ID: 949861791

View in Genome Browser
Species Human (GRCh38)
Location 3:8512119-8512141
Sequence ATGGCTTCAGAGTGAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949861791_949861792 -9 Left 949861791 3:8512119-8512141 CCTGAGCTTCACTCTGAAGCCAT 0: 1
1: 0
2: 2
3: 13
4: 190
Right 949861792 3:8512133-8512155 TGAAGCCATTTAATAACAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 189
949861791_949861794 26 Left 949861791 3:8512119-8512141 CCTGAGCTTCACTCTGAAGCCAT 0: 1
1: 0
2: 2
3: 13
4: 190
Right 949861794 3:8512168-8512190 AAGTAAGACTTTTTGATGTTAGG 0: 1
1: 0
2: 0
3: 34
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949861791 Original CRISPR ATGGCTTCAGAGTGAAGCTC AGG (reversed) Intronic
900010042 1:98282-98304 AAGGGTTCTGAGGGAAGCTCTGG - Intergenic
900026154 1:274866-274888 AAGGGTTCTGAGGGAAGCTCTGG - Intergenic
900035936 1:408719-408741 AAGGGTTCTGAGGGAAGCTCTGG - Intergenic
900057559 1:644470-644492 AAGGGTTCTGAGGGAAGCTCTGG - Intergenic
901021376 1:6257668-6257690 CTGACTTCAGAGTCAAGCTCTGG - Intronic
903002453 1:20275931-20275953 TTGGCTGCAGAGTGAAACTTTGG - Intergenic
903140508 1:21336026-21336048 AGGGCTACAGAGTGAATCTGGGG + Intronic
903240253 1:21978008-21978030 CTGGGTTCAAAGTGCAGCTCTGG - Intronic
903244001 1:22002642-22002664 CTGGGTTCAAAGTGCAGCTCTGG - Intronic
904919435 1:33995409-33995431 GTGGCTTCAGGGCTAAGCTCTGG + Intronic
907562893 1:55407100-55407122 AGGGCTTCAGATTGCAGTTCTGG + Intergenic
907681682 1:56569855-56569877 ATTGCAGCAGAGTGAAGCACAGG - Intronic
909217914 1:72915289-72915311 ATGTCTTCCAAGGGAAGCTCAGG - Intergenic
916471463 1:165127286-165127308 AGGGCTTCAGCGTGTAGTTCTGG - Intergenic
917076132 1:171207056-171207078 AGGGCTTCAGTGAGGAGCTCAGG + Intronic
922258474 1:223914287-223914309 AAGGGTTCTGAGGGAAGCTCTGG - Intergenic
923193305 1:231641339-231641361 CTGGCTCAAGAGTGAAGCTGCGG + Intronic
924339669 1:243017049-243017071 AAGGGTTCTGAGGGAAGCTCTGG - Intergenic
1064634804 10:17354150-17354172 AAGGCTTCTTTGTGAAGCTCTGG - Intronic
1066445594 10:35479921-35479943 TTGGCTTCAGTGTGAAGTTAGGG + Intronic
1067363350 10:45601752-45601774 CTGGCTTAGGAGTGAAGCTGCGG - Intergenic
1068100034 10:52541273-52541295 ATGTTATCAGAGTGGAGCTCAGG + Intergenic
1069824529 10:71246958-71246980 ACGGCTTCAGGGTGGGGCTCTGG - Intronic
1073462737 10:103676097-103676119 ATGGCATCAGACTTAAGCCCAGG + Intronic
1074873369 10:117595294-117595316 ATGTCTTCAGTGGGGAGCTCAGG - Intergenic
1076507155 10:130985759-130985781 ATGGCTGAAAAGCGAAGCTCAGG - Intergenic
1077390447 11:2298566-2298588 ATGCCTTCAGAGTGACCCCCCGG - Intronic
1077600678 11:3572447-3572469 GTGGTTTGAGAGTGCAGCTCTGG - Intergenic
1080212584 11:29804132-29804154 TTGGCTTCAGACTCTAGCTCAGG - Intergenic
1080270680 11:30448023-30448045 ATGTTTTCAGAGAGAAGCCCTGG + Intronic
1080563299 11:33484226-33484248 ATGGTTACAGAGTCAGGCTCAGG - Intergenic
1082794101 11:57367782-57367804 GTGGGTTCAGGGTGGAGCTCAGG + Intronic
1083263818 11:61537064-61537086 AAGGCTGCAGAATGAGGCTCTGG + Intronic
1083734950 11:64674856-64674878 ATGGGGTCAGTGTGAAGATCAGG - Intronic
1084024571 11:66439989-66440011 ATGGCTCAGGAGTGAAGCTGCGG + Intronic
1084274997 11:68046810-68046832 CTGGCTTCTGTGTGGAGCTCTGG + Intronic
1084816188 11:71648297-71648319 GTGGTTTGAGAGTGCAGCTCTGG + Intergenic
1087171014 11:95050328-95050350 GTGGCTTCACAGTGTAGCTGTGG + Intergenic
1090174072 11:124632107-124632129 AAGGCTGCAGGCTGAAGCTCTGG - Exonic
1091255895 11:134185108-134185130 ATGGCTTAGGAGTCAAGCTGTGG + Intronic
1091820204 12:3470524-3470546 ACGGCTTCACAGTGAGGCCCTGG - Intronic
1092426807 12:8381746-8381768 GTGGTTTGAGAGTGCAGCTCTGG - Intergenic
1092962609 12:13610503-13610525 ATGGCTTCTGGATGAAGCACAGG + Intronic
1093653756 12:21673398-21673420 ATGGCTCAGGAGTGAAGCTGCGG + Intronic
1095402917 12:41835488-41835510 ATAGCTTCAGAGAGAAGGTAGGG + Intergenic
1096911242 12:54986388-54986410 CAGGCTTTAGAGTGAAGCTCTGG + Intergenic
1096976737 12:55703641-55703663 CTGGCATCAGAGTGTGGCTCAGG + Intronic
1097141176 12:56903447-56903469 AGGGCTTCAAACTGAAGCTTGGG - Intergenic
1099726405 12:86433843-86433865 ATGAATTCATAGTGAAGGTCTGG - Intronic
1101820349 12:108179359-108179381 ATTGCTACAGTGTGATGCTCAGG - Intronic
1102799192 12:115716760-115716782 GTGGCTTCAAAGTGAACATCTGG + Intergenic
1102890456 12:116554689-116554711 ATGGGATCAGAGTCAAGCGCAGG + Intergenic
1103439049 12:120949606-120949628 CTGGCTCAAGAGTGAAGCTGCGG + Intergenic
1103472998 12:121196867-121196889 CTGTCTCCAGAGTGAAGCTTGGG - Intergenic
1105657722 13:22458695-22458717 AGAGCATCAGTGTGAAGCTCAGG + Intergenic
1107084199 13:36407995-36408017 ATGGGTCCAGAGGGAAGCTATGG + Intergenic
1114479329 14:23022398-23022420 GTGGCTTCAGAGCCAAGTTCTGG - Intronic
1115159572 14:30378275-30378297 TTGCATTCAGAGTGAATCTCAGG + Intergenic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1124855919 15:33388817-33388839 AGAGCTTCAGAGTGAAGCTGGGG + Intronic
1126013357 15:44325483-44325505 ATAGCTTCAGAATGAACCTGAGG - Intronic
1127612348 15:60649310-60649332 ATGGCTGCAGACAGAAGATCTGG + Intronic
1128687453 15:69697258-69697280 CTGGCTTCAAAGTGGAGCACAGG + Intergenic
1129073053 15:72967854-72967876 ATGGCTTTAGATAGAAGCCCAGG + Intergenic
1129983818 15:79898170-79898192 ATGGCTTGAGAGGGGAGTTCTGG + Intronic
1131186594 15:90279426-90279448 ATTGCTTCAAGGTTAAGCTCAGG + Intronic
1131200360 15:90390205-90390227 ATTGCTTCAAGGTTAAGCTCAGG + Intronic
1131546708 15:93321862-93321884 ATATTTTCACAGTGAAGCTCAGG + Intergenic
1132981571 16:2740844-2740866 ATGGCTTCATAGGGAAGCTGTGG + Intergenic
1134425572 16:14140669-14140691 AAGTCCTCAGAGTGAAGCTGTGG + Exonic
1135601139 16:23784598-23784620 CTGGCTTCAGATTGAGGTTCAGG - Intergenic
1137500404 16:49006830-49006852 ATGGATTCAGGGTGAAGCAAGGG + Intergenic
1140586055 16:76293147-76293169 CTGGCAACAGAGTGAGGCTCCGG - Intronic
1142376529 16:89709625-89709647 ATGGCCTCAGGGTAAAGCACAGG + Intronic
1142454288 16:90208622-90208644 AAGGGTTCTGAGGGAAGCTCTGG + Intergenic
1145965567 17:28914304-28914326 AGGGCTTCAGAGTGGTACTCTGG + Intronic
1146685701 17:34840248-34840270 CTGGCTTTAGAGTGAGACTCAGG - Intergenic
1147240392 17:39086924-39086946 ATGGCTTCAGCAGGAAGCTGGGG + Intronic
1147243588 17:39106380-39106402 CTGGCTTCAGAGTGGAGAACAGG - Intronic
1147375671 17:40021368-40021390 AAGGCTTCAGAGAAAAGTTCAGG + Intronic
1151624962 17:75270912-75270934 AAGGCTCCAGAATGGAGCTCAGG - Intronic
1152133509 17:78491200-78491222 ATGGGTTCAGAGTAAAGGCCTGG - Intronic
1153517430 18:5917125-5917147 ATGGCGACAGAGTGATGCCCAGG + Intergenic
1154108998 18:11549976-11549998 ATGGCATCATAGTGAAGTGCAGG - Intergenic
1155045686 18:22101201-22101223 CTGGCGAAAGAGTGAAGCTCTGG - Intergenic
1157740578 18:50089439-50089461 TTGGCTTCAGAGGGAATCTTTGG - Intronic
1159088200 18:63818340-63818362 AGGGCTGCAGTGTGCAGCTCAGG - Intergenic
1160217035 18:76941205-76941227 AGGGCTGTAGAGTGAAGCTTTGG + Intronic
1160844370 19:1159988-1160010 ATGGCTGCAGAGAGCAGCACTGG - Intronic
1161169136 19:2804345-2804367 AGGGCTCCAGTGAGAAGCTCTGG + Intronic
1162740449 19:12770855-12770877 ATGGCATCAGAGGGGAACTCTGG + Intronic
1163016400 19:14458113-14458135 CCAGCTCCAGAGTGAAGCTCTGG - Exonic
1168229249 19:55018486-55018508 ATGGGTGCAGAGTGGAGCTCTGG - Intronic
925449197 2:3953717-3953739 CTGGGTTCAGGGTGAAACTCTGG - Intergenic
927101300 2:19789569-19789591 CTGTTTTCAGAGTGCAGCTCTGG - Intergenic
927450106 2:23201679-23201701 ATGTCATCACAGTGGAGCTCTGG - Intergenic
931839817 2:66136412-66136434 ATGGCTTCAGAGGGACGCACTGG - Intergenic
932418648 2:71588515-71588537 ATGGTTCCAGGGTGAAGGTCAGG + Intronic
932654229 2:73594715-73594737 GTGCCTTCAGAGAGCAGCTCTGG - Intronic
933225973 2:79750138-79750160 ATTTCTTCATATTGAAGCTCTGG + Intronic
935135021 2:100292352-100292374 CTGGCATCAGAGTGCAGGTCTGG - Intronic
937056747 2:118943923-118943945 ATGGCTGGAGAGAGAAGCTGAGG + Intronic
937644230 2:124248353-124248375 CTGGCTTCATAGTGAAGTCCAGG - Intronic
938078708 2:128357533-128357555 CTGGCTGCAGAGTCAAGCACAGG - Intergenic
938611253 2:132949559-132949581 GGGGCTTCAAGGTGAAGCTCAGG - Intronic
939275037 2:139989992-139990014 CTGGCTCAAGAGTGAAGCTGCGG + Intergenic
940734234 2:157430784-157430806 ATGTTTTGAGAGTGAAGGTCAGG - Intronic
940790484 2:158025780-158025802 ATGTCTTCCGTGTGAGGCTCTGG - Intronic
946553201 2:220824900-220824922 AGGGATGCAGAGAGAAGCTCTGG - Intergenic
949085746 2:242153277-242153299 AAGGGTTCTGAGGGAAGCTCTGG + Intergenic
1170310649 20:14987927-14987949 AAGTCTTCAGAGTGAAGCTCTGG + Intronic
1170844601 20:19951800-19951822 ATGGCCACAGAGCCAAGCTCAGG - Intronic
1171210094 20:23310340-23310362 ATGGTGTCTGGGTGAAGCTCTGG - Intergenic
1172354536 20:34270226-34270248 TTGGCCACAGAGTGAAACTCTGG + Intergenic
1172943983 20:38674112-38674134 AGGGCTTCAGGGTGCAGCCCTGG + Intergenic
1173857242 20:46258320-46258342 ATGGCTCAAGACTGAGGCTCAGG + Intronic
1175628500 20:60510686-60510708 CTGGCTTCAGAGGGAAGCTGCGG + Intergenic
1179138038 21:38697843-38697865 GTGTCTTCACAGTGAGGCTCTGG - Intergenic
1179367718 21:40773682-40773704 ATGGCATCAGAGGGAAAATCAGG - Intronic
1183119087 22:35715790-35715812 CTGCCTTCAAGGTGAAGCTCCGG + Intergenic
949507926 3:4744157-4744179 ATGTCTTCAGAGAGAACCTCAGG + Intronic
949861791 3:8512119-8512141 ATGGCTTCAGAGTGAAGCTCAGG - Intronic
949938436 3:9135572-9135594 AAGGCTTCACAGTGCAGATCCGG - Intronic
952932207 3:38369098-38369120 ATGGCTTCAGAATGGAGCCTGGG + Intronic
954107769 3:48418557-48418579 GTGGGTTCAGAGTCAAGCACTGG + Intronic
955747461 3:62154390-62154412 AGGGCTTCAGAGGCAAGCTCTGG - Intronic
956172593 3:66444379-66444401 ATGGCTTCTGAGAAAGGCTCTGG - Intronic
956934445 3:74084057-74084079 AGGGCTTCAGAGGGAAGGTGAGG + Intergenic
957002111 3:74899274-74899296 CTGGCTTAAGTGTGAAGCTGCGG + Intergenic
957071493 3:75571062-75571084 GTGGTTTGAGAGTGCAGCTCTGG - Intergenic
957485403 3:80855328-80855350 ATGGCTTCAGAGTGAAGGAAGGG - Intergenic
958631532 3:96689639-96689661 ATGGCTTCAGGCTGATTCTCAGG - Intergenic
959944632 3:112113860-112113882 ATTGCTTTGTAGTGAAGCTCTGG + Intronic
961282634 3:125775679-125775701 GTGGTTTGAGAGTGCAGCTCTGG + Intergenic
967287562 3:187888246-187888268 ATGTCTTCTCAGGGAAGCTCAGG - Intergenic
967873116 3:194248685-194248707 CTGGCTTCAAAGTCATGCTCTGG - Intergenic
968469856 4:774877-774899 ATGGCTCAGGAGTGAAGCTGTGG - Intergenic
969015102 4:4098753-4098775 GTGGTTTGAGAGTGCAGCTCTGG - Intergenic
971852284 4:31997609-31997631 CTGGCTCAAGAGTGAAGCTGCGG - Intergenic
972809975 4:42572878-42572900 ATGGCTTCTGACTGTATCTCAGG + Intronic
975898581 4:79122902-79122924 CTGGCTCAAGAGTGAAGCTGCGG - Intergenic
979237445 4:118418178-118418200 AAGGGTTCTGAGAGAAGCTCTGG + Intergenic
981209778 4:142089239-142089261 CTGACTTCAGAAAGAAGCTCAGG - Intronic
982173486 4:152683636-152683658 CTGGCTTCAGAGTGATACACAGG - Intergenic
984438166 4:179729664-179729686 ATAGCTTCAGAGGGATACTCAGG + Intergenic
985710931 5:1429407-1429429 AGGGCTTCTGAGTGAAGGGCTGG + Intronic
986442207 5:7792458-7792480 ATGGGCTCAGAGGAAAGCTCTGG + Intronic
986493875 5:8322181-8322203 ATGGTTTCAGAGTTAGGCTTTGG - Intergenic
992800110 5:80288325-80288347 TGGGCAACAGAGTGAAGCTCTGG + Intergenic
993126758 5:83844727-83844749 ATGACTTCAGAGGGAAGGTGGGG + Intergenic
994615854 5:102103405-102103427 AAGGATTCAGAGTTTAGCTCAGG + Intergenic
995333588 5:110973955-110973977 ATGGCTTAAGAGTGAAAGTTAGG - Intergenic
998360744 5:141584555-141584577 ATCTCTTCAGACTGAAGCACTGG + Intronic
999460393 5:151752713-151752735 ATGGCTTCAGATACCAGCTCTGG + Intronic
1000843549 5:166251592-166251614 TGGGCAACAGAGTGAAGCTCTGG + Intergenic
1002737885 5:181410145-181410167 AAGGGTTCTGAGGGAAGCTCTGG + Intergenic
1003362817 6:5444888-5444910 TTGGCCTCAGAGTGAAGACCTGG + Intronic
1005808384 6:29496426-29496448 GTGGCATCAGAGTCAAACTCTGG - Intergenic
1009496164 6:64350651-64350673 AAGGATTCAGCGTAAAGCTCTGG + Intronic
1010553356 6:77250257-77250279 ATGGCTTCAGAATGAAGCACTGG + Intergenic
1011107199 6:83795791-83795813 ATGGCTTCAGAGGTAAGCAGAGG - Intergenic
1011993209 6:93550287-93550309 ATGGTTTATGAGTGAAGCTGGGG - Intergenic
1014119540 6:117707623-117707645 ATGACTTGAGAGTGTTGCTCTGG + Exonic
1014119547 6:117707694-117707716 ATGACTTGAGAGTGTTGCTCTGG + Exonic
1014131477 6:117839393-117839415 ATGGTTTAAGAATGAAACTCGGG - Intergenic
1015035568 6:128650117-128650139 AGGGCTGCAGAGTGAAGATCAGG + Intergenic
1015203248 6:130605827-130605849 TTGGCTTTAGAGTGAAGGTGTGG - Intergenic
1016533028 6:145078979-145079001 ATGGGTTCAGAGTGACTCTGGGG + Intergenic
1017131990 6:151115410-151115432 TCGCCTTCAGAGTGAAACTCAGG + Intergenic
1019242984 6:170685703-170685725 AAGGGTTCTGAGGGAAGCTCTGG + Intergenic
1021689073 7:23214614-23214636 ATGGCTTCAGGGTGAAGATTTGG - Intergenic
1023611224 7:41972838-41972860 ATGGCTTGAGAGAGAGGCTCAGG + Intronic
1024348392 7:48336675-48336697 ATGGATTCAGAGTGCAGCAGTGG + Intronic
1024466524 7:49717100-49717122 AGGGCATCACAGTGAAGCTGTGG + Intergenic
1025954863 7:66175126-66175148 ATGGTTTCAAAGTGCAGCTGGGG + Intergenic
1031427315 7:121621387-121621409 ATGGTTTAAGGGTGCAGCTCAGG - Intergenic
1032163122 7:129525848-129525870 ATGGCTCCAGAGAGAAAGTCTGG - Intergenic
1035505137 8:122459-122481 AAGGGTTCTGAGGGAAGCTCTGG - Intergenic
1035994318 8:4529167-4529189 ATGGCTTCTGAGAGTACCTCAGG - Intronic
1036243926 8:7100883-7100905 GTGGTTTGAGAGTGCAGCTCTGG + Intergenic
1036256873 8:7213168-7213190 GTGGTTTGAGAGTGCAGCTCTGG - Intergenic
1036308923 8:7671767-7671789 GTGGTTTGAGAGTGCAGCTCTGG - Intergenic
1036360616 8:8074344-8074366 GTGGTTTGAGAGTGCAGCTCTGG + Intergenic
1036890354 8:12592622-12592644 GTGGTTTGAGAGTGCAGCTCTGG - Intergenic
1036897922 8:12650539-12650561 GTGGTTTGAGAGTGCAGCTCTGG - Intergenic
1038307700 8:26419808-26419830 GTGGCTGCAGAGTGAGGTTCTGG - Intronic
1041828407 8:62124584-62124606 ATGGCTACAGAATGAAGCAAAGG + Intergenic
1044008281 8:86963420-86963442 AGGGCTTCAAACTGAAGCTTCGG + Intronic
1044274674 8:90285770-90285792 TTGGCTTGAGAGTGTAGCTTTGG - Intergenic
1047167987 8:122462094-122462116 GTGGCTTCAGAGTACAGCTGGGG - Intergenic
1048165212 8:132056170-132056192 CAAGCTTCAGAGTCAAGCTCTGG - Intronic
1049375284 8:142286533-142286555 ATGGCTTCAGTGTGCATCTGTGG + Intronic
1055733381 9:79302517-79302539 ATGGCTTTAATGTGAACCTCAGG + Intergenic
1058015969 9:100032241-100032263 CTGGCTTCAGGGTGGAGCCCTGG - Intronic
1203603173 Un_KI270748v1:34927-34949 AAGGGTTCTGAGGGAAGCTCTGG + Intergenic
1185513094 X:677645-677667 ATGGGTTCAGAGAGACCCTCTGG + Intergenic
1186915940 X:14220723-14220745 ATGTCCTCAGAGTGAACCTTGGG + Intergenic
1188113383 X:26217157-26217179 TCTGCTTCAGAGTGGAGCTCAGG + Exonic
1190099563 X:47511901-47511923 ATGACTTGAGAGTGTTGCTCTGG - Intergenic
1190099570 X:47511972-47511994 ATGACTTGAGAGTGTTGCTCTGG - Intergenic
1192147368 X:68690482-68690504 AGGGTCTCAGAGTGAGGCTCAGG + Intronic
1193425404 X:81336623-81336645 AGGGCTGCAGTGTGCAGCTCTGG - Intergenic
1193773987 X:85620738-85620760 AAGGCTGCAGTGTGCAGCTCAGG + Intergenic
1197533865 X:127663556-127663578 AGGGCTTCAGTGTGCAACTCAGG + Intergenic
1197775772 X:130117869-130117891 GTGTCCTCAGAGTGAAGCTGGGG + Intergenic
1198127248 X:133657661-133657683 ATGGGTTCAGAGCCAGGCTCAGG - Intronic