ID: 949875539

View in Genome Browser
Species Human (GRCh38)
Location 3:8623942-8623964
Sequence ACCCCACGAGTCCACACTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949875539_949875542 0 Left 949875539 3:8623942-8623964 CCGTCAGTGTGGACTCGTGGGGT 0: 1
1: 0
2: 0
3: 12
4: 67
Right 949875542 3:8623965-8623987 CTGTACACGTGTAGCGGGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 52
949875539_949875540 -6 Left 949875539 3:8623942-8623964 CCGTCAGTGTGGACTCGTGGGGT 0: 1
1: 0
2: 0
3: 12
4: 67
Right 949875540 3:8623959-8623981 TGGGGTCTGTACACGTGTAGCGG 0: 1
1: 0
2: 0
3: 11
4: 78
949875539_949875541 -5 Left 949875539 3:8623942-8623964 CCGTCAGTGTGGACTCGTGGGGT 0: 1
1: 0
2: 0
3: 12
4: 67
Right 949875541 3:8623960-8623982 GGGGTCTGTACACGTGTAGCGGG 0: 1
1: 0
2: 7
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949875539 Original CRISPR ACCCCACGAGTCCACACTGA CGG (reversed) Intronic
900161532 1:1226422-1226444 ATCCCACAAGCCCAAACTGAGGG + Intronic
902225551 1:14994282-14994304 CCCCCAAGAGTCCAGGCTGAGGG - Intronic
902512142 1:16972353-16972375 TCCCCAGGTGTCCACACTGAAGG + Exonic
905870913 1:41404217-41404239 ACCCCAGAAGTTCCCACTGAAGG - Intergenic
908379577 1:63583501-63583523 ACCCCATGATTCAACACTGAAGG + Intronic
909476746 1:76089338-76089360 ACCGCACCCGGCCACACTGAAGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
922346922 1:224704087-224704109 ACCACACCAGTGCACACTGCAGG + Intronic
1068451050 10:57189181-57189203 ACCCTACAAATCCAAACTGAAGG - Intergenic
1069729797 10:70603147-70603169 ACCCTACCAGTCCACACTGCTGG - Intergenic
1074040591 10:109784505-109784527 TCCCCACGATTCCACACTGCAGG - Intergenic
1076373634 10:129969601-129969623 ACCCCACGAGTCAGCTCTGGGGG + Intergenic
1077719347 11:4611916-4611938 ACCCCATAGGTCCACTCTGATGG + Intergenic
1079183302 11:18213243-18213265 ACCACACTGGTTCACACTGAAGG - Exonic
1097572905 12:61356099-61356121 GCACCACAAGTCCCCACTGAAGG + Intergenic
1102644819 12:114397028-114397050 ATCTCAGGGGTCCACACTGATGG - Intronic
1104198589 12:126565890-126565912 ACCCCATGAGTCCAGACTATGGG + Intergenic
1108209225 13:48121539-48121561 AGCCCAAGAGTCCACACTTTTGG + Intergenic
1108408249 13:50125154-50125176 ACCCCAGCAGTCCACACGGCAGG - Intronic
1113910138 13:113837812-113837834 AGCCCATGAGGCCACACTGCTGG - Intronic
1113910544 13:113839282-113839304 ACACCACAGGTCTACACTGAAGG + Intronic
1115302096 14:31895773-31895795 ACCTCAAAATTCCACACTGAGGG - Intergenic
1119066917 14:71537633-71537655 AGCCCACTCGCCCACACTGAAGG - Intronic
1121484712 14:94305804-94305826 ATCCCACCAGACCACACAGAGGG - Intronic
1123089563 14:105736471-105736493 AGCCCAGGAGTCCTCCCTGACGG + Intergenic
1132104619 15:99054200-99054222 ACATTACGAATCCACACTGAGGG - Intergenic
1139651338 16:68363682-68363704 ACCCCACAAGACCCCACTGCTGG - Intronic
1140245288 16:73242833-73242855 ACCCCACACCTCCACACTGATGG - Intergenic
1140841132 16:78840168-78840190 ATTCCACAAGTACACACTGAGGG - Intronic
1141101901 16:81203577-81203599 ACCCCACGAGTGCTCAGTGCCGG + Intergenic
1142009244 16:87705367-87705389 CTCCCACGGTTCCACACTGAAGG + Intronic
1148669743 17:49401894-49401916 TCCCCATCAGTCCACACTGGCGG + Intronic
1151888955 17:76940876-76940898 CCCCCACTAGTCCACACTGCTGG + Intronic
1152555149 17:81049344-81049366 AGCCCAGCTGTCCACACTGAGGG - Intronic
1155936230 18:31757339-31757361 ACCACACTAGTTCACACTGAAGG + Intergenic
1158308633 18:56134744-56134766 ACCACAAGAGTCCTCACTAAGGG + Intergenic
1160549224 18:79682378-79682400 CCACCACAAGTCCACACTGCAGG - Intronic
1161511567 19:4675113-4675135 ACCCCAGGAGTCCCCACAGATGG + Intergenic
925355657 2:3239298-3239320 ACCCCACAGGTACACACAGAAGG + Intronic
926092687 2:10060820-10060842 ACTCCACGAGTCCAGCCTGAGGG + Intronic
933599897 2:84318442-84318464 GCCCCAAGAGTACACACTTAGGG - Intergenic
938473288 2:131585840-131585862 ACCCCACGGGTCCAACCTGCAGG + Intergenic
943623934 2:190178889-190178911 ACCCCTGGGTTCCACACTGAGGG - Intronic
943676139 2:190718009-190718031 TCCTCACTAGTCCACACAGATGG + Intergenic
948807182 2:240458038-240458060 AGCTCAGGACTCCACACTGACGG - Intronic
1174546079 20:51326162-51326184 AGCCCCAGAGTCCACTCTGATGG - Intergenic
1175835022 20:61988174-61988196 ACACCAAGAGTGCACCCTGATGG + Intronic
1179320419 21:40285987-40286009 ACCCCAAGACTCCACACCCATGG - Intronic
1182568503 22:31217905-31217927 ACCCCATGAGTACACACCAAGGG + Intronic
1185010307 22:48309189-48309211 AGCCCAGGAATCCACACTGAAGG + Intergenic
949875539 3:8623942-8623964 ACCCCACGAGTCCACACTGACGG - Intronic
957039728 3:75327861-75327883 ACCCCAAAAGCCCACACAGATGG + Intergenic
961044479 3:123699295-123699317 ACCCCAAAAGTCCACACAGATGG + Intronic
961474383 3:127137571-127137593 ACCCCCACTGTCCACACTGATGG + Intergenic
962082159 3:132151210-132151232 AGCCCAAGAGGCCACACTTAAGG + Intronic
962585208 3:136835753-136835775 AATCCACAAGTCCACGCTGATGG - Intronic
967980038 3:195060204-195060226 TCCCCATGGATCCACACTGAGGG - Intergenic
971326936 4:25652401-25652423 AACCCAGGAGTTCAGACTGATGG - Intergenic
976212008 4:82680993-82681015 CCCCCACCAGTCCTCACTGCTGG + Intronic
987292729 5:16523816-16523838 AACACACGAGTCTTCACTGATGG - Intronic
1005235879 6:23761582-23761604 ACCAAAAGAGTCCACATTGATGG - Intergenic
1009600517 6:65791711-65791733 ACCACACTAGTTCACATTGAAGG - Intergenic
1015708077 6:136109792-136109814 CCCCCACAAGTCTACAGTGAAGG - Intronic
1016393821 6:143601695-143601717 GACCCAGGAGTCCACACAGATGG - Intronic
1018238059 6:161745264-161745286 ACTTCACCTGTCCACACTGAGGG - Intronic
1019622940 7:2001469-2001491 CCCCCACGGGCCCACACTGCGGG + Intronic
1021539038 7:21736514-21736536 ACCCCAGGAGCCCACATTCAAGG - Intronic
1025712466 7:63925792-63925814 ACCCCACCCGTTCCCACTGAGGG - Intergenic
1029493603 7:100885369-100885391 ACTCCACGGGTCCCCACTCACGG - Exonic
1032055367 7:128680184-128680206 ACCCCATGACTTCACACTGGAGG - Intronic
1033151283 7:138916922-138916944 TCCCCTCGACTCCACCCTGATGG - Exonic
1043794489 8:84519430-84519452 ACCCAAGGAGTCTACAATGAGGG - Intronic
1048996949 8:139800396-139800418 GACACACGTGTCCACACTGAGGG + Intronic
1052669035 9:31532016-31532038 CCCCCACGTGTCCACACACAGGG + Intergenic
1053406719 9:37883163-37883185 ACCACACTAGTTCACACTGAAGG + Intronic
1056216455 9:84409651-84409673 AGACCACGAACCCACACTGAAGG + Intergenic
1056595882 9:88007224-88007246 ACCCCACCACACCACACCGAGGG - Intergenic
1061259931 9:129474639-129474661 ACCCCACCACTCCCCACTGGAGG + Intergenic
1061923835 9:133796509-133796531 CTCCCAGGAGTGCACACTGAAGG - Exonic
1198889557 X:141377853-141377875 ACCCCACTGCTCCACCCTGAAGG + Intergenic