ID: 949865462

View in Genome Browser
Species Human (GRCh38)
Location 3:8543311-8543333
Sequence CCCAGGGTTGGGGCTTCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949865462_949865470 2 Left 949865462 3:8543311-8543333 CCGAGAGAAGCCCCAACCCTGGG 0: 1
1: 0
2: 0
3: 29
4: 301
Right 949865470 3:8543336-8543358 ATCCTGTGTCAGAGCCACCCAGG 0: 1
1: 0
2: 1
3: 18
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949865462 Original CRISPR CCCAGGGTTGGGGCTTCTCT CGG (reversed) Intronic