ID: 949875314

View in Genome Browser
Species Human (GRCh38)
Location 3:8622889-8622911
Sequence CCTGCATCCCAACATGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949875314_949875320 19 Left 949875314 3:8622889-8622911 CCAGGATCATGTTGGGATGCAGG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 949875320 3:8622931-8622953 AGTCTGCAAGGTTCCTGTCCCGG 0: 1
1: 0
2: 1
3: 3
4: 132
949875314_949875317 7 Left 949875314 3:8622889-8622911 CCAGGATCATGTTGGGATGCAGG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 949875317 3:8622919-8622941 GGATCTCAGCCCAGTCTGCAAGG 0: 1
1: 0
2: 1
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949875314 Original CRISPR CCTGCATCCCAACATGATCC TGG (reversed) Intronic
901078587 1:6570990-6571012 CCTGCTGCCCAACATCACCCTGG + Exonic
901668325 1:10838869-10838891 CCTGCACCCCTTCAGGATCCTGG + Intergenic
903057191 1:20644520-20644542 CCCTCACCCCAACATCATCCGGG + Exonic
903381952 1:22903287-22903309 CCTCCCTCCCAACATGACTCAGG - Intronic
905356534 1:37388825-37388847 CCTGAGTCCAAACCTGATCCAGG - Intergenic
907006089 1:50915444-50915466 ACTGCATCCTAACATGGTTCAGG - Intronic
908268280 1:62399287-62399309 CCTGAATCCCTCCATCATCCTGG + Intergenic
908394240 1:63710924-63710946 CCTGCATCCCTACACATTCCAGG + Intergenic
914690525 1:150022011-150022033 CCTGCTTCCCAGCCTGAGCCTGG + Intergenic
914923109 1:151860720-151860742 CCTGCACCCCACCCTCATCCCGG - Intergenic
915340409 1:155174092-155174114 CCTGGATCCCCACCTGTTCCAGG - Intronic
920402044 1:205681985-205682007 CCTGGATCCCATGGTGATCCTGG + Intergenic
921931862 1:220761424-220761446 TCTGCATTCAAACAAGATCCTGG + Intronic
922469506 1:225867190-225867212 CCTGCTTCCCCACATGACCCTGG - Intronic
1064092312 10:12395533-12395555 CCTGAATTCCAGCCTGATCCTGG - Intronic
1066466784 10:35658783-35658805 CCTGCCTCCTAACCTGATCAGGG - Intergenic
1067146988 10:43701266-43701288 CCTGCATCCCTGCCTGCTCCAGG - Intergenic
1069854741 10:71433852-71433874 CCTGCATCCCTGCAGGAGCCTGG + Intronic
1073317315 10:102592261-102592283 CCTGCCTCCCACCATGAGTCGGG + Intronic
1077528484 11:3083533-3083555 CCTGCACCCCAAGAGGGTCCAGG + Intergenic
1077610348 11:3640011-3640033 CCTGCATTTCTACCTGATCCGGG - Exonic
1078106476 11:8361255-8361277 CCTTCTTCCCAAGATGGTCCGGG + Intergenic
1078929474 11:15902100-15902122 CCTACCTCCCAGCTTGATCCAGG + Intergenic
1083180564 11:60982146-60982168 CCTGTGTCCCCACATGACCCTGG - Intronic
1091317056 11:134621870-134621892 CCTCCATCCCTCCATGCTCCTGG - Intergenic
1091579763 12:1777259-1777281 CCTTCATCCCACCATTAGCCAGG + Intronic
1091994748 12:4984565-4984587 CCTGCATCTAGACATGATCTGGG - Intergenic
1095980326 12:47969488-47969510 CCTGTGTCACTACATGATCCAGG - Intergenic
1102042590 12:109810248-109810270 ACTGCATCCCAAGATGTGCCAGG - Intronic
1102868280 12:116391763-116391785 CCTTCTTCCCATCATCATCCAGG - Intergenic
1108470391 13:50761504-50761526 GCTGTCTCACAACATGATCCAGG + Intronic
1110793346 13:79609594-79609616 CCTGCATCCCCACTTGATCATGG + Intergenic
1118156997 14:63252151-63252173 CCTGCATTCCTACAGGCTCCAGG + Intronic
1121921236 14:97883578-97883600 CCTCCATCCCTACCTGACCCTGG + Intergenic
1122921311 14:104881474-104881496 CCTGCATCCCAACCAGACACCGG - Intronic
1122983651 14:105202551-105202573 CCTGCTTCCCCAGATGGTCCTGG + Intergenic
1126739055 15:51759732-51759754 CCAGCATCCCAACAAGAAACGGG + Intronic
1126849713 15:52789617-52789639 CCTGCATCCCACCATGACCATGG - Exonic
1129245594 15:74276988-74277010 CCTGTAGCCCACCATCATCCAGG - Intronic
1133738688 16:8635058-8635080 CCTGCTTGCCAACATCCTCCAGG - Exonic
1136233777 16:28902692-28902714 CCTGCATCCCCACACCCTCCTGG - Intronic
1137574063 16:49586821-49586843 CCCGGATGCCAACATGAGCCTGG + Intronic
1137706910 16:50541918-50541940 ACTGCATCTCAACAAGATCCCGG + Intergenic
1139272854 16:65699834-65699856 CCCCCATCCCACCATGCTCCTGG + Intergenic
1139516798 16:67457118-67457140 CCCTCATCCCAACATGAAGCGGG + Intronic
1141267991 16:82514138-82514160 CATGCATACCAACAGGGTCCCGG + Intergenic
1141704812 16:85658898-85658920 CCTGCTTCCCATCATGCCCCAGG - Intronic
1141962950 16:87421521-87421543 CTTGCAGCCCAGCCTGATCCTGG - Intronic
1142161241 16:88558723-88558745 CCCGCATCCCCCCATGCTCCAGG + Intergenic
1145056341 17:19706363-19706385 CCTGAATCCCAGCATGGGCCAGG - Intronic
1147675567 17:42202679-42202701 CCTGCCTCCCATCCTTATCCTGG - Intronic
1147689998 17:42309154-42309176 CCTGCCTCCCATCCTGATCCTGG + Intronic
1147770487 17:42864668-42864690 CCTCCTTCCCAAGTTGATCCAGG + Intergenic
1148442062 17:47716554-47716576 CCTTCATCCCAAAATGAGTCAGG - Intergenic
1148688574 17:49513958-49513980 CCTCCATCCCGACATGGACCCGG + Exonic
1151420522 17:73994085-73994107 TCTTCCTCCCAGCATGATCCAGG - Intergenic
1152762001 17:82113613-82113635 CCTTCACCCAAACATGAACCAGG - Intronic
1153535836 18:6100785-6100807 CCTGCAGCCCAACATTAACAGGG - Intronic
1155989447 18:32264764-32264786 TCTGCCTCCCAACATGAGTCAGG + Intronic
1156312315 18:35935925-35935947 CGTGCATCCCAGCATCAGCCCGG + Intergenic
1156356965 18:36350299-36350321 CCTGCCTCCCACCAGAATCCTGG + Intronic
1158721085 18:59925290-59925312 CCTGCACCTCAGCATCATCCAGG + Intergenic
1159520987 18:69523154-69523176 TCTGCATCCAAAGATTATCCAGG + Intronic
1161061608 19:2217846-2217868 CGTGCAGCCCAACAAGCTCCCGG + Exonic
1161356405 19:3821534-3821556 CCTGCACCCCAAGATCCTCCTGG - Intronic
1161872704 19:6882628-6882650 CCAGCATCCCTACATGCTCAAGG + Intergenic
1162361803 19:10224860-10224882 CCTGAACCCCAACAAGGTCCAGG - Exonic
1163649762 19:18510389-18510411 CCTGCATCCCAACACAGGCCGGG + Intronic
1164618355 19:29679809-29679831 CCTGCACCCCATCATCATCAAGG - Intergenic
1164796461 19:31037490-31037512 GCTGCATCCCAACATCTCCCTGG - Intergenic
1165143283 19:33715514-33715536 TCTGCATCCCAGCATGCTTCTGG + Intronic
1168578676 19:57535221-57535243 CCAGCATCACATCATGATACAGG - Exonic
925228911 2:2213073-2213095 TCTGCATCCCACCAGGATGCAGG + Intronic
927519554 2:23690606-23690628 CCTGCTTCCCACCCTGAGCCCGG - Intronic
928152421 2:28843996-28844018 CATGCCTCCCTATATGATCCAGG - Intronic
928447783 2:31348267-31348289 CCTTCATACCAAAATGGTCCAGG - Exonic
930016674 2:46975464-46975486 CCTGCTTCCTCACAGGATCCAGG - Intronic
931910556 2:66895149-66895171 TCTGCTTCCCAAGATGGTCCAGG - Intergenic
934707184 2:96490997-96491019 CCTGCATCCCAACAAAAGTCAGG - Intergenic
937580244 2:123476578-123476600 CCTTCATCCCAACAGGACTCAGG + Intergenic
944388721 2:199194559-199194581 CCTGCATCCCTAGATGACCCTGG + Intergenic
946065578 2:216984412-216984434 CCTGGATACCAAGAGGATCCAGG + Intergenic
947550441 2:231041667-231041689 CATGCACCCCACCATGCTCCTGG - Intronic
948443781 2:238016252-238016274 CTTGCATCCTACCATGTTCCTGG - Intronic
948741280 2:240048114-240048136 ACTGCATGCCAACACGAACCAGG - Intergenic
1171161325 20:22926504-22926526 CTTGCCTCCCACCATGATCCTGG + Intergenic
1172916805 20:38449371-38449393 CCTGCATTCAAAAATGATCACGG + Intergenic
1176295656 21:5070758-5070780 CCTGCGTCCCAACATGGTGGAGG + Intergenic
1178039119 21:28620109-28620131 TTTGCATGCCAACTTGATCCTGG + Intergenic
1179003470 21:37485242-37485264 CCTGCAGCCCATCAGGATCTGGG + Intronic
1179260884 21:39757400-39757422 TCTGCATCCCTTCATGATGCAGG + Intronic
1179861393 21:44191366-44191388 CCTGCGTCCCAACATGGTGGAGG - Intergenic
1180196696 21:46200978-46201000 CCTGTCTTCCCACATGATCCAGG - Intronic
1184057160 22:42060296-42060318 CCTGTATCCCATCAAGAACCTGG - Exonic
1184098983 22:42331649-42331671 CCTGCACCCCAACAGCAGCCTGG + Intronic
1184512817 22:44943130-44943152 GCTGCTCCCCAACATGCTCCGGG + Intronic
949875314 3:8622889-8622911 CCTGCATCCCAACATGATCCTGG - Intronic
951055837 3:18145476-18145498 CCTACATTCCAGCATGTTCCAGG - Intronic
951220580 3:20065117-20065139 TTTTCATCCCAACAGGATCCAGG - Intronic
953514640 3:43578015-43578037 CCTGCTTCCCACCCTGGTCCTGG - Intronic
957898855 3:86461983-86462005 CCAGCATCCCTACACCATCCAGG + Intergenic
961175657 3:124832983-124833005 CCTGAATGTCAACATGATTCGGG - Intronic
961453481 3:127013104-127013126 CCTGCAACCCAACCTGCCCCAGG - Intronic
963493788 3:146034452-146034474 CCTGCCTCCTAACATGTTCTTGG - Intergenic
964946053 3:162225001-162225023 CCTGGATCCTAAAATGAGCCAGG - Intergenic
973338322 4:48978751-48978773 ACTGCACTCCATCATGATCCAGG - Intergenic
974199643 4:58622341-58622363 CCTGCGTCCCCACATGTTTCTGG - Intergenic
974620443 4:64347206-64347228 CCATCATTCCAACATGATACAGG + Intronic
976006070 4:80431867-80431889 GCAGCATGCCAACATGGTCCTGG + Intronic
978382261 4:108141720-108141742 GCTGCAATCCAACATGATGCTGG - Intronic
980656528 4:135794177-135794199 CCTGCATCCCTACATGAAAATGG - Intergenic
986221193 5:5770502-5770524 CCTGGATCCCTTCATGTTCCAGG - Intergenic
987085128 5:14461071-14461093 CCTCCAGCCCCACATGATCGGGG + Exonic
987544357 5:19293298-19293320 GCTGTATCCCAACCTGATGCAGG + Intergenic
991452806 5:66770741-66770763 CCTGGCTCCCAACACTATCCAGG - Intronic
992612425 5:78519096-78519118 CTTGCTCCCCAACATGAGCCAGG + Intronic
998369092 5:141649807-141649829 CCTTCATCCCCACAGGTTCCTGG + Intronic
1002576918 5:180179186-180179208 CCTGCATCCAAACATCAACACGG - Intronic
1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG + Exonic
1008770257 6:54970242-54970264 CCTGCAACTCAACATGATGCAGG + Intergenic
1014949757 6:127541154-127541176 CCTGCATCCAAGCAGGATGCAGG + Intronic
1016514265 6:144876695-144876717 CCTGCATTCCCCCATGACCCTGG + Intergenic
1020942641 7:14560808-14560830 TTTGCATCCCAACATTATGCAGG + Intronic
1027416513 7:77980181-77980203 TCTGGATGCCAAAATGATCCTGG - Intergenic
1030358503 7:108569818-108569840 TCTGCCTCCCCACGTGATCCCGG - Exonic
1032653274 7:133901818-133901840 CCTGCATGCCAACATGAGGAAGG - Intronic
1035081594 7:156220644-156220666 CCTGCACCCCAACATCCTCTTGG - Intergenic
1037811595 8:22089767-22089789 CCTGCACCCCAACAAGGTCCTGG - Intronic
1039044665 8:33439060-33439082 TCTGCATCTCAACCTAATCCAGG + Intronic
1039607960 8:38898601-38898623 CCCTCAGCCCAACATGTTCCTGG + Intergenic
1046113153 8:109751330-109751352 CCTGCTTCCAAACATGAAGCAGG - Intergenic
1047019255 8:120757248-120757270 ACTGCATTCCTACATGATACTGG + Intronic
1052375992 9:27718097-27718119 CCTGGAACCCAACATGGGCCTGG + Intergenic
1052418536 9:28209748-28209770 ACTGCATCCCATCATACTCCTGG - Intronic
1055415656 9:76079993-76080015 CTTGCATCCCAACTTGATCATGG + Intronic
1055528717 9:77161453-77161475 TCTGTAACCCAACATGATCCTGG - Intergenic
1058195595 9:101971100-101971122 GCTGCTCCCCAACTTGATCCTGG + Intergenic
1060403265 9:123360576-123360598 TCTGCATCGCAACCTGCTCCTGG - Intronic
1061609371 9:131736304-131736326 CCTGCATCCCAGCTTGTTCCTGG + Intronic
1061940524 9:133881397-133881419 CCTGCATCCCATCAGGGGCCTGG + Intronic
1062248371 9:135581873-135581895 CCTCCAACCCAGCATGCTCCTGG + Intergenic
1189307045 X:39994721-39994743 CCTGCATCACATCATCAGCCTGG + Intergenic
1194812689 X:98405326-98405348 CCTGCATCCCAACATGCCATGGG - Intergenic
1197677432 X:129345761-129345783 CCTGCCCCCCAACAGGACCCAGG - Intergenic