ID: 949873516

View in Genome Browser
Species Human (GRCh38)
Location 3:8608745-8608767
Sequence CTTTAAATCCAGAGGAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949873516_949873521 3 Left 949873516 3:8608745-8608767 CCAAGCCTCCTCTGGATTTAAAG No data
Right 949873521 3:8608771-8608793 CTCTTTCTTTGATTCCATACTGG No data
949873516_949873523 28 Left 949873516 3:8608745-8608767 CCAAGCCTCCTCTGGATTTAAAG No data
Right 949873523 3:8608796-8608818 AACCAGAAGACAGAAGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949873516 Original CRISPR CTTTAAATCCAGAGGAGGCT TGG (reversed) Intergenic
No off target data available for this crispr