ID: 949880049

View in Genome Browser
Species Human (GRCh38)
Location 3:8654495-8654517
Sequence CAGTGTAACTGCAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949880049 Original CRISPR CAGTGTAACTGCAGGGAAGT AGG (reversed) Intronic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
901904517 1:12396225-12396247 CAGTGTGACTGTAGGGCCGTTGG + Intronic
902893158 1:19459676-19459698 AAGTGAAACTGCAGGTAAGGGGG - Intronic
906501561 1:46344814-46344836 CAGTCGAACAGCAGGGAATTTGG - Exonic
910339548 1:86170117-86170139 CAAGGTAACTGAAGAGAAGTAGG + Intergenic
910765887 1:90781814-90781836 CAGTGAAACTGCAGGGATAAAGG + Intergenic
912445773 1:109735107-109735129 CAGTCTTACTGCAGGCAAGTGGG - Exonic
913687468 1:121246459-121246481 GGGTGAAACTCCAGGGAAGTAGG + Intronic
914039330 1:144034104-144034126 GGGTGAAACTCCAGGGAAGTAGG + Intergenic
914150129 1:145033832-145033854 GGGTGAAACTCCAGGGAAGTAGG - Intronic
916407577 1:164512792-164512814 CCCTGAAACTTCAGGGAAGTAGG + Intergenic
916690138 1:167182248-167182270 GATAGTAACTGCAGGGAAGAGGG - Intergenic
917787269 1:178472203-178472225 CAGTCTAACTAAAGGAAAGTAGG - Intronic
918516147 1:185365881-185365903 CCTTTTAACTGCAAGGAAGTTGG + Intergenic
919781299 1:201222830-201222852 GAGTGTACCTGCAGGGGTGTGGG + Intronic
920474796 1:206264979-206265001 GGGTGAAACTCCAGGGAAGTAGG + Intronic
920991324 1:210942669-210942691 CTGTGTAACTTCAGGAAAATGGG + Intronic
921393041 1:214636435-214636457 CAGTTTAGCAGCAGGGAAGCAGG + Intronic
922062530 1:222105971-222105993 CTGTGTAATTGCAGGACAGTGGG - Intergenic
923188670 1:231598665-231598687 CAGTGAAACTGCAGATAAGCGGG + Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923508111 1:234624270-234624292 TGGAGTAACTGCAGAGAAGTGGG - Intergenic
1064583411 10:16816433-16816455 CAGTGAAACTGAAGGCAAGAGGG + Intronic
1070100513 10:73381778-73381800 CAGAGTAACAGGAGGGCAGTAGG - Intronic
1070854178 10:79593472-79593494 CAGTGTTACAGGAGAGAAGTGGG + Intergenic
1071542488 10:86499656-86499678 AAGTGAAACTGCAGGTAAGGGGG + Intronic
1072341041 10:94450211-94450233 CAGTATAACTGCAGGGGACAAGG + Intronic
1073676195 10:105649783-105649805 CAGTGTCTCTGCAGCGCAGTCGG - Intergenic
1074952754 10:118355705-118355727 CAGTTTCACTGCAGTGCAGTTGG - Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075454760 10:122577918-122577940 CAGAGTATCTGCAGAGAAGCAGG - Intronic
1075844380 10:125533849-125533871 CCGTGTAGCTGCAGAGCAGTCGG + Intergenic
1075991433 10:126842041-126842063 CCATGTAACTCCTGGGAAGTTGG - Intergenic
1076021429 10:127076909-127076931 CAGTGAAACTCCAGGCAAGAAGG - Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1077178546 11:1202293-1202315 GAGTGTATCTGCAGGCAAGCGGG + Intergenic
1078037755 11:7825223-7825245 CAGAGTGACTGCAGTGAGGTGGG + Exonic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078831824 11:14984794-14984816 TGGTGAAACTGGAGGGAAGTAGG - Intronic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1080414129 11:32053722-32053744 CAGTGCAACTGCAGTGTAGGGGG + Intronic
1081394507 11:42569703-42569725 CAGAGTAAATGAAGGGAAATTGG - Intergenic
1083383907 11:62293240-62293262 GAATGTAACTGCAGGGGAGCTGG - Intergenic
1085287377 11:75372396-75372418 CTGTTTAACTGCAAGGAACTTGG - Intergenic
1085554207 11:77404667-77404689 CATTGTAACTGGAAGGAAGAAGG - Intronic
1086967209 11:93042027-93042049 GAAAGTAACTGCAGGGAAGGAGG - Intergenic
1090855033 11:130603437-130603459 GATTCTATCTGCAGGGAAGTAGG - Intergenic
1091655440 12:2342844-2342866 CAGTTTCACTGCTGGGAAGGAGG - Intronic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1092650781 12:10632439-10632461 CAGTGTAGCTGGAGCCAAGTGGG + Intronic
1092937662 12:13379123-13379145 CAGAGGAAATGCAGGGAGGTGGG - Intronic
1093130152 12:15382099-15382121 GAGTATAATTTCAGGGAAGTAGG + Intronic
1093407531 12:18823321-18823343 CATGGTCACTGCAGGGAAGCTGG - Intergenic
1094187912 12:27664761-27664783 CAGTGCAACTGCAAGGTGGTGGG + Intronic
1096042083 12:48526359-48526381 AAGTGTCACTGCAGTGAGGTGGG - Exonic
1096586531 12:52625999-52626021 CAGTGTCACAGGAGAGAAGTGGG + Intergenic
1096859971 12:54518729-54518751 CAAGGTAACTGGAGGGAGGTGGG + Exonic
1098474943 12:70889866-70889888 CAGTGAAACGGCATGGAAATGGG - Intronic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1101713203 12:107287875-107287897 CAGTGTAACTGCCGTGAGGCAGG + Intergenic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1104151059 12:126083709-126083731 CAGGGCAGCTGCAGGAAAGTTGG + Intergenic
1104652578 12:130546884-130546906 AAGTGAAACTACAGGGAAATAGG - Intronic
1106822934 13:33486570-33486592 GAGTGAAACCGCAGAGAAGTGGG + Intergenic
1107023559 13:35776781-35776803 CAGTGAAACTGAAGGAAAGAGGG - Intronic
1110370303 13:74732656-74732678 TACTGTAACTGCGGGGAAATGGG - Intergenic
1111746072 13:92271110-92271132 CAGTGAAGCTCCAGGGAATTGGG - Intronic
1112525284 13:100140763-100140785 CATTCTAACTGCAGGTAAGATGG - Intronic
1114334110 14:21670177-21670199 CAGTGTAACTACAGTGAGATGGG + Intergenic
1115583762 14:34788753-34788775 CAGTGCCACTGCAGGAGAGTTGG - Intronic
1116648271 14:47558070-47558092 CAGTGAAAATGAAGGCAAGTGGG + Intronic
1119348104 14:73942805-73942827 AAGTGTTACTGGAGGCAAGTAGG + Intronic
1119999622 14:79288215-79288237 CAGCGTGACTGCACTGAAGTTGG - Intronic
1120459610 14:84777941-84777963 CAGTGTAACTGCATGGATTCTGG + Intergenic
1121084090 14:91132110-91132132 CAGAGTAATTGCAGACAAGTGGG - Intronic
1121171112 14:91855138-91855160 CAGTGGAACGGCAGGGATGGAGG + Intronic
1121626607 14:95389804-95389826 CACTGGAACTCCAGGGAATTGGG + Intergenic
1121666852 14:95679057-95679079 CAGTGTAACTGAAAGGAACAAGG - Intergenic
1123097615 14:105773869-105773891 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1123097632 14:105773948-105773970 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1126374833 15:47987044-47987066 CAGAGTAAATGCAGGGAAGGAGG + Intergenic
1126466905 15:48969007-48969029 CCCTGTAACTGCAGGGAATAGGG + Intergenic
1126653907 15:50955729-50955751 CACTGACACTGCAGGGGAGTAGG + Intronic
1126663204 15:51052274-51052296 CAGTGGAACTGCAGTGCTGTTGG + Intergenic
1126989139 15:54351509-54351531 CTGTGTAACTTCTGGGAAGCTGG - Intronic
1129301776 15:74629661-74629683 CAGTGTGACGGCAGGGTCGTGGG - Intronic
1129819473 15:78587867-78587889 AATTGTAACTGCATGGAGGTAGG + Intronic
1132505954 16:308985-309007 GAGTGTCTGTGCAGGGAAGTAGG - Intronic
1133266698 16:4589108-4589130 CTGCGTAAGTGCAGGGATGTGGG - Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135568205 16:23528338-23528360 CAATGGCACTGCAGGGAAGCAGG + Intronic
1138888310 16:61108465-61108487 CAGTGGAACAGCACTGAAGTTGG + Intergenic
1139076315 16:63453284-63453306 CATGCTAACTGCAGGGAAGCTGG + Intergenic
1139757614 16:69157335-69157357 GAGTGTATCTGCAGGGTAGGAGG - Intronic
1141815669 16:86407976-86407998 CAGGGAAACTGCAGGGAAGGTGG + Intergenic
1142995864 17:3760014-3760036 CAGGGTAACTCCAGGCAAGATGG + Intronic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1143328908 17:6119965-6119987 CTGTGAAACTGCAGGGCAGTAGG - Intronic
1145980653 17:29009430-29009452 CAGAGTCCCTGCTGGGAAGTAGG + Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1147396775 17:40149660-40149682 CATTGTAATTACAGAGAAGTGGG + Intronic
1148948314 17:51285563-51285585 CAGTGAAACTGCAGATAAGGGGG - Intronic
1149058954 17:52398807-52398829 CATAGTAACTGTAAGGAAGTAGG - Intergenic
1155772457 18:29719528-29719550 CAGTGTAACTCCATTGAAGAAGG + Intergenic
1155991848 18:32286394-32286416 CAGTGTAACTTCAGGGATATAGG + Intronic
1160595350 18:79969650-79969672 CAGTGTGTCTGCAGGAAACTTGG - Intronic
1160965982 19:1747181-1747203 CACTGTACCTGCAGGGAGCTAGG - Intergenic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1164631734 19:29766269-29766291 GAGTGTCACTGCAGGGAGGAGGG - Intergenic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1167854770 19:52228680-52228702 CAGTGTGACTGCTGGGATTTAGG - Exonic
1168211146 19:54891296-54891318 CAGTGAAACTGAAGGGACTTAGG + Intergenic
1202648501 1_KI270706v1_random:160975-160997 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
925769287 2:7266628-7266650 CACTGTATCTGGAGGGAAGGAGG - Intergenic
925983130 2:9192957-9192979 CTGTGTGACTGCAGGGACCTGGG + Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
927303246 2:21540164-21540186 CATTGTCACTGCTGGGAAGAGGG - Intergenic
927347865 2:22069015-22069037 CAGTGTCCTTGCAGGGCAGTGGG - Intergenic
933929780 2:87137632-87137654 CAGAATAACTGTAGGTAAGTTGG + Intergenic
934001113 2:87713424-87713446 CAGAATAACTGTAGGTAAGTTGG + Intergenic
937117068 2:119415188-119415210 CATTGCAACTGAAGGGAACTGGG + Intergenic
939319142 2:140593350-140593372 CAGGGTAACTGCAGGGAGATAGG + Intronic
941099772 2:161282634-161282656 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
941473570 2:165920899-165920921 CAGTTTCACTCAAGGGAAGTTGG - Intronic
946113324 2:217439077-217439099 CAGAGTTACTGGAGAGAAGTAGG - Intronic
946725701 2:222659094-222659116 CAGTGCAATTGCTGGGTAGTAGG - Intergenic
946789216 2:223283701-223283723 CAGTATAAAAGCAAGGAAGTAGG - Intergenic
947288286 2:228542857-228542879 CAGTGTGTCTGCAGTGAACTGGG - Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
1169035289 20:2445687-2445709 CACTATAATTGCAGGGATGTTGG - Intergenic
1170411832 20:16100818-16100840 AAGTGCAACTGCAGGGATTTAGG + Intergenic
1170463289 20:16599265-16599287 CAGTTTGGCTGCAGGTAAGTAGG + Intergenic
1171303898 20:24088480-24088502 CAGTGAAACTGGAGTGAAGGAGG - Intergenic
1173435457 20:43028393-43028415 CTGTGACACTTCAGGGAAGTTGG - Intronic
1174417195 20:50375258-50375280 AAGTGTGAGTGCAGGGAAGTTGG - Intergenic
1175672257 20:60914457-60914479 AATTGTAACTGCAGGTAAGAAGG - Intergenic
1176603352 21:8811712-8811734 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1177047496 21:16188266-16188288 CAGTGAAATTGAAGGGAAGGGGG + Intergenic
1179923492 21:44520298-44520320 GAGGGTACCTGCAGGGCAGTGGG - Intronic
1180345637 22:11703269-11703291 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1180352078 22:11814043-11814065 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1180386131 22:12178023-12178045 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1181890963 22:26063076-26063098 CGGTGTAACAGCAGAGAAGATGG - Intergenic
1184080734 22:42218044-42218066 CAGTGAATCTGCAGGGCAGTAGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184281367 22:43439480-43439502 CAGTGCCAGTGCAGGGAGGTGGG + Intronic
1184575354 22:45359950-45359972 CTGTGTAATTACAGGGAAGTGGG - Exonic
1184851545 22:47124226-47124248 CAGGGTAAATGCAGGAAGGTTGG + Intronic
1185229339 22:49671127-49671149 CAGGGTAGCAGCAGGGACGTGGG + Intergenic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
954372019 3:50174037-50174059 CAGTGTATCTGCAGAGAGGGGGG - Exonic
961816379 3:129552804-129552826 CAGAGTCTCTGCAGGGATGTGGG + Intergenic
962062073 3:131939480-131939502 CAGTGTATATTCCGGGAAGTTGG + Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
963271177 3:143287136-143287158 CAGAATAACTGCTGGCAAGTGGG + Intronic
964590953 3:158361328-158361350 CACTGCTACTGCAGGGAAGGAGG - Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966703151 3:182878607-182878629 CAGTCTCACTGCTGGAAAGTGGG - Intronic
968615072 4:1574023-1574045 CAGTGTGGCTGCTGGGAAGGAGG - Intergenic
969108974 4:4829462-4829484 CAGGGAAAATGCAGGGAAGAGGG - Intergenic
969275401 4:6131751-6131773 CATGGTTTCTGCAGGGAAGTCGG - Intronic
969838855 4:9865849-9865871 CAGTGTTCCTGCAGGGACCTTGG - Intronic
970500574 4:16672750-16672772 CAGTGTTACTGCAGGGAAAGAGG - Intronic
972349056 4:38218978-38219000 GAGTGGAACTGAAGGGTAGTAGG + Intergenic
973270611 4:48258902-48258924 GAGTGTATGTGTAGGGAAGTAGG - Intronic
973375630 4:49284961-49284983 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
973376527 4:49290980-49291002 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
973377447 4:49297132-49297154 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
973378367 4:49303268-49303290 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
973380695 4:49318235-49318257 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
973381781 4:49325280-49325302 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
973856842 4:55019949-55019971 CAGTGTCACTGTAGAGCAGTGGG - Intergenic
975810890 4:78168434-78168456 CAGGGGTGCTGCAGGGAAGTGGG - Intronic
977711558 4:100132537-100132559 CAGTGAAACTGAAAGGAAATAGG - Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979523286 4:121692584-121692606 GAGTGAAACTGCAGTGAGGTGGG - Intronic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
982362014 4:154529034-154529056 CATAGTAGCTACAGGGAAGTAGG - Intergenic
982435827 4:155383078-155383100 CAGGGTACCTGCAGGGCAGCAGG + Intergenic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
983679522 4:170336621-170336643 AAATGAAACTGCAGGGAAGCTGG - Intergenic
984692387 4:182741980-182742002 CAGTGTATCTGCTAAGAAGTAGG + Intronic
984930122 4:184839600-184839622 AAGTGTGACTGCAGGAGAGTTGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
991487672 5:67154937-67154959 TGGTTTAACAGCAGGGAAGTTGG + Intronic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
998294775 5:140957271-140957293 GAGTGAAACTGCAGGTAAGGGGG - Intronic
998500110 5:142625202-142625224 TAGTGTAACTGGCAGGAAGTGGG + Intronic
999234532 5:150082505-150082527 CAGTGCAACTGCCAGGAAGAGGG + Intronic
1004789945 6:19014368-19014390 CAGTGCTACTTCAGTGAAGTTGG - Intergenic
1006898961 6:37487816-37487838 CAGTGGAACTGCAGATAAATTGG - Intronic
1007497392 6:42269405-42269427 CCGTGTATCTTGAGGGAAGTGGG + Exonic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1008969904 6:57355448-57355470 CAGTGTTACTGCTGGGAAGCAGG + Intronic
1009158870 6:60257258-60257280 CAGTGTTACTGCCGGGAAGGAGG + Intergenic
1010026220 6:71220490-71220512 CAGTCTCTATGCAGGGAAGTTGG + Intergenic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1013482841 6:110566947-110566969 GCGAGCAACTGCAGGGAAGTGGG - Intergenic
1017037247 6:150277840-150277862 CACGGTAACTGCAGAGTAGTTGG + Intergenic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1020643981 7:10791261-10791283 CAGTGAAACTGCAAATAAGTGGG + Intergenic
1021876775 7:25057075-25057097 AAGTGCTTCTGCAGGGAAGTTGG + Intergenic
1022415965 7:30177287-30177309 CACTGCCACTGCAGGGAAGGAGG + Intergenic
1022683552 7:32573112-32573134 CAGAGTAACTACGGGGAAGGTGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1026362464 7:69615245-69615267 CAGTTTCACTTCAGGGTAGTGGG + Intronic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1032689212 7:134265898-134265920 CACTGACACTGCAGGGATGTGGG - Intergenic
1035429522 7:158808146-158808168 CAGTGGAACTGCCGATAAGTAGG - Intronic
1035744473 8:1951883-1951905 CCCTGTAACTGCAGTGAGGTGGG + Intronic
1036524723 8:9524443-9524465 CAGTATAACTGCAGTGAATGGGG + Intergenic
1038325870 8:26572359-26572381 CATCCAAACTGCAGGGAAGTGGG - Intronic
1040392171 8:46959639-46959661 CAGTGTGATTGCAGGGAATTTGG + Intergenic
1040988948 8:53328355-53328377 GGGAGTAACTGCAGGGAAGAGGG - Intergenic
1041118232 8:54561047-54561069 CAGTGTAAATGGGTGGAAGTGGG + Intergenic
1042311953 8:67387678-67387700 AAGTGTGACTGCAGTGAAATGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043437915 8:80252414-80252436 CAGTGGAACTTCAGGGGAATGGG - Intergenic
1043587291 8:81783916-81783938 CAGTTTCACTGTAGGGAGGTGGG + Intergenic
1045046040 8:98279517-98279539 CAGTGAAAGGACAGGGAAGTGGG - Intronic
1045946195 8:107798728-107798750 CAGTGCAACAGCAGAGGAGTAGG + Intergenic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048952720 8:139509580-139509602 CAGAGTACCTTCAAGGAAGTAGG - Intergenic
1051707514 9:19895997-19896019 CAGTGTGACGGCAGGGTCGTGGG + Intergenic
1051725354 9:20083297-20083319 CAGCGCAACTGCTGGGAAGGTGG - Intergenic
1054884172 9:70178007-70178029 CAGTGTAACCCCAGGGCTGTAGG + Intronic
1055901985 9:81250468-81250490 CATAGTCACTGCAGGGAAGCTGG + Intergenic
1056460403 9:86804464-86804486 AAATGTGACTGAAGGGAAGTTGG - Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1057546695 9:96024315-96024337 CAGAGTGAATGAAGGGAAGTAGG + Intergenic
1057770693 9:97965198-97965220 GGGTGTATCTGCAGGGAAGAGGG - Intergenic
1059107038 9:111520890-111520912 CATTGTAATAGCAGGGAAGGAGG - Intergenic
1059676324 9:116544048-116544070 AAGTGTTTCTGCAGGGAATTTGG - Intronic
1062027031 9:134345300-134345322 AAGTGTAGCTGCTGGGAAGGAGG + Intronic
1062104859 9:134749686-134749708 GAGTGTAACTGGAGTGTAGTTGG + Intronic
1203698431 Un_GL000214v1:117044-117066 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203699348 Un_GL000214v1:123195-123217 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203700292 Un_GL000214v1:129478-129500 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203701214 Un_GL000214v1:135498-135520 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203480042 Un_GL000224v1:4081-4103 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203481975 Un_GL000224v1:16718-16740 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203416772 Un_KI270330v1:526-548 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1203549877 Un_KI270743v1:157967-157989 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1203550814 Un_KI270743v1:164132-164154 CAGTGTCACTGCCAGGAAGGAGG - Intergenic
1203568002 Un_KI270744v1:108189-108211 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1203569640 Un_KI270744v1:119432-119454 CAGTGTCACTGCCAGGAAGGAGG + Intergenic
1186621270 X:11242701-11242723 GAGTGTAAATGAAAGGAAGTAGG + Intronic
1187923449 X:24228550-24228572 CAGGGTAAATACATGGAAGTGGG + Intergenic
1188781514 X:34292257-34292279 CAATGTCACTGTATGGAAGTGGG - Intergenic
1190794357 X:53726982-53727004 AAGTGAAACTGCAGATAAGTGGG - Intergenic
1191221396 X:57991342-57991364 TAGTGTAGCTTCAGGGAAGCAGG + Intergenic
1195805680 X:108762889-108762911 CAGTGCAACTGTTGGGAGGTTGG - Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1198530415 X:137546391-137546413 CTGCGCAACTGCAGGGTAGTTGG + Intergenic
1198666223 X:139026095-139026117 TGGTGTAAGGGCAGGGAAGTTGG - Intronic
1201672922 Y:16544518-16544540 TAGTGTAAGTGTATGGAAGTGGG + Intergenic