ID: 949877130

View in Genome Browser
Species Human (GRCh38)
Location 3:8633776-8633798
Sequence CAGAGTCCCTGCGATGACGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 98}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949877130_949877139 3 Left 949877130 3:8633776-8633798 CCTCCGTCATCGCAGGGACTCTG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 949877139 3:8633802-8633824 GGGACCGAACAGAGAGGCGGGGG 0: 1
1: 0
2: 0
3: 15
4: 156
949877130_949877142 11 Left 949877130 3:8633776-8633798 CCTCCGTCATCGCAGGGACTCTG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 949877142 3:8633810-8633832 ACAGAGAGGCGGGGGCTTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 217
949877130_949877144 16 Left 949877130 3:8633776-8633798 CCTCCGTCATCGCAGGGACTCTG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 949877144 3:8633815-8633837 GAGGCGGGGGCTTCTGGGAAGGG 0: 1
1: 0
2: 3
3: 54
4: 433
949877130_949877136 0 Left 949877130 3:8633776-8633798 CCTCCGTCATCGCAGGGACTCTG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 949877136 3:8633799-8633821 CAGGGGACCGAACAGAGAGGCGG 0: 1
1: 0
2: 0
3: 15
4: 213
949877130_949877141 10 Left 949877130 3:8633776-8633798 CCTCCGTCATCGCAGGGACTCTG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 949877141 3:8633809-8633831 AACAGAGAGGCGGGGGCTTCTGG 0: 1
1: 0
2: 0
3: 14
4: 223
949877130_949877135 -3 Left 949877130 3:8633776-8633798 CCTCCGTCATCGCAGGGACTCTG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 949877135 3:8633796-8633818 CTGCAGGGGACCGAACAGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 157
949877130_949877145 23 Left 949877130 3:8633776-8633798 CCTCCGTCATCGCAGGGACTCTG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 949877145 3:8633822-8633844 GGGCTTCTGGGAAGGGCCTGTGG 0: 1
1: 0
2: 10
3: 96
4: 678
949877130_949877137 1 Left 949877130 3:8633776-8633798 CCTCCGTCATCGCAGGGACTCTG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 949877137 3:8633800-8633822 AGGGGACCGAACAGAGAGGCGGG 0: 1
1: 0
2: 2
3: 23
4: 295
949877130_949877138 2 Left 949877130 3:8633776-8633798 CCTCCGTCATCGCAGGGACTCTG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 949877138 3:8633801-8633823 GGGGACCGAACAGAGAGGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 124
949877130_949877143 15 Left 949877130 3:8633776-8633798 CCTCCGTCATCGCAGGGACTCTG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 949877143 3:8633814-8633836 AGAGGCGGGGGCTTCTGGGAAGG 0: 1
1: 0
2: 3
3: 65
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949877130 Original CRISPR CAGAGTCCCTGCGATGACGG AGG (reversed) Exonic
900127093 1:1073503-1073525 CAGGGTCCCTGCCATGAAGTGGG - Intronic
900531370 1:3155098-3155120 CAGAGCCCCTGAGAGGTCGGGGG - Intronic
901251107 1:7781244-7781266 CAGAGACCCTGCGCTGAAGGTGG - Exonic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
903374288 1:22856139-22856161 CAGAGTCCCTGGGAGGAGAGGGG + Intronic
904001535 1:27341727-27341749 CAGAGTCCCTGCTCTGCCAGTGG - Intergenic
905536581 1:38727011-38727033 CAGAGACCCTGCGAACATGGAGG - Intergenic
905975533 1:42171197-42171219 CAGACTCCCTGGGATGAGGGAGG + Intergenic
906732926 1:48098708-48098730 CAGAGTCCCTGCTCTCAAGGAGG - Intergenic
908796225 1:67833364-67833386 CCGAGTCCCGGCGGCGACGGCGG - Exonic
912466303 1:109877268-109877290 CAGAGCCCCTGCGTTGGGGGAGG + Intergenic
912945809 1:114083156-114083178 GTGAGTCCCTGAGATGACAGAGG - Intergenic
918518896 1:185392842-185392864 CTGAGTCCCTGGGATTACAGGGG + Intergenic
1062985002 10:1760296-1760318 CAGAGTACCTGGGATTACAGTGG + Intergenic
1065382422 10:25103286-25103308 CAGTGTCCCTGCAAGGATGGGGG - Intergenic
1068632853 10:59315582-59315604 CAGAGTCCCTGACATGAATGAGG + Intronic
1070976701 10:80611047-80611069 CTGAGTACCTGGGATGACAGGGG - Intronic
1077372464 11:2189748-2189770 CAGAGTTCTGGAGATGACGGTGG + Intergenic
1077482763 11:2824263-2824285 CAGAGGCCCTGGGAGGAGGGAGG + Intronic
1081779212 11:45698518-45698540 CAGGGTACCTGCGATGAGGAAGG + Intergenic
1082890570 11:58134412-58134434 GAGAGTCCCTGAGATGAGGAGGG - Intronic
1084542535 11:69796602-69796624 CAGAGGGGCTGGGATGACGGAGG - Intergenic
1084746140 11:71171226-71171248 CAGAGTCCCCGCGATGACAGAGG + Intronic
1085565970 11:77513761-77513783 CAGAGTCTTTGTGATGATGGTGG + Intergenic
1085717968 11:78889810-78889832 CAGAGTGGCTGAGATGACGATGG + Exonic
1090860918 11:130651692-130651714 CAAAGTCCCTGTGTTGGCGGGGG + Intergenic
1091286730 11:134412196-134412218 CAGAGTCCCCGAGGTGGCGGCGG + Intergenic
1092998497 12:13973563-13973585 CAGGGTCCCTGAGAAGGCGGTGG - Intronic
1102842549 12:116141642-116141664 CAGAGTCCCTGTGGTGAGGGTGG - Intronic
1103623712 12:122203915-122203937 CAGGGTCCCCGCGAGGACGCCGG + Intronic
1104028023 12:125043389-125043411 CACAGTTCCTGCTATGACTGAGG + Intergenic
1104714674 12:131008561-131008583 CAGGGCTCCTGTGATGACGGAGG + Intronic
1115640566 14:35333159-35333181 CAGAGTCCCTCCCAGGAAGGAGG - Intergenic
1119290036 14:73488394-73488416 CAGAGTAGCTGGGATGACAGGGG + Intronic
1122024639 14:98866929-98866951 CACAGTCACTGTGATGACAGTGG - Intergenic
1122059145 14:99124935-99124957 CAGAGTCCCTTCAATGGCAGAGG + Intergenic
1122488868 14:102099813-102099835 CAGGGTCCCTGTGAGAACGGAGG - Intronic
1124422846 15:29537753-29537775 CTGAGTCACTGGGAGGACGGTGG - Intronic
1128457354 15:67839153-67839175 CAGATTTCCTGCGATGACTTAGG - Intergenic
1128670274 15:69569668-69569690 CACAGTGCCTGCCATGAAGGAGG - Intergenic
1130093228 15:80838283-80838305 CAGGGTCCCTGCCAGGAAGGAGG - Intronic
1131711765 15:95063034-95063056 CAGAGTCCCTGAGCTGAGGAAGG - Intergenic
1132074463 15:98808631-98808653 TAGAGTCCCTGCGAGGACCTAGG - Intronic
1132462821 16:63798-63820 CTGAGTCCCTGCCATGCCAGGGG - Exonic
1132505902 16:308576-308598 CGGAGCCGCTGGGATGACGGAGG - Intronic
1133620166 16:7518466-7518488 CAGAGTCCCTGGGTAGATGGGGG - Intronic
1135486926 16:22873882-22873904 CAGAGTGCTTGAGATGATGGAGG + Intronic
1139209670 16:65065003-65065025 CAGAGACCCTGGGATGCTGGAGG - Intronic
1142205323 16:88780125-88780147 CAGGGTCACTGGGAGGACGGGGG - Intronic
1142377011 16:89711624-89711646 GAGGGTCCCTGCGAGGAGGGAGG - Intronic
1147388711 17:40096615-40096637 CAGAGGCCCAGCCATGATGGAGG - Intronic
1147393446 17:40123166-40123188 CAGGGTCCCGGCGGTGGCGGTGG - Intronic
1152441628 17:80313399-80313421 CACAGTCCCTGTGGTGATGGAGG + Intronic
1156405410 18:36778322-36778344 CAGAGTTCCTGAGATGACCAGGG - Intronic
1161356300 19:3821086-3821108 CAGTGTCCCTGCGTCTACGGAGG + Intronic
1161895412 19:7075842-7075864 CAGAGACCCTGGGATGCCTGAGG - Intronic
1164314744 19:24077460-24077482 CAGAGTCCCTGCAATGGTGGTGG - Intronic
1165159573 19:33808107-33808129 CAGAGTCCCTGACATGTGGGAGG - Intronic
1168613481 19:57819532-57819554 GAGAGTTCCTGACATGACGGTGG + Intronic
928404806 2:31006573-31006595 CAAAGTCCCTGCCATGATAGGGG + Intronic
938291164 2:130151342-130151364 CAGAGTCCCTGAGCACACGGGGG - Intergenic
938465377 2:131521617-131521639 CAGAGTCCCTGAGCACACGGGGG + Intergenic
1172301870 20:33856102-33856124 CAGAGTCCCTGCCCTCAAGGTGG + Intergenic
1173775765 20:45704892-45704914 CAGTGTCCCTGGGATAAGGGTGG - Intronic
1174237919 20:49109448-49109470 CCGAGTACCTGGGATTACGGGGG - Intergenic
1175758362 20:61544560-61544582 CGGGATCCCTGCGTTGACGGTGG + Intronic
1178421865 21:32449745-32449767 CAGAGTAGCTGGGATTACGGGGG + Intronic
1179025437 21:37675480-37675502 GAGGGTCCCCGCGATGACAGTGG - Intronic
1181043724 22:20204861-20204883 CAGGGTCCCTGTGATGAGGAGGG - Intergenic
1181546928 22:23607492-23607514 CAGAGTCCCTGCCTTGGCCGTGG + Intergenic
1183605255 22:38864058-38864080 CACAGTGCCTGCGATGCCAGGGG + Exonic
1184363309 22:44031643-44031665 CAGAGTCCCTTTGATGAGTGTGG - Intronic
949877130 3:8633776-8633798 CAGAGTCCCTGCGATGACGGAGG - Exonic
950420195 3:12893912-12893934 CTGAGTCCCTGGGATGACCATGG - Intergenic
950634324 3:14304241-14304263 CAGAGTCACAGGGAGGACGGAGG - Intergenic
953876500 3:46669773-46669795 CAGAGTCCCAGAGATGATGTGGG - Exonic
963313062 3:143729504-143729526 CACAGTCCCTGCTATCATGGAGG - Intronic
988227380 5:28429675-28429697 CTGAGTACCTGGGATGACAGGGG + Intergenic
990393654 5:55354723-55354745 CAGAGTCCCTGCTAGCACAGAGG - Intronic
991410724 5:66342912-66342934 CACAGTCCCTGGCATGAAGGAGG + Intergenic
997088123 5:130825239-130825261 CAGAGTTCCTGCCATGACCCAGG - Intergenic
999124991 5:149240047-149240069 CTGAGTCCCTGAGATGGCAGGGG + Intronic
1006577824 6:35058941-35058963 CAGAGACCCTGGGACGACTGTGG + Intronic
1008055667 6:46943538-46943560 CAGAGACCCTGTGATGGAGGTGG - Intronic
1015303081 6:131676221-131676243 CAGAGTAACTGAGATGAAGGTGG - Intronic
1016994867 6:149954567-149954589 CAAAGTCCCCGCGAGGATGGAGG + Intergenic
1018417949 6:163617629-163617651 CAGAGGCCTTGTGATGATGGAGG + Intergenic
1018864952 6:167739043-167739065 GGGAATACCTGCGATGACGGTGG + Intergenic
1023658699 7:42451758-42451780 CAGTGTCCCAGTGATGATGGTGG + Intergenic
1027190602 7:75993885-75993907 CAGAGTCCCTCCGAGGCCAGTGG - Intronic
1028383801 7:90229590-90229612 CAGAGTCCCTGTAATGATGATGG + Intronic
1029155150 7:98512056-98512078 CAGAGGCCCTGTGAGGACCGAGG - Intergenic
1036188272 8:6644671-6644693 CTGAGTCCCAGCGAGGTCGGAGG + Intergenic
1043077237 8:75717464-75717486 CTGAGTCCCTCCCATGACGTGGG + Intergenic
1047517166 8:125565041-125565063 CAGAGGCCCTGCTATGGAGGTGG + Intergenic
1049163615 8:141112841-141112863 CAGAGTCCCCGGGATGAAGCGGG + Intergenic
1049661708 8:143822458-143822480 CACAGTGCCTGCGGGGACGGTGG - Intronic
1053427901 9:38023068-38023090 CAGAACCCCTGCCATGGCGGAGG + Intronic
1057612294 9:96555876-96555898 CAGAGTCCCTGTGAGAACGCTGG + Intronic
1061185175 9:129048820-129048842 CAGAGTCCCTGGTATAACGCAGG - Intronic
1061263440 9:129492393-129492415 AAGGGTCCCTGAGATGACTGTGG + Intergenic
1062210237 9:135359717-135359739 CAGAGGCCCTGTGAAGACAGAGG + Intergenic
1188038551 X:25345354-25345376 CAGGGTTCCTGAGATGAAGGGGG + Intergenic
1189348791 X:40262083-40262105 CAGAGTCCCAGCCAGGTCGGTGG + Intergenic