ID: 949878324

View in Genome Browser
Species Human (GRCh38)
Location 3:8641627-8641649
Sequence GCCCATCTGGTCTTTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949878324_949878336 21 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878336 3:8641671-8641693 TAGCTGGGAAAGCTGCATTCCGG 0: 1
1: 0
2: 0
3: 11
4: 178
949878324_949878332 5 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878332 3:8641655-8641677 GAGGCCAGGGCTAACCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
949878324_949878333 6 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878333 3:8641656-8641678 AGGCCAGGGCTAACCTAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 99
949878324_949878327 -9 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680
949878324_949878337 24 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878337 3:8641674-8641696 CTGGGAAAGCTGCATTCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 135
949878324_949878328 -8 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878328 3:8641642-8641664 AGATGGGCCCCTAGAGGCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949878324 Original CRISPR GCCCATCTGGTCTTTCCCAC AGG (reversed) Intronic
900294818 1:1943552-1943574 GTCCCTCTGCGCTTTCCCACCGG + Intronic
901026635 1:6281896-6281918 GCCCCACTGGTCTCGCCCACGGG + Intronic
902525790 1:17056415-17056437 GCCCCTCTGGTCTGCCCCATGGG + Intergenic
906197171 1:43936386-43936408 CCCCATCTGCTCTTCCCCGCGGG + Exonic
906746629 1:48226447-48226469 GCACATCCTCTCTTTCCCACTGG - Intronic
907243838 1:53094782-53094804 GCCCATTTGGATTTTCCCAGGGG + Intronic
915205615 1:154268488-154268510 GCCTATTTGGTCTTTACAACAGG + Intronic
915301152 1:154952371-154952393 GCCTTTCTGGCCTTTCCCGCTGG + Intronic
915878194 1:159635592-159635614 GCCCAGCTGGTAAGTCCCACAGG + Intergenic
918008904 1:180568027-180568049 CCCCATCTCGACTTTCCCACAGG + Intergenic
918412473 1:184273885-184273907 TCACTTCTGGGCTTTCCCACAGG - Intergenic
921177219 1:212606118-212606140 GCCCCTGAGGTCTTTGCCACAGG - Intronic
921442330 1:215202226-215202248 ACCCGTCTTCTCTTTCCCACGGG + Intronic
924074967 1:240324196-240324218 CCCCATCTGGACATTCCAACTGG + Intronic
1065492939 10:26300766-26300788 GCTGATATGGTCTGTCCCACAGG + Exonic
1067541638 10:47159306-47159328 GCCCATCTGGGCATTCCCTGTGG - Intergenic
1069754233 10:70763558-70763580 TCCCATATGGCCTTTCCCACTGG - Intergenic
1069911196 10:71760924-71760946 GCCCTTCTGTTTGTTCCCACAGG - Exonic
1073147293 10:101289275-101289297 GCCCATCATGGCATTCCCACAGG + Intergenic
1075488466 10:122846882-122846904 GCCCACCTGGTCTCTGCCTCGGG - Intronic
1075495629 10:122916384-122916406 GCCCATCTGGTCCCTGCCTCAGG + Intergenic
1075663631 10:124215456-124215478 GCCCATCAGGTCTTCCCCACAGG - Intergenic
1075737467 10:124672777-124672799 GCCCAGCTGCTCCTTGCCACTGG - Intronic
1079297342 11:19244956-19244978 GCCTATCAGGAATTTCCCACAGG - Intergenic
1080290311 11:30663844-30663866 GCTCATCTCTTCTTTCCCAGTGG + Intergenic
1084310751 11:68314761-68314783 GCCCTTCTGGGCTCTCCCAGAGG - Intronic
1086804812 11:91227189-91227211 GCCCATCTGGTTTCTCCTACTGG + Intergenic
1093517350 12:20004189-20004211 CCCCATGTGGTCTTTCCAGCAGG - Intergenic
1094775127 12:33717952-33717974 GACAATCTGGTCCTTGCCACAGG + Intergenic
1096775214 12:53959592-53959614 GCACATCTGGACTCTACCACTGG - Intergenic
1097567119 12:61285025-61285047 GCCCATTTGGTCTTTCTCAGAGG - Intergenic
1098967778 12:76810995-76811017 GTCCATGTGGTCTTTCCAGCAGG + Intronic
1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG + Intergenic
1103243975 12:119439414-119439436 GCTGATCTGGACTCTCCCACTGG - Intronic
1111685882 13:91500374-91500396 GGCCATCTGATATTTCCTACTGG + Intronic
1118594761 14:67426997-67427019 GCTCATCTAGTTTTTCCCAGTGG - Intergenic
1119178896 14:72590829-72590851 GCCCTTCTGGTCTTTTCTTCTGG - Intergenic
1122272221 14:100573393-100573415 CCCCAGCTGCTCCTTCCCACTGG - Intronic
1122610945 14:102983167-102983189 GCCCACCTGGACCTCCCCACTGG + Intronic
1122795362 14:104203360-104203382 GCCCCTTTGTTCTATCCCACAGG + Intergenic
1123061149 14:105595050-105595072 GCTCATCTGGTCTTCCTCTCAGG + Intergenic
1123085604 14:105715961-105715983 GCTCATCTGGTCTTCCTCTCAGG + Intergenic
1123988835 15:25668325-25668347 GCCCGTCTGCTCTCACCCACTGG - Intergenic
1125506616 15:40271241-40271263 GCCCTTCTGCTCTTTCTGACAGG - Intronic
1126675625 15:51157478-51157500 ACCCATCTGGTCCCTCACACAGG - Intergenic
1128562354 15:68677259-68677281 GCACTGCTGGTCATTCCCACTGG + Intronic
1128745656 15:70112260-70112282 GCACATGTGGTCTCTCCCCCAGG + Intergenic
1128791940 15:70440223-70440245 GCCCATCTCATCTCTCCCACAGG + Intergenic
1128896339 15:71377215-71377237 TCACATCTGTTCTTCCCCACTGG - Intronic
1129612165 15:77070037-77070059 GCCCATCTGGACTTTGCACCCGG - Intronic
1131070843 15:89464763-89464785 GCCCAGTTGTTCATTCCCACAGG - Intergenic
1131997087 15:98143507-98143529 GCCCATCCAGTCTTTACCCCTGG + Intergenic
1135499483 16:22981331-22981353 GCCCTTCAGGTATTTCCCCCTGG - Intergenic
1136120612 16:28131003-28131025 GCCCAGGTGGTCTTTCCTTCAGG - Intronic
1137467734 16:48726198-48726220 TCCCATCTGATCTTTGTCACAGG + Intergenic
1139421829 16:66853767-66853789 CCTCCTCTGGTCTTCCCCACTGG + Exonic
1140631419 16:76856979-76857001 CCCCAGCTGGTTTTTCCTACAGG - Intergenic
1141475481 16:84270270-84270292 GCCCATCTGGTGTTGCTCCCTGG - Intergenic
1142828733 17:2532054-2532076 GCCCAGCTGGCCTCTCCCCCTGG + Intergenic
1143050246 17:4119428-4119450 TTCCATTTGGCCTTTCCCACCGG + Intronic
1143252404 17:5533186-5533208 GCCCATCTCCCCTTCCCCACTGG + Intronic
1143953400 17:10651405-10651427 CCCCATCTGGTGTTTAGCACAGG - Intronic
1144994316 17:19256646-19256668 GCCCCTCAGAGCTTTCCCACGGG - Intronic
1145245411 17:21265930-21265952 GACCACCTGGTCTGTCCCAGGGG + Intergenic
1145355797 17:22148591-22148613 GCCCATGTGTTTCTTCCCACCGG + Intergenic
1152656594 17:81522759-81522781 GCCCAGCTGGACTTACACACAGG - Intronic
1152847691 17:82612478-82612500 GACCAAGTGGGCTTTCCCACAGG + Intronic
1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG + Intronic
1158617793 18:59004134-59004156 CCCCATGTGGTCTTTCCTCCAGG - Intergenic
1160729172 19:632938-632960 GCCGCTCTCGTCTTTCCCGCAGG - Exonic
1160922947 19:1529152-1529174 GCCCACCTGGGCTTTCCCAAGGG + Intronic
1162852018 19:13438269-13438291 GCCCATCTGGTATTTACCTGGGG - Intronic
1163472226 19:17504358-17504380 GCACCTCTGGACCTTCCCACAGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1167591929 19:50408935-50408957 GCCCATCTGGGCCTTCCCTTGGG + Intronic
1167717652 19:51154250-51154272 GCCCCTCTGGTCTTGTCCTCGGG + Intergenic
1167767075 19:51490620-51490642 GCCCTTCTGGTCTTGTCCTCAGG - Exonic
1168434235 19:56304657-56304679 CCCCCTCTGCTCTTTCCCTCTGG - Intronic
925053558 2:836236-836258 GCCCAGCTGTTCCTTCCCAAAGG + Intergenic
925173600 2:1767397-1767419 GCTCAGCTGGTTTTTCCCCCAGG - Intergenic
925835666 2:7943921-7943943 CCTCTTCTGGTCTTTCCCATAGG - Intergenic
926080398 2:9981067-9981089 GCCCATCTTGTTGCTCCCACTGG + Intronic
932435776 2:71701912-71701934 GTCTATCTGGTCTTTGCCATGGG - Intergenic
932775526 2:74526048-74526070 TCCCTTCAGGACTTTCCCACAGG - Intronic
933755215 2:85633038-85633060 GGCCATCTGGTCCCTCCCTCAGG - Intronic
933764749 2:85699010-85699032 ACCCTGCTGGTCTATCCCACTGG - Intergenic
936851981 2:116910932-116910954 GGTCATCTGGTCTTACCTACTGG + Intergenic
937488666 2:122342286-122342308 GCTCATGTGGCATTTCCCACTGG - Intergenic
940892974 2:159053317-159053339 GCCCATATGCCCTTTCTCACAGG + Intronic
944978408 2:205086214-205086236 GCCCTACTGGTTTTTCCCCCAGG + Intronic
946450252 2:219773506-219773528 GCCACTCTGGTCTTCCCCACCGG - Intergenic
947707024 2:232284646-232284668 CCCCATGTGGTCTTTGCCCCGGG + Intronic
948192072 2:236067140-236067162 TCCAACCTGGTCTTTACCACTGG + Intronic
948270870 2:236672178-236672200 CTCCAGCTGGTCTTTCCCACGGG + Intergenic
1171433361 20:25101169-25101191 TCCCATCAGGCATTTCCCACAGG - Intergenic
1174094288 20:48075675-48075697 GCCCATCTGGTTTATCCACCAGG + Intergenic
1174902215 20:54512085-54512107 GGGCATCTGTTCTTTCACACAGG - Intronic
1175876111 20:62230969-62230991 GGCCATCTGGTCTCTCCCCAAGG + Intergenic
1178990848 21:37355233-37355255 ACCCATTTGGTCTTCCCTACTGG + Intergenic
1179422170 21:41245355-41245377 GCTCATCTGGTGTTGGCCACTGG + Intronic
1180247153 21:46555637-46555659 GCTCATCTGGGCTTTGCCATAGG + Intronic
1181666924 22:24404853-24404875 GGCCCTCTGCCCTTTCCCACAGG + Intronic
1183476623 22:38039194-38039216 CCCCATCTGGTGCTTCCCACGGG - Intronic
1183716306 22:39535441-39535463 GCCCATCCCGTCTTGCCCAGAGG - Intergenic
1184168334 22:42743642-42743664 GCCCCTTTGGTCTCTCCCTCTGG + Intergenic
949487589 3:4554625-4554647 GCCCATCTGCTCTCTCTCAGGGG - Intronic
949878324 3:8641627-8641649 GCCCATCTGGTCTTTCCCACAGG - Intronic
952763509 3:36935690-36935712 GCCCATCTCGGCTTTCCAAAGGG + Intronic
952966401 3:38623645-38623667 GCCAAACTGGTGATTCCCACAGG + Intronic
953571125 3:44072744-44072766 GCCCATCAGGTCTCTGCCAGAGG + Intergenic
954202037 3:49029186-49029208 CCCCATCTGGCCTTTTCCCCAGG + Intronic
954938583 3:54349733-54349755 GCCCATCTTGGCTTTCTCAGGGG + Intronic
955023771 3:55147294-55147316 GCTCATCTGATCCTTCCCATTGG + Intergenic
956096169 3:65718839-65718861 TTCCATCTGGTCTTTCCAATTGG + Intronic
956949636 3:74266867-74266889 GCCCAGCTGGGCTTTTCCACGGG - Intronic
957966880 3:87333372-87333394 GCCTATTTGATCTATCCCACTGG - Intergenic
962443106 3:135440999-135441021 GCCCTTCTGTTCCTTCCCCCTGG + Intergenic
963295789 3:143544951-143544973 ACCCATCTGGTCTTTGACACAGG - Intronic
964756666 3:160095424-160095446 ACCCACCTGATCTTGCCCACGGG + Intergenic
965494848 3:169385136-169385158 GCCCATCTGTGCCCTCCCACTGG + Intronic
966914799 3:184578704-184578726 TTGCATCTTGTCTTTCCCACAGG - Intronic
967984056 3:195082378-195082400 GCCCATCTTCTCTCTCCCTCTGG + Intronic
968617111 4:1582390-1582412 GCCCTTCTGGTCTTTCCCCGCGG - Intergenic
973079648 4:45973447-45973469 CCACATCTTGTCTGTCCCACTGG - Intergenic
973589009 4:52421254-52421276 GGCCATCTGGTCTTACCTCCAGG - Intergenic
985659942 5:1152053-1152075 GCCGAGCTGGACCTTCCCACAGG + Intergenic
986208160 5:5645654-5645676 GCCCATCTGGCCTGTCCCTCAGG - Intergenic
986649062 5:9946160-9946182 GCCCAGCTTGTCTTTCACCCTGG - Intergenic
986685111 5:10269710-10269732 GCCCATCTGGTTATTCCTTCAGG + Intergenic
987238972 5:15973077-15973099 ACCCATCTGTGGTTTCCCACTGG + Intergenic
990515978 5:56531199-56531221 GCTCATCTGTTTTTTTCCACTGG + Intronic
999129703 5:149273034-149273056 GCCCATCTGGCCATTGCCAAAGG - Intronic
1002790665 6:435500-435522 GCCCAGCTGGTTTCACCCACTGG + Intergenic
1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG + Intronic
1015080172 6:129214565-129214587 GGCCATCTGATCTTTCACAAAGG - Intronic
1016745196 6:147572020-147572042 GTACATCTGGTTTGTCCCACTGG + Intronic
1016783479 6:147985727-147985749 CCCCATCTGTTCTTTTCCACAGG + Intergenic
1019308366 7:347037-347059 GGCCATATGGTCTTCCCCACTGG - Intergenic
1021587596 7:22226002-22226024 ATCCATGTGGCCTTTCCCACAGG - Intronic
1023688993 7:42766551-42766573 GCCCATCTTGGCTTCCCTACAGG + Intergenic
1024360338 7:48461457-48461479 TACCATCTGTTTTTTCCCACTGG - Intronic
1025739080 7:64182151-64182173 GCCCCTCTGGCCTGTCCCAGCGG + Intronic
1029697850 7:102226149-102226171 GCCCAGCTGGCATTTCCCACTGG + Intronic
1031015073 7:116565514-116565536 CCCCATCTGGTCTTGAACACAGG + Intergenic
1031424718 7:121591590-121591612 GCCAATCTTTTCTTTCCCTCTGG + Intergenic
1031694777 7:124836617-124836639 GCTCATCTAGTCATTCACACTGG + Intronic
1033265300 7:139880514-139880536 GCCCATCTGCTCCTTCACAGAGG + Intronic
1034352915 7:150428938-150428960 GGCCATCTGGTCTACTCCACAGG - Intergenic
1037823617 8:22147772-22147794 GCCCCTCTGGTCTTTCCTGTTGG - Exonic
1037981144 8:23255225-23255247 GCCAATGTTGCCTTTCCCACAGG + Exonic
1038477478 8:27878192-27878214 ACCCACCTGGTCTTCTCCACAGG + Intronic
1038819379 8:30938294-30938316 GCCAATCTAGTCTGTCCCAAGGG - Intergenic
1039895603 8:41714481-41714503 GGCCATCGGGTCTTTCCAAAAGG + Intronic
1041219242 8:55632712-55632734 GCCTAACTGGTGTTTCCTACTGG + Intergenic
1041997174 8:64076705-64076727 GCCATTCTGTTCTTTCCCACAGG + Intergenic
1043399182 8:79867095-79867117 GCCCATGTGGTCTGTGTCACTGG + Intergenic
1045033951 8:98162980-98163002 GCCCCTCTGGGCTAACCCACTGG + Intergenic
1047550373 8:125865301-125865323 GGCTCTCTGTTCTTTCCCACTGG + Intergenic
1048267753 8:133002637-133002659 GCAGCTCTGGCCTTTCCCACTGG + Intronic
1051571987 9:18569176-18569198 ATCCATCTTATCTTTCCCACTGG + Intronic
1053514584 9:38719854-38719876 GCCCATCTGTTATTCCCAACTGG + Intergenic
1054716561 9:68562705-68562727 TACCAGCTGGTCTTTCCCAGAGG - Intergenic
1055261235 9:74436470-74436492 GCTCAGCTGGTATTTTCCACTGG + Intergenic
1061845576 9:133386309-133386331 GCCCATCTGGCCTGGCCCTCTGG - Intronic
1062286798 9:135776843-135776865 GCTCATCTGTGCTTTCCAACCGG + Intronic
1187399964 X:18950821-18950843 GCCCTTCTGGTCTCCCCCATGGG + Intronic
1188524359 X:31072723-31072745 GCCCATCTCGCCTTCCTCACTGG + Intergenic
1191624366 X:63253985-63254007 GCCCATTTTGCCTTTTCCACTGG + Intergenic
1192510397 X:71717714-71717736 GCCCAGCACGTCTCTCCCACTGG + Exonic
1192516300 X:71763839-71763861 GCCCAGCACGTCTCTCCCACTGG - Exonic
1192973038 X:76253599-76253621 GCCCCTCTGGTGTCTCTCACAGG + Intergenic
1195108245 X:101621090-101621112 GGCCATCTGGCTTCTCCCACAGG + Intergenic
1195443227 X:104921422-104921444 GCCGGTCTGGCCATTCCCACAGG + Intronic
1199679624 X:150215826-150215848 GCCCTGCCTGTCTTTCCCACAGG + Intergenic
1199695607 X:150341223-150341245 GCCCTGCCTGTCTTTCCCACAGG - Intergenic
1200836235 Y:7734485-7734507 GTCAATCTGGTCTCTCCAACTGG + Intergenic