ID: 949869992

View in Genome Browser
Species Human (GRCh38)
Location 3:8580283-8580305
Sequence GTGTGCAGAAAGGCTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949869992_949869997 5 Left 949869992 3:8580283-8580305 CCCAGCCCAGCCTTTCTGCACAC No data
Right 949869997 3:8580311-8580333 GCAAAAGAAAACCTCCAGCCAGG No data
949869992_949869998 10 Left 949869992 3:8580283-8580305 CCCAGCCCAGCCTTTCTGCACAC No data
Right 949869998 3:8580316-8580338 AGAAAACCTCCAGCCAGGCGCGG No data
949869992_949869999 13 Left 949869992 3:8580283-8580305 CCCAGCCCAGCCTTTCTGCACAC No data
Right 949869999 3:8580319-8580341 AAACCTCCAGCCAGGCGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949869992 Original CRISPR GTGTGCAGAAAGGCTGGGCT GGG (reversed) Intergenic
No off target data available for this crispr