ID: 949879216

View in Genome Browser
Species Human (GRCh38)
Location 3:8648703-8648725
Sequence GAGGGGCCTCAGCTACATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949879216_949879224 4 Left 949879216 3:8648703-8648725 CCTTGATGTAGCTGAGGCCCCTC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 949879224 3:8648730-8648752 AAGGCTCCCAAAACACAGGTGGG 0: 1
1: 0
2: 2
3: 7
4: 212
949879216_949879222 0 Left 949879216 3:8648703-8648725 CCTTGATGTAGCTGAGGCCCCTC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 949879222 3:8648726-8648748 TTGGAAGGCTCCCAAAACACAGG 0: 1
1: 0
2: 0
3: 8
4: 151
949879216_949879225 5 Left 949879216 3:8648703-8648725 CCTTGATGTAGCTGAGGCCCCTC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 949879225 3:8648731-8648753 AGGCTCCCAAAACACAGGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 188
949879216_949879223 3 Left 949879216 3:8648703-8648725 CCTTGATGTAGCTGAGGCCCCTC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 949879223 3:8648729-8648751 GAAGGCTCCCAAAACACAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949879216 Original CRISPR GAGGGGCCTCAGCTACATCA AGG (reversed) Intronic
901378199 1:8854781-8854803 GAGGGACCTCAGCTGCCTAACGG + Intergenic
902122646 1:14180555-14180577 GAGGTGCCTCATCAATATCATGG - Intergenic
903461630 1:23524859-23524881 GTGGGGCCTAAACCACATCAGGG + Intronic
903767504 1:25744134-25744156 AAGGGGCCTGAGCTACAGCCAGG + Intronic
906282393 1:44563252-44563274 GAGGAGGCTCAGCTCCAGCAAGG - Intronic
906930895 1:50168245-50168267 GAGTGTCCCCAGCTTCATCAGGG + Intronic
908737212 1:67289448-67289470 CAGTGTCCTCAGCTTCATCAGGG - Intergenic
910789973 1:91041197-91041219 CAGTGGCCCCAGCTTCATCAGGG - Intergenic
911422945 1:97668292-97668314 GAGGGACCTCAGTTAAATCCAGG + Intronic
911980119 1:104557021-104557043 CAGTGTCCTCAGCTTCATCAGGG - Intergenic
915106587 1:153538515-153538537 GAGGGGCCACAGGTCCAGCAGGG - Intronic
916964115 1:169917723-169917745 GATGGTGCTCAGCCACATCAAGG - Intergenic
917500014 1:175577471-175577493 GTGTGGCCTCAGATAAATCATGG - Intronic
919241295 1:194919948-194919970 GATGAGCCTCAACTACATCAGGG - Intergenic
920312431 1:205056533-205056555 GCTGGGCCTCAGCTGCAGCATGG + Intronic
922621848 1:226994724-226994746 GATTGGCCTCAGCTGCAGCAGGG - Intronic
924847538 1:247788179-247788201 CAGGGTCCTCAGCTTTATCAGGG + Intergenic
1062843104 10:686385-686407 GAGGGGCCTCCGCACCCTCATGG + Intronic
1062960333 10:1568365-1568387 GAGGGGCCTCAGCGAACACACGG + Intronic
1063343469 10:5290522-5290544 GAAGGGCATCAGCTTCATCTAGG - Intergenic
1064960690 10:20961722-20961744 GAGGGGCTTCAGCATCGTCACGG - Intronic
1065898450 10:30184586-30184608 GAGGGCCCTCAGAAACTTCAAGG + Intergenic
1067024976 10:42836908-42836930 GGGGGGCCTCAGGCACAGCAGGG - Intergenic
1067125946 10:43515499-43515521 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
1067681535 10:48444990-48445012 CAGGGCCCTCAGCAGCATCAAGG - Intergenic
1067905676 10:50288269-50288291 GATGGGCCCCAGATACAGCAAGG - Intergenic
1069419203 10:68231407-68231429 GATGGCCCTGAGCTACATCATGG - Exonic
1071116541 10:82228024-82228046 TAGGGGCCTCTGAAACATCAGGG - Intronic
1071859116 10:89654753-89654775 AAGGGGGCTCAGGCACATCATGG + Intergenic
1073329116 10:102659414-102659436 GAGGGGCCTCACCTTCAAAAAGG + Intergenic
1073440387 10:103549211-103549233 GAGGGACCTCAACTCCATCCAGG + Intronic
1075723954 10:124602416-124602438 GAGGAGCCTCACCTGCATCCCGG + Intronic
1076545262 10:131240897-131240919 GAGGGGCTGCAGCGGCATCAGGG + Intronic
1076837563 10:133028754-133028776 AAGAGGCCTCAGCTAGAGCATGG - Intergenic
1076994036 11:289661-289683 GAGGGGCCTCAGGAAAATCGGGG + Intronic
1077228294 11:1447819-1447841 GATGGGCCTCAGCGATATCCAGG - Intronic
1077462923 11:2719829-2719851 CAAGGGCCACAGCTACATCAGGG - Intronic
1078937774 11:15966587-15966609 AAGGGGCCTGAGCCCCATCACGG + Exonic
1081611400 11:44565446-44565468 GCGGGGCCTCAGCTCCAGCTGGG + Intronic
1083236987 11:61357311-61357333 GAGGGGCATCAGCTGGTTCAAGG - Exonic
1083431709 11:62616714-62616736 GAGGGCCCTCAGGTACAGGACGG - Exonic
1084859121 11:72006751-72006773 GAGGGGCCCCTGGTACAGCAGGG - Intronic
1086001069 11:81986822-81986844 GCCGGGCCTCAGCTGCCTCACGG - Intergenic
1086108133 11:83169165-83169187 GAGGGCCCTTTGCTACAGCAAGG + Exonic
1089768427 11:120785281-120785303 GAGAGCCCCCAGCTACATCTGGG - Intronic
1090237994 11:125163860-125163882 GGGTGGCTTCATCTACATCAGGG - Intergenic
1095497989 12:42805665-42805687 GAGGGGCCTCCCCTAGATTATGG + Intergenic
1098001185 12:65945086-65945108 GAGGGGCCTCAGGGGCATCCTGG + Intronic
1099296429 12:80833629-80833651 GATGGGCTTGAGCCACATCATGG - Intronic
1101535043 12:105608774-105608796 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
1102470276 12:113155855-113155877 GAGAGGCCTCAGCTTCCGCAGGG + Intronic
1102560327 12:113757482-113757504 GGGTGGAGTCAGCTACATCAAGG - Intergenic
1104763925 12:131314316-131314338 GAGGGGGCTCAGGTAGAGCATGG - Intergenic
1106341766 13:28836632-28836654 GAGAGGCCTGAGCTCCATCTTGG + Intronic
1107490114 13:40873689-40873711 CAGTGTCCTCAGCTTCATCAGGG - Intergenic
1108066646 13:46584580-46584602 GAGGGGGCTCTGCATCATCATGG - Intronic
1110332609 13:74289951-74289973 TAGGGCCTCCAGCTACATCAAGG - Intergenic
1113602825 13:111582844-111582866 GGGGGGCCTGGGCTACACCAGGG - Intergenic
1113937727 13:114003270-114003292 GTGGAGCCTCAGCTGCATCCAGG + Intronic
1118341668 14:64898906-64898928 AAAGGGCCCCAGCTACATGAAGG + Intergenic
1118633446 14:67726477-67726499 GAGGGGTCACATCTACATGATGG + Intronic
1119618855 14:76116714-76116736 AAGAGGCCTCAGCAGCATCATGG + Intergenic
1119761433 14:77154799-77154821 GAGGGGCCTCAGCTCCTGAAAGG - Intronic
1121935147 14:98011725-98011747 GAGGGGCCTTAGGGGCATCATGG - Intergenic
1132865328 16:2090287-2090309 GATGGGCCTCAGCAAGGTCAAGG - Exonic
1133224126 16:4332530-4332552 GAGGGGCTGCAGCTACATGCTGG - Intronic
1133416791 16:5613126-5613148 GAGGGGCCTCAGTTGGAGCAGGG + Intergenic
1136342584 16:29654696-29654718 GAGGGGCCGCTCCTACACCAAGG - Intergenic
1138150281 16:54650455-54650477 CAAGGCCCTCAGTTACATCATGG + Intergenic
1142908841 17:3069883-3069905 GGGGAGCCTCAGCTACAGTAGGG - Intergenic
1147757387 17:42778056-42778078 GTGGGGGCTCAGCTAAGTCAGGG - Intronic
1147987124 17:44313066-44313088 GAGGGGGCTCAGCAAGACCAGGG - Intronic
1149128830 17:53270541-53270563 GATGGGCTTCTACTACATCAGGG + Intergenic
1150697125 17:67415325-67415347 GAGGGTCCTGAGCTACAGAAGGG - Intronic
1151247283 17:72804656-72804678 GAGGTGCCACAGCTAGGTCATGG - Intronic
1152127356 17:78455233-78455255 AAGGGGCCTGAGCCTCATCACGG + Intronic
1152873681 17:82773370-82773392 GAGGGGCCTCACCTGCTCCAGGG - Intronic
1153009526 18:525415-525437 GAAGGGCCTCAGCCACAGAAGGG - Intergenic
1154068115 18:11128469-11128491 CAGTGTCCTCAGCTTCATCAGGG - Intronic
1158966775 18:62629163-62629185 GGGGGGCCTCACTCACATCATGG + Intergenic
1160412037 18:78681756-78681778 GAGGCGTCTCAGCTCCATCCAGG - Intergenic
925465719 2:4106022-4106044 CAGTGGGCTCAGCCACATCAAGG - Intergenic
925499751 2:4489580-4489602 CAGTGTCCTCAGCTCCATCAGGG + Intergenic
926111530 2:10187182-10187204 GAGCGGCCCCAGCAGCATCAGGG - Intronic
927276776 2:21268599-21268621 GAGGGTGGTCAGCTAAATCAAGG - Intergenic
929859992 2:45668688-45668710 GAGAGGTTTCAGCTTCATCAAGG - Intronic
932357490 2:71078381-71078403 GGAGTGCCTCAGCTTCATCAGGG - Exonic
932369947 2:71178646-71178668 GGAGTGCCTCAGCTTCATCAGGG - Intergenic
934039602 2:88116862-88116884 TAGGCGCCTCAGCTACCTAATGG + Intergenic
938373091 2:130786150-130786172 GAGGTGACTCAGTTACATCGAGG - Intergenic
939535294 2:143420582-143420604 CAGAGGCTTCAGCTACATCAAGG - Intronic
944678525 2:202054726-202054748 AAGAGGCTTCAGCTGCATCAGGG - Intergenic
946292280 2:218754422-218754444 CATGGGCATCAGCTACCTCACGG + Exonic
1171446491 20:25207851-25207873 GAGGGGTCTCAGCTGGATAAGGG + Intronic
1173709493 20:45141915-45141937 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
1173849911 20:46211269-46211291 CAGGGACCTCAGCTACATGGTGG + Intronic
1177934053 21:27319583-27319605 CAGTGGCCCCAGCTTCATCAGGG + Intergenic
1177938707 21:27382339-27382361 GAGAGTCATCACCTACATCATGG - Intergenic
1181532509 22:23524915-23524937 CAGGGGCCTCACCTGCATCATGG - Intergenic
1181802365 22:25355959-25355981 GAGGAGCCTCAGCACCTTCAGGG - Intronic
1183210614 22:36449151-36449173 GTGGGGCCTCTGCTATATCCAGG + Intergenic
1183597116 22:38819342-38819364 CAGGGGGCTCAGCTGCTTCAGGG - Exonic
1184658980 22:45956746-45956768 GATGGGCCTCACAGACATCATGG + Intronic
949342099 3:3041244-3041266 GAGAGGCAGCAGCTAGATCATGG - Intronic
949418015 3:3833855-3833877 TAGTGTCCTCAGCTTCATCAGGG + Intronic
949879216 3:8648703-8648725 GAGGGGCCTCAGCTACATCAAGG - Intronic
952289313 3:31999987-32000009 GTGCGGCCTCAGCTATAACAGGG + Intronic
954533152 3:51338101-51338123 GAGAGCCCAGAGCTACATCAGGG - Intronic
955784406 3:62521772-62521794 GAGTGGCCTCAGCCACATTCTGG + Intronic
956554106 3:70498703-70498725 GGGTGGCCTAAGATACATCATGG - Intergenic
960791340 3:121434590-121434612 GAGGGGCCTCAGGTATTTCAAGG + Intronic
962278594 3:134033625-134033647 GATGGGCCACAGCAATATCAAGG + Intronic
965034892 3:163425164-163425186 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
968363621 3:198167812-198167834 GAGGAGCTTCAGCTTCCTCAGGG + Intergenic
968522094 4:1038601-1038623 GAGGGGCCTCAGCTTCTGCATGG + Intergenic
977761741 4:100746094-100746116 GAGAGGGCCCTGCTACATCATGG - Intronic
980983278 4:139671971-139671993 GAGGGGCCTCAGAGAGACCATGG - Intronic
982847440 4:160271656-160271678 CAGTGTCCTCAGCTTCATCAGGG - Intergenic
985349325 4:189040642-189040664 GAGGGGCCTGAGGGACTTCATGG + Intergenic
986021809 5:3811740-3811762 TAGAGTCCACAGCTACATCAGGG - Intergenic
986311773 5:6556616-6556638 AGGGGGCATCAGCTGCATCACGG + Intergenic
988188434 5:27898576-27898598 CAGTGTCCTCAGCTTCATCAAGG - Intergenic
994353431 5:98770626-98770648 GAGGGGGCTCAGCGGGATCAGGG - Exonic
994490822 5:100441056-100441078 CAGGGGCCTCAGGAACATTACGG - Intergenic
994958111 5:106561662-106561684 TAGTGTCCTCAGCTTCATCAGGG - Intergenic
997480294 5:134179432-134179454 GTGGAGCCTCAGCTTCCTCAGGG - Intronic
1002421985 5:179153680-179153702 CAGGGGCCTCAGCTGCCTCCAGG - Intronic
1003865578 6:10359535-10359557 GAGAACCCTCTGCTACATCAGGG - Intergenic
1004006327 6:11640615-11640637 GAGGGGCCTCGGTGACAGCAGGG - Intergenic
1005315547 6:24599633-24599655 TGGGGGCCTCAGCTACAGCCTGG + Intronic
1006728825 6:36219646-36219668 AAGGGGCCCCAGATAAATCAAGG - Intronic
1006946141 6:37785581-37785603 GAGGGGCCGCAGATGCAGCAGGG - Intergenic
1008236526 6:49057926-49057948 GAGTGGCCTGAGCTATATCAGGG + Intergenic
1010984935 6:82412854-82412876 CAGGAGCCTCAGCTACTGCAGGG + Intergenic
1011599570 6:89047614-89047636 GAGGAACCTCAGCTACTTTAGGG + Intergenic
1011710455 6:90047561-90047583 GAAGGTGCTCAGCTTCATCAAGG - Intronic
1014416658 6:121192714-121192736 CAGTGTCCTCAGCTTCATCATGG - Intronic
1018123334 6:160658204-160658226 CAGTGTCCTCAGCTTCATCAGGG + Intronic
1019389910 7:780250-780272 GAGGGGCCTCAGCTCCGGCCTGG + Intronic
1023234389 7:38068404-38068426 GAGGGTCTTCAGATAAATCAGGG + Intergenic
1029960887 7:104688494-104688516 CAGTGTCCTCAGCTTCATCAAGG - Intronic
1034353405 7:150432061-150432083 GAAGGGCCTCAGCACCACCATGG - Intergenic
1035325966 7:158066257-158066279 GAGGGGACTCATCCACCTCATGG - Intronic
1035366625 7:158352500-158352522 GAGGGGCCTGACCCACCTCAGGG - Intronic
1035631137 8:1107341-1107363 GCGGGGGCTCAGCAACAGCAAGG - Intergenic
1039792991 8:40890685-40890707 GAGGGGCCACTGCCACATGAAGG - Intronic
1044202045 8:89449811-89449833 CAGTGTCCTCAGCTTCATCAGGG - Intergenic
1045272842 8:100676504-100676526 GAGGCTCCCCAGCTGCATCAGGG - Intergenic
1049372344 8:142273821-142273843 GAGGGTCCTCAGTTGCCTCAGGG - Intronic
1051332633 9:16039267-16039289 TAGGGGCCTCAGCCACATGAGGG - Intronic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1057907594 9:98994472-98994494 GAGGGGGCTTAGCTAAATAATGG - Intronic
1061849238 9:133404829-133404851 CAGTGGCCTCAGCCTCATCAAGG + Exonic
1062081714 9:134627622-134627644 AAGGGGCCTCAGCAGCAGCAGGG - Intergenic
1185843627 X:3416668-3416690 GAGAGGCCTCAGCTCCAGAAGGG + Intergenic
1190318299 X:49165009-49165031 GAGTGTCCCCAGCTACATCCCGG - Exonic
1191769835 X:64742785-64742807 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
1191831262 X:65419005-65419027 GAGGGGCCACAGTTACATTTTGG - Intronic
1194755569 X:97734636-97734658 GAGGAGCCTCATCTACACCAGGG + Intergenic
1195024519 X:100862850-100862872 GAGGCATCTCAGCAACATCATGG + Intronic
1196372673 X:114996819-114996841 CAGTGTCCTCAGCTTCATCAGGG + Intergenic
1199980159 X:152916431-152916453 GAGGGGGCTCAGATAACTCAGGG - Intronic