ID: 949866041

View in Genome Browser
Species Human (GRCh38)
Location 3:8548556-8548578
Sequence TACTGCAGTCCCTAGGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949866041_949866050 16 Left 949866041 3:8548556-8548578 CCTCCTCCCTAGGGACTGCAGTA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 949866050 3:8548595-8548617 AAGGAGAAGCAGCCAGTGACAGG 0: 1
1: 0
2: 5
3: 26
4: 441
949866041_949866046 -3 Left 949866041 3:8548556-8548578 CCTCCTCCCTAGGGACTGCAGTA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 949866046 3:8548576-8548598 GTACATGGAGCTCATCCCCAAGG 0: 1
1: 0
2: 0
3: 29
4: 134
949866041_949866052 25 Left 949866041 3:8548556-8548578 CCTCCTCCCTAGGGACTGCAGTA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 949866052 3:8548604-8548626 CAGCCAGTGACAGGCACAGAGGG 0: 1
1: 0
2: 2
3: 53
4: 468
949866041_949866051 24 Left 949866041 3:8548556-8548578 CCTCCTCCCTAGGGACTGCAGTA 0: 1
1: 0
2: 0
3: 11
4: 153
Right 949866051 3:8548603-8548625 GCAGCCAGTGACAGGCACAGAGG 0: 1
1: 0
2: 2
3: 45
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949866041 Original CRISPR TACTGCAGTCCCTAGGGAGG AGG (reversed) Exonic
900645801 1:3708175-3708197 TTCTGCAGACCCTAGGGCTGTGG - Intronic
903809500 1:26027462-26027484 TACTGCAGTCCACTGGGAGGTGG + Intronic
904418184 1:30375396-30375418 TCCTGCAGACCCGAGGGTGGGGG + Intergenic
907315909 1:53572492-53572514 CACTGCAGCCCAAAGGGAGGTGG - Intronic
915557818 1:156670029-156670051 TCCTGGGGTCCCTGGGGAGGTGG - Exonic
920650919 1:207836788-207836810 TTCTGCAGGCCCCAGGGAGATGG - Intergenic
920692206 1:208155513-208155535 GACTCCAGTCCCTGGAGAGGTGG - Intronic
920779067 1:208970325-208970347 TACTGCAGTAGCTGGGGAGCAGG + Intergenic
920959858 1:210654746-210654768 CAGTGCAGCCCCTAGGAAGGAGG + Intronic
924179164 1:241424120-241424142 CACTGCAGCCCCCAGGGCGGCGG - Intergenic
1064600671 10:16989166-16989188 TACAGCAGTCCCTAGAGCTGAGG + Intronic
1067565252 10:47331567-47331589 TACAGCAGCCCTCAGGGAGGTGG + Intergenic
1068424890 10:56847157-56847179 TATTGCATTCCCTAGAAAGGGGG + Intergenic
1068483694 10:57628663-57628685 TACTACAGTCCCTAAGGAGTAGG - Intergenic
1070817018 10:79331139-79331161 TACTGCAGTCTCTAAGGTAGGGG + Intergenic
1074752850 10:116603504-116603526 AACTGCATTGCCCAGGGAGGAGG - Intronic
1075837691 10:125469726-125469748 TACTGGAGTCCAGAGGGTGGAGG - Intergenic
1075903464 10:126061966-126061988 CACTGCACTCCCAAAGGAGGTGG + Intronic
1078573005 11:12475625-12475647 TCCTCCAGTCCCTAGTGAGATGG - Intronic
1079137593 11:17784755-17784777 GACTGCAGTGCGGAGGGAGGAGG - Intergenic
1079400786 11:20104788-20104810 TCCTGCAGGCCATAGGGAGCTGG - Intronic
1080280772 11:30554368-30554390 TACTGCAGTCCCTGGAGTTGTGG - Intronic
1089306387 11:117528933-117528955 TACTACATTCCCAAGGGGGGGGG - Intronic
1090900509 11:131026732-131026754 TATCGCAGCCCCTAGGAAGGAGG + Intergenic
1096492740 12:52021847-52021869 TACAGCAGTCAGTAGGGTGGGGG + Intergenic
1098228632 12:68350446-68350468 TAGCTCAGTCCCTAGGGAAGAGG - Intergenic
1098326858 12:69312281-69312303 TACTACTCTCCCTGGGGAGGTGG + Intergenic
1100394629 12:94174025-94174047 TACTGCAGTCCCTGGGAGGTCGG - Intronic
1100799010 12:98212013-98212035 TGCTGCAGTCCCAGGGGAGTGGG + Intergenic
1101845568 12:108360578-108360600 TCCCACAGTCCCCAGGGAGGTGG - Intergenic
1104744649 12:131203183-131203205 TATTGCTGTCCCTGGGGAGACGG + Intergenic
1104761715 12:131300814-131300836 TCCTGGAGTCCCTGGGAAGGAGG - Intergenic
1104818058 12:131659971-131659993 TCCTGGAGTCCCTGGGAAGGAGG + Intergenic
1105723159 13:23135674-23135696 TACCCCAGTCCCAAGGAAGGTGG + Intergenic
1110232958 13:73185642-73185664 TACAGAAGGCTCTAGGGAGGAGG + Intergenic
1110417386 13:75268140-75268162 TGCTGCAGCTCCTTGGGAGGAGG - Intergenic
1112467513 13:99656858-99656880 TACTGCTGGCTCTAGGAAGGAGG + Intronic
1113420402 13:110166827-110166849 AACTGCAGTGCCTGGGGAGCTGG + Intronic
1116603713 14:46962314-46962336 TCCTGCACTCCCTTGGGAGTGGG + Intronic
1119073912 14:71616549-71616571 TACCTGAGTCCCTAGGAAGGAGG + Intronic
1119139315 14:72251331-72251353 TAATGAAATTCCTAGGGAGGGGG + Intronic
1121178291 14:91907347-91907369 TGCTGCAGTCCAGAGGCAGGTGG - Intronic
1121433597 14:93904126-93904148 GACTGCACTCCCTGGGGATGGGG + Intergenic
1124371828 15:29108424-29108446 CACTGCAGGGCCCAGGGAGGGGG + Intronic
1125334119 15:38611027-38611049 TGCAGCAGTCTCTTGGGAGGTGG + Intergenic
1127730606 15:61798618-61798640 TTCTACAGCCCCCAGGGAGGGGG - Intergenic
1130815747 15:87430577-87430599 TAATGCACTCCCTAGGATGGGGG + Intergenic
1131446683 15:92504104-92504126 GACTGCAGATCCCAGGGAGGAGG + Intergenic
1131534227 15:93220966-93220988 TTCTGCAGTCCATGGGGAGTTGG - Intergenic
1133270568 16:4609226-4609248 CTCTGCATTCCCTAGGGTGGGGG + Exonic
1133892788 16:9896660-9896682 GTCTTCAGTCCCTTGGGAGGGGG + Intronic
1139718791 16:68836218-68836240 TTCTGGAGTACCTGGGGAGGTGG + Intergenic
1141161871 16:81634612-81634634 TCCTGCCCTCCCTGGGGAGGCGG - Intronic
1141811863 16:86381301-86381323 GAGTGCAGTCCCTCTGGAGGTGG - Intergenic
1146611284 17:34307213-34307235 GAATGCATTCCCTGGGGAGGTGG - Intergenic
1148199364 17:45739852-45739874 TCCTGCAGGCCCCAGGGAGGGGG + Intergenic
1148212729 17:45818030-45818052 TTCTGGAGCCCCTAGGAAGGAGG + Intronic
1150218739 17:63484221-63484243 TTCTGCAGTCCATTGGGGGGCGG + Intergenic
1151619587 17:75237770-75237792 TGCTGCCATCCCCAGGGAGGTGG - Exonic
1154033613 18:10776669-10776691 TACTGCATTCCCTGAGGAGTGGG + Intronic
1155414365 18:25581512-25581534 AACACCACTCCCTAGGGAGGTGG + Intergenic
1160276528 18:77442726-77442748 GACTGCAGACCTGAGGGAGGAGG - Intergenic
1160624118 18:80191245-80191267 TCCTGCAGGTCCTGGGGAGGTGG - Intronic
1161320586 19:3639009-3639031 TACTCCTGTCCCCAGGGTGGAGG - Exonic
1161367793 19:3890965-3890987 TTCTGCAGTCCCCAGGGGAGGGG - Intronic
1162985101 19:14264903-14264925 AACTGTAGTCCCTAGGGATAAGG + Intergenic
1165472115 19:36009756-36009778 CTCTGCCGTCCCTCGGGAGGGGG + Intronic
1165476120 19:36032189-36032211 TACCGTAGTCCTTAGGGAGGGGG + Exonic
1166179291 19:41095666-41095688 GGCTGCACTCTCTAGGGAGGAGG - Intronic
1166874931 19:45891245-45891267 TCCTGCACTCCCCAGGAAGGGGG - Exonic
925367964 2:3324174-3324196 TCGTGCAGTGCCTGGGGAGGAGG - Intronic
925477362 2:4232209-4232231 TACTGCAGTTCCCAAAGAGGAGG + Intergenic
926699027 2:15790425-15790447 CACTGCAGTCCCAGGGGAGGTGG - Intergenic
927257093 2:21049035-21049057 TACTGGAGTCTCTGGGGAGAAGG + Intergenic
930469388 2:51793617-51793639 TTCTGGAGTCCAGAGGGAGGTGG + Intergenic
930728872 2:54709135-54709157 TACAGCTGTCCCTGGGAAGGCGG - Intergenic
932109246 2:68979937-68979959 TACATCAGGCCCTTGGGAGGTGG - Exonic
932215294 2:69962405-69962427 TGCTGCAGTGCCTGGGGAAGGGG - Intergenic
944186949 2:196959524-196959546 TACTGGATTCCACAGGGAGGTGG + Intergenic
944772972 2:202932742-202932764 GACTGCACTCCCTACGGAGAAGG + Intronic
946076493 2:217077824-217077846 CACAGCTGTCCCTAGGGAGGTGG + Intergenic
948855527 2:240728616-240728638 CACTGCAGACCCCAGGGAAGGGG - Intronic
1170230171 20:14037760-14037782 TACTCCAGCACCTTGGGAGGAGG + Intronic
1170476024 20:16715249-16715271 AATTCCAGTCACTAGGGAGGGGG - Intergenic
1173252584 20:41372375-41372397 TACTGCAGTGACTAGAAAGGAGG - Intergenic
1175864273 20:62166249-62166271 GCCTGCAGTCCCTGGGGAGAGGG + Intronic
1179250418 21:39667097-39667119 TCCTGCAGCCTCCAGGGAGGTGG - Exonic
1181037754 22:20178142-20178164 CCCTGCAGCCCCAAGGGAGGAGG + Intergenic
1181497344 22:23295003-23295025 TCCTGCAGCCCCAAGGGAGAAGG - Exonic
1182983818 22:34698108-34698130 TAATCCAGTTCCTAGGAAGGAGG + Intergenic
949866041 3:8548556-8548578 TACTGCAGTCCCTAGGGAGGAGG - Exonic
951766672 3:26207104-26207126 TACTGCACACCCTAGGGTAGAGG - Intergenic
951868540 3:27334148-27334170 AACTTCAGGCCCTTGGGAGGAGG - Intronic
953927172 3:46988374-46988396 GACTGCAGGCATTAGGGAGGTGG + Intronic
954359989 3:50116641-50116663 TTCAGCAGTCGCTGGGGAGGTGG - Intronic
956344851 3:68267050-68267072 TAATGCGTTCCCTAGGGAGGAGG - Intronic
956452644 3:69389696-69389718 CACTGCAGTCCCTGGAGTGGAGG - Intronic
960097078 3:113699099-113699121 CACAGTAGTCCCTAGGAAGGAGG - Intergenic
960451642 3:117816971-117816993 GACTGCAGTTTCTAGGGAGAAGG - Intergenic
962040293 3:131700216-131700238 TAATGCAGTCAATTGGGAGGTGG + Intronic
963931636 3:151009748-151009770 TACTGCAGTACCAAAGGAAGTGG - Intergenic
965608210 3:170517749-170517771 TAATGGAATCCCTAGGGAGGAGG - Intronic
970494239 4:16609328-16609350 TACTGAACTCCCAGGGGAGGGGG + Intronic
971431814 4:26576429-26576451 AACTGCAGCCCCTGGGGAGAAGG - Intronic
984036006 4:174668476-174668498 TACTTCAGTCCACATGGAGGTGG + Intronic
987287546 5:16472716-16472738 TGCTGCTGTCCCTAGAGAGCTGG + Intergenic
987317689 5:16739075-16739097 TACTCCAGTGCCGAGGCAGGAGG + Intronic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
992776007 5:80089966-80089988 TTCTGCAGTCCATAGGTAAGGGG - Intergenic
992996657 5:82340562-82340584 AACTGCAGTTACTAGTGAGGTGG - Intronic
993628733 5:90258197-90258219 TATATCAGTCCCTAGGAAGGAGG - Intergenic
997425876 5:133802256-133802278 TTCTGCAATTCCTAAGGAGGAGG + Intergenic
997771211 5:136556190-136556212 GACTTCACTCCCTATGGAGGAGG + Intergenic
998108124 5:139481449-139481471 CACTGCAGTACCCAGGGACGGGG - Intronic
998205454 5:140154125-140154147 TACTGCATTCAGGAGGGAGGAGG + Intergenic
1001743809 5:174074602-174074624 CACTGCAGCCCCTAGGAAGCAGG - Intronic
1002352769 5:178595066-178595088 AACTGGAGTCCCTGGGGAAGAGG + Intergenic
1002461473 5:179375960-179375982 GACTCCAGCCCCTGGGGAGGAGG + Intergenic
1002653181 5:180719229-180719251 GACTGCTGTCCTTACGGAGGAGG + Intergenic
1004128114 6:12893563-12893585 TACAGCAGGTCCAAGGGAGGAGG - Intronic
1005348979 6:24915857-24915879 AACTGCAGTGCCAAGGGAGCTGG - Intronic
1006232617 6:32596868-32596890 CACTGCAGTCACTGGGGAGTGGG - Intergenic
1006850159 6:37092603-37092625 TGCTGCAGGCCTTAGGGAGGTGG - Intergenic
1007077287 6:39075817-39075839 TGCTGCAGTCCCCAGGCAGTTGG + Intronic
1007384187 6:41509640-41509662 CTCTGCAGACCGTAGGGAGGAGG + Intergenic
1008657546 6:53631155-53631177 TACTGCAGTCCCTTGGGGCGAGG - Intergenic
1017963888 6:159246926-159246948 CACTGCAGTACCTACGGAAGAGG + Exonic
1019344387 7:522272-522294 CATTGCAGCCCCTGGGGAGGGGG + Intergenic
1022965592 7:35468494-35468516 TATGGCAGCCCCTGGGGAGGTGG - Intergenic
1023385409 7:39652106-39652128 TGCTGCATCCTCTAGGGAGGAGG + Intronic
1024123216 7:46266378-46266400 TACTGCCGTCCCCATGGAAGTGG + Intergenic
1024301149 7:47888740-47888762 GAATGCAGGCCCAAGGGAGGTGG - Intronic
1024521248 7:50305616-50305638 GGCTGCAGTCCCTAGAGAGAGGG - Intronic
1027826575 7:83124061-83124083 TACTTCAGTACTTTGGGAGGCGG + Intronic
1034142050 7:148829326-148829348 TACTGTAGTCCCTAGAGGAGCGG + Intronic
1037750644 8:21679954-21679976 TGCTGCCGTTCCTGGGGAGGGGG - Intergenic
1039124527 8:34186256-34186278 TACTGCTATCACAAGGGAGGAGG + Intergenic
1043010887 8:74880162-74880184 TCCAGCTGTCCTTAGGGAGGTGG + Intergenic
1045300096 8:100903493-100903515 TCCTGCAGTGCCTGGGGAGGAGG - Intergenic
1046100441 8:109608159-109608181 CACTGCAGTCACCAGGGAGAAGG - Intronic
1049251326 8:141590758-141590780 TACTGCAGATGCTGGGGAGGTGG - Intergenic
1049673649 8:143880333-143880355 GACTGGAGCCCCTGGGGAGGTGG - Intergenic
1050526969 9:6554696-6554718 TTCTGCATTCCCCACGGAGGAGG - Exonic
1050930991 9:11326414-11326436 TACAGCAGCCCCTAAGCAGGAGG - Intergenic
1053355581 9:37442889-37442911 TTCTGCATTCCCTAAGGATGAGG + Intronic
1054845037 9:69785766-69785788 TAATGCAGTCCCTAAGGATATGG + Intergenic
1056142920 9:83700988-83701010 TACTGCAGTTTCTAGGCAAGAGG + Intronic
1056332639 9:85534460-85534482 TACGGCAGTCCACAGGGAAGTGG - Intergenic
1057849617 9:98555225-98555247 CCCTGCCTTCCCTAGGGAGGTGG - Intronic
1058482099 9:105406308-105406330 AACTACAAACCCTAGGGAGGAGG + Intronic
1059633516 9:116150721-116150743 TAAGGGAGTCCCTGGGGAGGAGG + Intergenic
1059922768 9:119177192-119177214 TACTGCAGTCCTGAGGGGAGAGG - Intronic
1061884388 9:133584245-133584267 TCCTGGGGTCCCCAGGGAGGAGG - Intronic
1061913891 9:133738998-133739020 GACAGCAGTGCCCAGGGAGGGGG + Intronic
1062334150 9:136057651-136057673 TACTGCAGCCCTGGGGGAGGAGG - Intronic
1062574770 9:137200924-137200946 CAATGAAGTCCCTTGGGAGGCGG - Intronic
1186228374 X:7425835-7425857 TTTTCCAGTCCCTAGGTAGGTGG - Intergenic
1190927364 X:54921722-54921744 TACTGCAGAGCGGAGGGAGGGGG + Intronic
1194835855 X:98682180-98682202 TAATGCAGTCCCTGGGGGAGGGG - Intergenic
1195129677 X:101840169-101840191 TACTGCTGGTCCTGGGGAGGTGG + Intronic
1195176561 X:102319660-102319682 TACTGCTGGTCCTGGGGAGGTGG - Intronic
1195182303 X:102367433-102367455 TACTGCTGGTCCTGGGGAGGTGG + Intronic
1195202427 X:102564351-102564373 TACTGCTGGTCCTGGGGAGGTGG - Intergenic
1199680687 X:150222319-150222341 TCCTGCAGCCACTATGGAGGGGG + Intergenic
1200086061 X:153606489-153606511 TACTGCAGTTCCGAGGCAGCAGG + Intergenic