ID: 949862484

View in Genome Browser
Species Human (GRCh38)
Location 3:8518834-8518856
Sequence TGGCGTAACCAGAGGAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949862484 Original CRISPR TGGCGTAACCAGAGGAGGCT AGG Intronic
905275958 1:36818455-36818477 TGGAGCAACCTGGGGAGGCTGGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
907307522 1:53521629-53521651 TGGGGTGACCAGATGGGGCTCGG - Intronic
910663573 1:89700273-89700295 TGGAGTAAGCAGGGTAGGCTTGG - Intronic
914244644 1:145876622-145876644 AGGCACAGCCAGAGGAGGCTGGG + Exonic
917488650 1:175478574-175478596 AGGTGTCCCCAGAGGAGGCTGGG - Intronic
1063122565 10:3115074-3115096 AGGCATAAACAGAGGAGGCAAGG + Intronic
1065491202 10:26283590-26283612 TGGTTTAACTAGAGGAGGGTGGG - Intronic
1067237285 10:44461630-44461652 TGGAGTAACCACAGAAGGCAAGG - Intergenic
1067973023 10:50992651-50992673 TGGGGTGTGCAGAGGAGGCTGGG + Intronic
1070949412 10:80418943-80418965 TGGCATCTGCAGAGGAGGCTGGG - Intronic
1071958236 10:90782176-90782198 TGTCGTATCCTGAGGAGTCTGGG - Intronic
1072465122 10:95656290-95656312 TGGTGTACCCAGGGGAGGCCGGG + Intronic
1076448259 10:130533866-130533888 TGGGGGAGCAAGAGGAGGCTGGG - Intergenic
1077408431 11:2392791-2392813 GGGCGTTAAGAGAGGAGGCTGGG + Intronic
1077956077 11:7020865-7020887 TGGAGTCTCCAGAGGAGCCTGGG - Intronic
1080694190 11:34586687-34586709 TGGCGTGTCCTCAGGAGGCTTGG + Intergenic
1083052670 11:59791096-59791118 GGGGGTAGCCAGAGGAGGCTGGG + Intronic
1088223278 11:107591415-107591437 TGGCGACCCCAGAGGAGCCTAGG + Intronic
1093895661 12:24571785-24571807 TGGCATAACCTAAGGATGCTAGG - Intergenic
1093923361 12:24884322-24884344 GGTGGTTACCAGAGGAGGCTAGG + Intronic
1095494446 12:42769894-42769916 TGGCGAACCCAGAGAAGGCATGG + Intergenic
1096649412 12:53054512-53054534 TGACGTCACCAGCGGAGGCGAGG + Intronic
1106911074 13:34464265-34464287 TGGCACAACCATAGGAGGCAGGG - Intergenic
1107018811 13:35731039-35731061 TGGCACACCCAGAGGGGGCTTGG - Intergenic
1107520402 13:41174927-41174949 TGTAGCAACCAGAGGAGGGTAGG + Intergenic
1107534985 13:41320490-41320512 AGACGAAACCAGAGCAGGCTGGG - Intronic
1112226285 13:97543858-97543880 TGCTGTAACCAGAAGAGGCAAGG - Intergenic
1115957155 14:38794157-38794179 TGGGGGAACTGGAGGAGGCTGGG - Intergenic
1116769080 14:49106463-49106485 TCTGGTAACCAGAGCAGGCTAGG + Intergenic
1122451303 14:101810157-101810179 AGACTTAACCAGAGGAGGTTGGG + Intronic
1135647405 16:24175209-24175231 TGGCATAGCCAGGGCAGGCTTGG + Intronic
1138194619 16:55043238-55043260 GGGCATCACCAGAGGGGGCTCGG + Intergenic
1139344307 16:66292655-66292677 TGCTGCAACCAGAGGAGCCTTGG + Intergenic
1139785445 16:69388588-69388610 TGGGATAACCAGAGGATGATGGG + Intronic
1142285896 16:89171428-89171450 GGGCGGAGCCAGAGGAGGATGGG - Intergenic
1142868104 17:2803334-2803356 TTGCGTAACCAGATGACACTGGG - Intronic
1147907649 17:43833218-43833240 TGGCGGAGCCTGAGGAGGCGCGG + Intergenic
1153845736 18:9048395-9048417 TGGCTTCAGCAGAGGAGGGTGGG - Intergenic
1158859643 18:61579997-61580019 TGGGGGGTCCAGAGGAGGCTTGG + Intergenic
1160064512 18:75562294-75562316 TGGAGTGAGCAGTGGAGGCTGGG + Intergenic
1162200288 19:9015085-9015107 TGGCGGAGACAGAGGAGGCAGGG + Intergenic
1163687786 19:18721935-18721957 GGGCAGACCCAGAGGAGGCTGGG - Intronic
1164986678 19:32653478-32653500 TGGCGTCCTCAGAGCAGGCTGGG - Intronic
1167237161 19:48322018-48322040 GGGTGTAACCAGAGGGGGCGTGG - Intronic
1168326107 19:55539227-55539249 TGCCGACACCAGGGGAGGCTGGG - Intergenic
927992747 2:27459771-27459793 TGGTGAAACTAGAGGAGGCATGG - Exonic
930833392 2:55769782-55769804 TGAAGAACCCAGAGGAGGCTGGG + Intergenic
937264433 2:120607071-120607093 AGGCTGAGCCAGAGGAGGCTGGG + Intergenic
938160101 2:128978177-128978199 TGGTGTAAGCACAGGAGCCTTGG + Intergenic
940363449 2:152820071-152820093 TGGCAGAACCAGAGCAGGGTAGG + Intergenic
941199472 2:162491159-162491181 TGGCTCAACCAGAGGAGGAAAGG - Intronic
946149395 2:217753943-217753965 TATTGTAACCAGAGGAGACTGGG - Intronic
946394233 2:219435191-219435213 TCCCGGAACCAGCGGAGGCTGGG - Exonic
1169272054 20:4208042-4208064 TGGCACACCCAGAGGAGGCGTGG + Intergenic
1171493504 20:25538462-25538484 TTCCTTACCCAGAGGAGGCTGGG - Intronic
1172617377 20:36298208-36298230 TGGGGTCACCAGAGGATGCACGG + Intergenic
1172897301 20:38309445-38309467 TGGGCTTAGCAGAGGAGGCTTGG + Intronic
1173271931 20:41544378-41544400 TGTCTTGACCAGAGGAGTCTGGG - Intronic
1174513921 20:51076673-51076695 TGGAGTCAGCAGAGGAGGCGGGG + Intergenic
1175755085 20:61524411-61524433 TGTCGTCAGCAGAGGAAGCTGGG + Intronic
1176209861 20:63914026-63914048 TGGGGGGACCACAGGAGGCTGGG + Intronic
1179541747 21:42087387-42087409 TGGAGTTCCCAGTGGAGGCTTGG + Intronic
1181270835 22:21657679-21657701 TGGGGTCACCAGGGGAGGCGGGG - Intronic
949862484 3:8518834-8518856 TGGCGTAACCAGAGGAGGCTAGG + Intronic
951881478 3:27484502-27484524 GGGCGTGACCCGAGGAGGCGGGG - Intergenic
954363099 3:50132820-50132842 GGGGGTTAACAGAGGAGGCTGGG - Intergenic
957026989 3:75193305-75193327 TGGCATACCCAGAGAGGGCTGGG - Intergenic
962426336 3:135272042-135272064 TGCAGTACCCAGAGGAGCCTGGG - Intergenic
972318218 4:37947575-37947597 TGGTGTAACCTGGGGAGGTTGGG - Intronic
973027043 4:45284935-45284957 TGGCGGCAGCAGAGGAGGCATGG - Intergenic
988778787 5:34500473-34500495 TCTGGTAACCAGAGGAGGATGGG - Intergenic
989752777 5:44915810-44915832 TGGCCTAACAAGAGGAGTTTAGG + Intergenic
990862606 5:60343750-60343772 TGGTGTAACTGGAGGAGGCATGG - Intronic
992319827 5:75602489-75602511 TGGAGTAACCTGAGGCTGCTAGG + Intergenic
992720943 5:79560590-79560612 TGGCTAAACAGGAGGAGGCTCGG + Intergenic
998548942 5:143057928-143057950 TGGCCTTCCCAGAGGATGCTGGG + Intronic
1000335298 5:160237599-160237621 AGGTGGAATCAGAGGAGGCTGGG - Intronic
1001902868 5:175445468-175445490 TGGGGCAACCAGGGGAGGCTGGG - Intergenic
1003598560 6:7496734-7496756 TGGAGCAACCAGGGGAAGCTGGG + Intergenic
1006491943 6:34395106-34395128 AGGCTTAACTAAAGGAGGCTGGG + Intronic
1007162622 6:39804125-39804147 TCCCATAAACAGAGGAGGCTGGG - Intronic
1007416712 6:41695247-41695269 TGGCCTGACCAGAGGAGACCGGG - Intronic
1010013265 6:71074408-71074430 TTGAGGAGCCAGAGGAGGCTTGG + Intergenic
1010123301 6:72405052-72405074 TGGGGTAATCGGAGGAGGCAGGG - Intergenic
1019617893 7:1974831-1974853 TCGGGTAACCTGAGGATGCTGGG + Intronic
1021423307 7:20470022-20470044 CAGTGTAGCCAGAGGAGGCTGGG - Intergenic
1023485940 7:40686956-40686978 TGGAGTAACCTGAGGAAGGTGGG - Intronic
1028242029 7:88433306-88433328 TGGAATAATGAGAGGAGGCTGGG + Intergenic
1032314931 7:130828962-130828984 TGGGGTATCCAATGGAGGCTGGG - Intergenic
1036205071 8:6799591-6799613 TGGCGATAACAGGGGAGGCTCGG - Intergenic
1043843217 8:85133808-85133830 TGGCATAAACAGAGGGGGGTAGG - Intronic
1049439533 8:142602823-142602845 TGGAGGGACCAGAGGGGGCTAGG + Intergenic
1057206385 9:93175523-93175545 TGGTCTGATCAGAGGAGGCTGGG + Intergenic
1057975466 9:99601602-99601624 TGGTGCAACCAGACAAGGCTGGG + Intergenic
1059615326 9:115944603-115944625 TTGCGTAATCTGAGGAGGCTGGG + Intergenic
1059699046 9:116757486-116757508 TTGCTTGACCAGAGGAGGATGGG + Intronic
1061999053 9:134206943-134206965 TGCTGCAGCCAGAGGAGGCTGGG - Intergenic
1062026778 9:134344226-134344248 TGCCGGTGCCAGAGGAGGCTGGG - Intronic
1197248920 X:124194292-124194314 TGGGGTAACCACAGGAGGAATGG - Intronic