ID: 949871945

View in Genome Browser
Species Human (GRCh38)
Location 3:8596559-8596581
Sequence CTGTGGGCCCTTTTATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949871938_949871945 21 Left 949871938 3:8596515-8596537 CCTCAGAGGGGTACTAAGAAGGT No data
Right 949871945 3:8596559-8596581 CTGTGGGCCCTTTTATCTCCAGG No data
949871936_949871945 24 Left 949871936 3:8596512-8596534 CCACCTCAGAGGGGTACTAAGAA No data
Right 949871945 3:8596559-8596581 CTGTGGGCCCTTTTATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949871945 Original CRISPR CTGTGGGCCCTTTTATCTCC AGG Intergenic
No off target data available for this crispr