ID: 949878327

View in Genome Browser
Species Human (GRCh38)
Location 3:8641641-8641663
Sequence CAGATGGGCCCCTAGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 680}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949878317_949878327 8 Left 949878317 3:8641610-8641632 CCTCCCGAAGTGTGCAGCCTGTG 0: 1
1: 0
2: 1
3: 6
4: 127
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680
949878324_949878327 -9 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680
949878313_949878327 18 Left 949878313 3:8641600-8641622 CCACTATCCCCCTCCCGAAGTGT 0: 1
1: 0
2: 1
3: 9
4: 323
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680
949878312_949878327 24 Left 949878312 3:8641594-8641616 CCGGAACCACTATCCCCCTCCCG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680
949878320_949878327 5 Left 949878320 3:8641613-8641635 CCCGAAGTGTGCAGCCTGTGGGA 0: 1
1: 0
2: 2
3: 18
4: 160
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680
949878314_949878327 11 Left 949878314 3:8641607-8641629 CCCCCTCCCGAAGTGTGCAGCCT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680
949878316_949878327 9 Left 949878316 3:8641609-8641631 CCCTCCCGAAGTGTGCAGCCTGT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680
949878321_949878327 4 Left 949878321 3:8641614-8641636 CCGAAGTGTGCAGCCTGTGGGAA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680
949878315_949878327 10 Left 949878315 3:8641608-8641630 CCCCTCCCGAAGTGTGCAGCCTG 0: 1
1: 0
2: 0
3: 12
4: 105
Right 949878327 3:8641641-8641663 CAGATGGGCCCCTAGAGGCCAGG 0: 1
1: 1
2: 2
3: 40
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949878327 Original CRISPR CAGATGGGCCCCTAGAGGCC AGG Intronic