ID: 949878332

View in Genome Browser
Species Human (GRCh38)
Location 3:8641655-8641677
Sequence GAGGCCAGGGCTAACCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949878320_949878332 19 Left 949878320 3:8641613-8641635 CCCGAAGTGTGCAGCCTGTGGGA 0: 1
1: 0
2: 2
3: 18
4: 160
Right 949878332 3:8641655-8641677 GAGGCCAGGGCTAACCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
949878324_949878332 5 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878332 3:8641655-8641677 GAGGCCAGGGCTAACCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
949878316_949878332 23 Left 949878316 3:8641609-8641631 CCCTCCCGAAGTGTGCAGCCTGT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 949878332 3:8641655-8641677 GAGGCCAGGGCTAACCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
949878326_949878332 -8 Left 949878326 3:8641640-8641662 CCAGATGGGCCCCTAGAGGCCAG 0: 1
1: 0
2: 5
3: 36
4: 207
Right 949878332 3:8641655-8641677 GAGGCCAGGGCTAACCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
949878315_949878332 24 Left 949878315 3:8641608-8641630 CCCCTCCCGAAGTGTGCAGCCTG 0: 1
1: 0
2: 0
3: 12
4: 105
Right 949878332 3:8641655-8641677 GAGGCCAGGGCTAACCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
949878314_949878332 25 Left 949878314 3:8641607-8641629 CCCCCTCCCGAAGTGTGCAGCCT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 949878332 3:8641655-8641677 GAGGCCAGGGCTAACCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
949878321_949878332 18 Left 949878321 3:8641614-8641636 CCGAAGTGTGCAGCCTGTGGGAA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 949878332 3:8641655-8641677 GAGGCCAGGGCTAACCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
949878317_949878332 22 Left 949878317 3:8641610-8641632 CCTCCCGAAGTGTGCAGCCTGTG 0: 1
1: 0
2: 1
3: 6
4: 127
Right 949878332 3:8641655-8641677 GAGGCCAGGGCTAACCTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949878332 Original CRISPR GAGGCCAGGGCTAACCTAGC TGG Intronic