ID: 949878324

View in Genome Browser
Species Human (GRCh38)
Location 3:8641627-8641649
Sequence GCCCATCTGGTCTTTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949878324_949878333 6 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878333 3:8641656-8641678 AGGCCAGGGCTAACCTAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 99
949878324_949878332 5 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878332 3:8641655-8641677 GAGGCCAGGGCTAACCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
949878324_949878327 -9 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680
949878324_949878328 -8 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878328 3:8641642-8641664 AGATGGGCCCCTAGAGGCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 240
949878324_949878336 21 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878336 3:8641671-8641693 TAGCTGGGAAAGCTGCATTCCGG 0: 1
1: 0
2: 0
3: 11
4: 178
949878324_949878337 24 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878337 3:8641674-8641696 CTGGGAAAGCTGCATTCCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949878324 Original CRISPR GCCCATCTGGTCTTTCCCAC AGG (reversed) Intronic