ID: 949878240

View in Genome Browser
Species Human (GRCh38)
Location 3:8641133-8641155
Sequence AGCCGCACTCAGGCAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949878240_949878243 -3 Left 949878240 3:8641133-8641155 CCAAAGCCTGCCTGAGTGCGGCT 0: 1
1: 0
2: 0
3: 13
4: 126
Right 949878243 3:8641153-8641175 GCTCCCTGTCCTGTGCCCCTTGG 0: 1
1: 0
2: 5
3: 41
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949878240 Original CRISPR AGCCGCACTCAGGCAGGCTT TGG (reversed) Intronic
900167858 1:1251038-1251060 ATCAGCACTCAGGCAGGCCTGGG + Intergenic
904818250 1:33221303-33221325 GGCCCCCATCAGGCAGGCTTGGG + Intergenic
905732420 1:40305961-40305983 ATCTGCACTGAGGCAGGCTGAGG + Intronic
905870356 1:41400101-41400123 AGGCGCACTCAGGGAGGGATGGG - Intergenic
906654174 1:47535644-47535666 AGACGTCCACAGGCAGGCTTTGG - Intergenic
907858095 1:58323667-58323689 AGCCGCACTTTGGGAGGCTGAGG + Intronic
908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG + Intronic
909497919 1:76300173-76300195 AGCTGCAATCAGGTAGGCTTTGG + Intronic
910692729 1:89981544-89981566 AGCCCCACCTAGGCAGGTTTGGG + Intergenic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
922248776 1:223827179-223827201 AGCTGCTCTCATCCAGGCTTAGG - Intronic
923046665 1:230361029-230361051 AGGTGCACTCAGGCTGGCCTGGG - Intronic
923732442 1:236565467-236565489 AGCACCACTGAGGCTGGCTTAGG - Intronic
924542700 1:244996208-244996230 AGCAGCACTCAAGCAGCCTATGG - Intronic
1064019005 10:11794371-11794393 AGCAGCACTTTGGCAGGCTGAGG + Intergenic
1064504595 10:16014967-16014989 ACCCACAATCAGGCAGCCTTAGG + Intergenic
1066695110 10:38070309-38070331 AGCAGCACTCTGGGAGGCTGAGG - Intergenic
1071492270 10:86143981-86144003 GGCAGGACTCCGGCAGGCTTGGG - Intronic
1074302399 10:112244613-112244635 TGCAGCACTCAAGGAGGCTTAGG - Intergenic
1076496970 10:130903864-130903886 AGGAGCAGTCAGGCAGGCTGTGG - Intergenic
1077333117 11:1992055-1992077 AGCCACACACAGCCAGGCTCAGG + Intergenic
1077436111 11:2539996-2540018 GGCCGGGCGCAGGCAGGCTTGGG + Intronic
1080109320 11:28547697-28547719 TGCTGCACTCAAGCAGGCTCTGG - Intergenic
1083842212 11:65310919-65310941 AGCCTCATTCCCGCAGGCTTAGG + Intergenic
1202816099 11_KI270721v1_random:47234-47256 AGCCACACACAGCCAGGCTCAGG + Intergenic
1092253424 12:6914102-6914124 GGCCGCCCTCGGGCAGGCGTGGG + Exonic
1096623063 12:52876557-52876579 GGCCCCACTCAAGCAGGCTGGGG - Intergenic
1098143317 12:67472789-67472811 AGCCTCACTCAGGCAGCCACGGG + Intergenic
1098290833 12:68955779-68955801 AGCCAGACTCAGGCAGACATGGG - Intronic
1098323600 12:69277481-69277503 AGCAGCACTCTGGGAGGCCTAGG + Intergenic
1101421638 12:104555847-104555869 AGCCGCACAAAGGCAGCCCTGGG + Intronic
1104415008 12:128590728-128590750 AGCTGCATGCAGGCAGGCTGAGG + Intronic
1104981693 12:132575852-132575874 ACCCGCACTCAGGCTGGCCTGGG - Intronic
1105809191 13:23979680-23979702 AGCAGAACTCAGACAGGCTCTGG - Exonic
1113364721 13:109665464-109665486 AGCAGCAACCAGGCAGGCATGGG - Intergenic
1113572953 13:111371684-111371706 CGCTGCACCCAGGCAGGCTCAGG + Intergenic
1113804332 13:113104548-113104570 AGCAGCAAGCAGGGAGGCTTTGG + Intergenic
1114263331 14:21055562-21055584 AGCCTCACTCAGGGAGGCCTGGG - Intronic
1115728384 14:36241642-36241664 AGCCACACTCAAGCAGGTATGGG + Intergenic
1118004599 14:61554146-61554168 AGCTGCACTCTGGCCAGCTTTGG - Intronic
1122444894 14:101761423-101761445 AGCCGGCCTCAGGCAGGCCGCGG - Intergenic
1122694422 14:103545854-103545876 CGCCGCGCTCAGGAGGGCTTCGG - Intergenic
1123050213 14:105537820-105537842 GACCCCACTCAGGCAGGCCTTGG + Intergenic
1202854460 14_GL000225v1_random:42230-42252 AGTCTCACACAGGCAGGCGTGGG - Intergenic
1124159418 15:27255101-27255123 AGCCGCTGTCAGGCAGCCCTGGG - Intronic
1124646162 15:31438816-31438838 AGCCGCACTCAGCCTCACTTAGG - Intergenic
1127842869 15:62845805-62845827 AACCGCACTTAGGTAGGCCTGGG + Intergenic
1129708458 15:77808033-77808055 AGCCTTACCCATGCAGGCTTGGG + Intronic
1130230350 15:82092246-82092268 GTCCGGAGTCAGGCAGGCTTGGG - Intergenic
1132826945 16:1909866-1909888 GGCCAGACTCAGGCAGGCTGGGG - Intergenic
1133233472 16:4377146-4377168 AGCAGCACTCAGCAAGGCTGAGG + Intronic
1133363193 16:5190198-5190220 ACCAGCACTCTGGCAGGCTGAGG - Intergenic
1136117235 16:28102256-28102278 AGGAGCAGGCAGGCAGGCTTTGG - Intronic
1137983779 16:53091076-53091098 AGCCCCACTCAGTGAGGTTTCGG + Intronic
1139061834 16:63262890-63262912 AGCAGCCCTGGGGCAGGCTTAGG + Intergenic
1139923970 16:70475579-70475601 AGACGGAGTCAGGCAGGCCTGGG + Intronic
1140402734 16:74684742-74684764 AGCAGCACTTAGGGAGGCTGAGG - Intronic
1142248243 16:88979466-88979488 AGGGGCCCTAAGGCAGGCTTTGG + Intergenic
1143021978 17:3921604-3921626 AGCTGGACTCAGGCCGGCCTGGG + Intergenic
1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG + Intergenic
1151388774 17:73771743-73771765 AGCTCCACTCAGGTAAGCTTTGG + Intergenic
1152346590 17:79756236-79756258 AGCAGCACACAGGAAGGCGTGGG - Intergenic
1153673191 18:7432187-7432209 AGCAGCTCTCAGGCAGGCCAAGG + Intergenic
1155907499 18:31469281-31469303 GGCCGCACTCAGGGAGGCTGGGG + Exonic
1156228416 18:35131086-35131108 AGATCCACTCAGCCAGGCTTTGG + Intronic
1157427524 18:47596469-47596491 AGCAGAAGTCAGGCAGTCTTAGG - Intergenic
1160298338 18:77657618-77657640 AGCGCCACTCAGGGAGGCTCTGG + Intergenic
1160563868 18:79775003-79775025 AGTCGAACTCAGGCAGGAGTGGG + Intergenic
1160623496 18:80187474-80187496 AGCCGCACTGAGGGCTGCTTTGG - Intronic
1160836253 19:1126086-1126108 GCCCGGGCTCAGGCAGGCTTGGG - Intronic
1160929601 19:1564056-1564078 AGCAGCACTCAGAGAGGCTGAGG - Intronic
1162362326 19:10227549-10227571 AGCCAGTCCCAGGCAGGCTTGGG + Intronic
1164609726 19:29623926-29623948 AGCTGGAGTCAGGCAGGCTGAGG + Intergenic
1165293587 19:34908080-34908102 AGCACCACTCAGGCAGCTTTTGG + Intergenic
1166698056 19:44865468-44865490 AGCCGCTCGCTGCCAGGCTTCGG - Exonic
1167633610 19:50640282-50640304 AGGCGCACACAGGCAGGAGTTGG - Intronic
925038209 2:708655-708677 AGCAGCTCTCAGGCAGGACTCGG - Intergenic
932772532 2:74508380-74508402 TGCCACACACAGACAGGCTTAGG + Exonic
935363652 2:102268112-102268134 ATCCGGTCTCAGGCAGGCCTTGG + Intergenic
939090227 2:137771624-137771646 AGCCACTCTCAGGAAGACTTTGG - Intergenic
942101208 2:172585873-172585895 AGCAGCACTCAGGCTGGGTGCGG + Intronic
947754548 2:232552023-232552045 AGCTCCACTGAGGCAGGATTTGG - Intronic
948902922 2:240965255-240965277 GGCCACACTTAGGGAGGCTTGGG - Intronic
1169964480 20:11199488-11199510 AGGCCCAAGCAGGCAGGCTTTGG - Intergenic
1170954531 20:20966510-20966532 AGCCACACTCGGGCCAGCTTTGG + Intergenic
1171456575 20:25275958-25275980 AGGCGCACTCAGGGATGCTTGGG - Intronic
1172165256 20:32894900-32894922 AGCCCCACTCTGGCAGTCTTGGG + Intronic
1180177264 21:46096944-46096966 TGCCACACTCAGGCACACTTAGG + Intergenic
1181100011 22:20532688-20532710 AGCACCACCCAGGCAGCCTTGGG + Intronic
1181761464 22:25061719-25061741 ATCTGCACTCAGGTAGGCCTGGG - Intronic
1184649554 22:45913345-45913367 AGCCGCTCTCAGACAGGCTCTGG - Intergenic
1184710103 22:46244806-46244828 AGCAGCACTCACTCAGGCCTGGG + Exonic
1185076871 22:48687826-48687848 AGCCGCACTCAGGGAGCCTGGGG - Intronic
1185148191 22:49150457-49150479 TGCCCCACTCAGGGAGGGTTGGG + Intergenic
949877545 3:8635973-8635995 AGCCTCACTCTGGCATCCTTAGG + Intronic
949878240 3:8641133-8641155 AGCCGCACTCAGGCAGGCTTTGG - Intronic
952338824 3:32428205-32428227 AGCACCTCTCAGGCAGGCTTTGG - Intronic
952999731 3:38921487-38921509 AGCAGCACTGAGGCAGGCATAGG - Intronic
961825102 3:129595164-129595186 AGCCGCACACAGCCAGGCCAGGG + Intronic
962720419 3:138168874-138168896 AGCCTCAATCTGCCAGGCTTGGG - Intronic
963130924 3:141856899-141856921 TGCCGCTCTCAGGCAGACTGTGG + Intergenic
966332622 3:178831735-178831757 CTCCACACTCAAGCAGGCTTTGG - Intronic
969587380 4:8102205-8102227 ACCCGGAAGCAGGCAGGCTTGGG - Intronic
981732819 4:147917944-147917966 ACCTGCAATCAGGCAGCCTTAGG + Intronic
985643235 5:1073435-1073457 AGCCGCACCCCGGGAAGCTTGGG - Intronic
992158085 5:73974229-73974251 AGCCAAAGGCAGGCAGGCTTAGG + Intergenic
995675133 5:114654738-114654760 AGGCACAATCAGGCAGGGTTGGG + Intergenic
996186385 5:120481261-120481283 TGGCGCACTGAGGCAGGCTGAGG - Exonic
1002395389 5:178948655-178948677 TGCCGCACTGAGGCTGGTTTGGG + Intronic
1003046803 6:2740645-2740667 AGCCACCCTCACGCATGCTTGGG + Intronic
1003340492 6:5215466-5215488 TGCCACACTCAGACAGGCCTAGG - Intronic
1006317252 6:33298165-33298187 AGGCACACTCAGGCAGGCAGAGG + Intronic
1007529961 6:42533251-42533273 ATCCTCAATCAGACAGGCTTGGG + Intergenic
1016805916 6:148211973-148211995 AGCCGCTCTCGGGCATACTTGGG + Intergenic
1019411038 7:906889-906911 GGCCGTCCTCAGGCTGGCTTGGG - Intronic
1021200648 7:17725565-17725587 AGCTGCACTGAGGCAGGTGTAGG + Intergenic
1022097679 7:27151028-27151050 AGCCGCAGTCAGGAAGGCGGCGG + Intronic
1022304676 7:29135812-29135834 AGCAGCACTCTGGGAGGCTAAGG - Intronic
1022956554 7:35386533-35386555 GGCTGCACACTGGCAGGCTTTGG + Intergenic
1029627612 7:101730109-101730131 CGCCGCACCCAGCCTGGCTTTGG + Intergenic
1030652125 7:112127740-112127762 CGCCGCACCCAGCCAAGCTTAGG - Intronic
1031033993 7:116767079-116767101 AGCAGGACTCAGCCAGGCTGAGG - Intronic
1034466631 7:151233529-151233551 AGGCCCACTGAGGCAGGCTCCGG + Exonic
1044569371 8:93700451-93700473 AGCCGCGCTCAGGCTGCCTCGGG + Intronic
1044749018 8:95398729-95398751 AGACGCACTCAGATAGGCCTGGG - Intergenic
1045225641 8:100242702-100242724 ACCCTCTCTCAGGCAGGCCTGGG - Intronic
1049065406 8:140309760-140309782 CTCAGCACTCAGGCAGGCTGTGG - Intronic
1052151811 9:25126395-25126417 AGACTCACTCAGGCAAACTTAGG + Intergenic
1053917067 9:42951395-42951417 AGTGGCAGCCAGGCAGGCTTGGG - Intergenic
1054910922 9:70454609-70454631 AGCCCAACTGAGGCAGACTTGGG + Intergenic
1059256781 9:112938090-112938112 ACCCTCACTGAGGCAGGCTCAGG - Intergenic
1060748860 9:126155744-126155766 CGCCTCACTCAGCCAGGCCTCGG + Intergenic
1060791279 9:126487256-126487278 AGCAGCACTGAGGCAGGCACTGG - Intronic
1062315213 9:135963835-135963857 ATCTGCAGCCAGGCAGGCTTGGG - Intergenic
1186171582 X:6882809-6882831 AGCGGCACTGAGGCTGGGTTGGG + Intergenic
1189813167 X:44799339-44799361 AGCAGCACTCTGGGAGGCTGAGG + Intergenic
1195387162 X:104324273-104324295 AGCAGGAGTCAGGAAGGCTTGGG - Intergenic
1196465359 X:115966990-115967012 AACCTCACGCAGGCAGTCTTTGG - Intergenic
1198743497 X:139866093-139866115 AGCAGCACTTTGGCAGGCTGAGG + Intronic
1199529429 X:148830251-148830273 AGGCCCCCTCAGGCAGGCTTCGG - Intronic