ID: 949878336

View in Genome Browser
Species Human (GRCh38)
Location 3:8641671-8641693
Sequence TAGCTGGGAAAGCTGCATTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949878330_949878336 -2 Left 949878330 3:8641650-8641672 CCCTAGAGGCCAGGGCTAACCTA 0: 1
1: 0
2: 1
3: 3
4: 70
Right 949878336 3:8641671-8641693 TAGCTGGGAAAGCTGCATTCCGG 0: 1
1: 0
2: 0
3: 11
4: 178
949878324_949878336 21 Left 949878324 3:8641627-8641649 CCTGTGGGAAAGACCAGATGGGC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 949878336 3:8641671-8641693 TAGCTGGGAAAGCTGCATTCCGG 0: 1
1: 0
2: 0
3: 11
4: 178
949878326_949878336 8 Left 949878326 3:8641640-8641662 CCAGATGGGCCCCTAGAGGCCAG 0: 1
1: 0
2: 5
3: 36
4: 207
Right 949878336 3:8641671-8641693 TAGCTGGGAAAGCTGCATTCCGG 0: 1
1: 0
2: 0
3: 11
4: 178
949878331_949878336 -3 Left 949878331 3:8641651-8641673 CCTAGAGGCCAGGGCTAACCTAG 0: 1
1: 0
2: 0
3: 10
4: 127
Right 949878336 3:8641671-8641693 TAGCTGGGAAAGCTGCATTCCGG 0: 1
1: 0
2: 0
3: 11
4: 178
949878329_949878336 -1 Left 949878329 3:8641649-8641671 CCCCTAGAGGCCAGGGCTAACCT 0: 1
1: 0
2: 2
3: 16
4: 116
Right 949878336 3:8641671-8641693 TAGCTGGGAAAGCTGCATTCCGG 0: 1
1: 0
2: 0
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949878336 Original CRISPR TAGCTGGGAAAGCTGCATTC CGG Intronic