ID: 949882505

View in Genome Browser
Species Human (GRCh38)
Location 3:8672820-8672842
Sequence ATGCACACCCACTGCTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 7, 1: 2, 2: 32, 3: 72, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949882501_949882505 9 Left 949882501 3:8672788-8672810 CCAGGAATATGAGGAGGAATATC 0: 1
1: 9
2: 8
3: 115
4: 774
Right 949882505 3:8672820-8672842 ATGCACACCCACTGCTATCTTGG 0: 7
1: 2
2: 32
3: 72
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949882505 Original CRISPR ATGCACACCCACTGCTATCT TGG Intronic
900593570 1:3470397-3470419 ATGCACACACACTGCTGCCCAGG - Intronic
904124874 1:28231286-28231308 ATGCACAACCTCTGCCTTCTGGG - Intronic
905999301 1:42410166-42410188 ATGCAGAGCAACTGCTCTCTCGG + Exonic
907239322 1:53071761-53071783 ATGCAGCCCCACTGCTAGCCTGG - Intronic
911331024 1:96525959-96525981 ACTCACACCCTCTGCTATATTGG + Intergenic
917835126 1:178935711-178935733 CTCCACACCCACAGCTATCATGG - Intergenic
919055979 1:192570033-192570055 TTGCACACCCTCTGAAATCTAGG + Intergenic
919151298 1:193703008-193703030 ATGCACTCCAAATGCTATCATGG + Intergenic
922274335 1:224062919-224062941 ATGCACACCCTCTTCTAAGTGGG - Intergenic
923514643 1:234684563-234684585 CTGTACACCCACTGCTCTGTAGG + Intergenic
1063386333 10:5618530-5618552 AGGTACACCCACTACTTTCTAGG - Intergenic
1064395029 10:14975094-14975116 ATGCGCACCCAGTGCTATATTGG - Intronic
1064396082 10:14983218-14983240 ATGCACACCCAGTGCTATCTTGG - Intronic
1064396134 10:14983523-14983545 ATGTACACCCCCTGCGATATTGG - Intronic
1064397062 10:14990662-14990684 ATGTACACCCACTGCTTTATTGG - Intergenic
1064399970 10:15013133-15013155 ATGTACAACCACTGCTTTATTGG - Intergenic
1070351548 10:75597472-75597494 AGGCACAGCCCCTGCAATCTGGG + Intronic
1073631074 10:105149668-105149690 ATGCCCACCCACCCCTATTTGGG - Intronic
1074956770 10:118398173-118398195 ATACACACACACAACTATCTAGG + Intergenic
1075840634 10:125499429-125499451 TTGCTCACCCAGTGCTACCTAGG + Intergenic
1076213665 10:128674609-128674631 ATGGACACCCAATGCTTTCAAGG + Intergenic
1076404809 10:130204691-130204713 GTGCACACGAACTGCTAGCTTGG - Intergenic
1077088573 11:767260-767282 ATGAACACACACTGGTATATGGG + Exonic
1077542342 11:3152967-3152989 ATTCCCGCCCACTGCTGTCTAGG - Intronic
1078832660 11:14992155-14992177 ATGTACACCCACTGCCATATTGG - Intronic
1079038429 11:17040972-17040994 ATGTACACCCACTGCAATATTGG + Intergenic
1079607320 11:22386139-22386161 ATGCATACTCACTGTCATCTGGG - Intergenic
1080041947 11:27768319-27768341 AGGCAGACCCACTTCAATCTGGG - Intergenic
1081448490 11:43151915-43151937 ATGTACACCCACTGCGATATTGG - Intergenic
1081448572 11:43152439-43152461 ATGTACAGCCACTGCGATATTGG - Intergenic
1081448960 11:43154760-43154782 GTGTACACCCACTGCTATATTGG - Intergenic
1081449198 11:43156299-43156321 ATGTACACCCACTGCGATATTGG - Intergenic
1081449226 11:43156450-43156472 GTGTACACCCACTGCTATATTGG - Intergenic
1081449425 11:43157716-43157738 ATGTACTCCCACTGTTATATTGG + Intergenic
1081449438 11:43157790-43157812 GTGTACACCCACTGCTATATTGG + Intergenic
1081449557 11:43158598-43158620 GTGCACACCCCCTGCGATATTGG + Intergenic
1081449602 11:43158901-43158923 GTGTACACCAACTGCTATATGGG + Intergenic
1081449632 11:43159117-43159139 ATGTACACCCACTGCTATATTGG + Intergenic
1081450848 11:43169611-43169633 ATGTACACCCACTGTTATATTGG + Intergenic
1081451011 11:43171108-43171130 GTGTACGCCCACTGCTATATTGG - Intergenic
1082168445 11:48972185-48972207 ATGTACACCCCCTGCGATTTTGG + Intergenic
1082168496 11:48972493-48972515 ATGTACACCCACTGCTATATTGG + Intergenic
1082234948 11:49813459-49813481 ATGTACACCCACTGCTATATTGG - Intergenic
1082234998 11:49813767-49813789 ATGTACACCCCCTGCGATATTGG - Intergenic
1082608649 11:55274430-55274452 ATGTACACCCACTGCTATATTGG - Intergenic
1082936518 11:58662147-58662169 ATGTACACCCATTGCGATATTGG + Intronic
1084227545 11:67726642-67726664 ATGTACACCCACTGCTTTATTGG - Intergenic
1084228259 11:67731390-67731412 ATGCACACCCAGTGCTATATTGG - Intergenic
1084260963 11:67978336-67978358 GTGTACACCCACTGCTTTATTGG - Intergenic
1084261663 11:67983065-67983087 ATGCACACCCACTGCTATCTTGG - Intergenic
1084261929 11:67984433-67984455 ATGTACACCCCCTGCGATATTGG + Intergenic
1084806966 11:71585483-71585505 ATGCACACCCAGTGCTATATTGG + Intronic
1084807661 11:71590223-71590245 ATGTACACCCACTGCTTTATTGG + Intronic
1084809188 11:71602461-71602483 GTGTACACCCCCTGCTATATTGG - Intronic
1084809204 11:71602537-71602559 GTGCACACCCTCTGCGATATTGG - Intronic
1084810929 11:71610741-71610763 ATGTACACCCCCTGCGATATTGG + Intergenic
1084810981 11:71611046-71611068 ATGCACACCCACTGCTATCTTGG + Intergenic
1084811682 11:71615779-71615801 ATGTACACCCACTCCTTTATTGG + Intergenic
1084844052 11:71885490-71885512 ATGCACACCCAGTGCTATATTGG + Intronic
1084844766 11:71890230-71890252 ATGTACACCCACTGCTTTATTGG + Intronic
1086401783 11:86466675-86466697 TTGCCCACCCACTGGTATTTGGG - Intronic
1086444741 11:86860645-86860667 ACGTACACCCACTGCGATATTGG - Intronic
1086444886 11:86861412-86861434 GTGCACACCCCCTGCGATATGGG - Intronic
1086701754 11:89906725-89906747 ATGTACACCCACTGTTACATTGG + Intergenic
1086701905 11:89907777-89907799 ATGTACACCCCCTGCGATATTGG + Intergenic
1086701954 11:89908085-89908107 ATGTACACCCACTGCTATATTGG + Intergenic
1086704214 11:89936441-89936463 ATGTACACCCACTGCTATATTGG - Intergenic
1086704263 11:89936749-89936771 ATGTACACCCCCTGCGATATTGG - Intergenic
1086704414 11:89937800-89937822 ATGTACACCCACTGTTACATTGG - Intergenic
1091147603 11:133293283-133293305 ATGCACACCCTCTGTGACCTAGG + Intronic
1092432224 12:8418889-8418911 ATGTACAACCACTGCTTTATTGG - Intergenic
1092432946 12:8423631-8423653 AAGCACACCCAGTGCTATATTGG - Intergenic
1092435183 12:8441754-8441776 ATGGACACCCACTGCTTTGTTGG - Intergenic
1092435540 12:8444268-8444290 ATGCACACCCAGTGCTATATTGG - Intergenic
1095697167 12:45155768-45155790 GTGTACACCCACTGCGATATTGG - Intergenic
1095697175 12:45155844-45155866 GTGTACACCCACTGCGATTTGGG - Intergenic
1096506395 12:52096292-52096314 ATGTACACCCACTGCTATATTGG + Intergenic
1096506657 12:52097990-52098012 ACGTACACCCACTGCTTTATTGG + Intergenic
1096508864 12:52115843-52115865 ATGTAAACCCACTGCTTTATTGG - Intergenic
1097434217 12:59540171-59540193 GTGTACACCCACTGCGATATTGG - Intergenic
1099140271 12:78965365-78965387 ATGCACAACCTCTGCTCTCCTGG + Intronic
1099180545 12:79469788-79469810 GTGCACACCCCCTGCAATATTGG - Intergenic
1099180610 12:79470311-79470333 ATGTACATCCCCTGCTATATTGG - Intergenic
1099181324 12:79474837-79474859 GTGCACACCCCCTGCGATTTTGG - Intergenic
1099181402 12:79475297-79475319 ATGTACACCCCCTGCGATATTGG - Intergenic
1102692250 12:114770519-114770541 GTGCATACCCACTGCCATCTGGG + Intergenic
1107544718 13:41425181-41425203 ATGCACACCCAGTGCTATATTGG - Intergenic
1107544770 13:41425486-41425508 ATGTACACCCCCTGCCATATTGG - Intergenic
1107548195 13:41453284-41453306 ATGTACACCCACTGCTATATTGG + Intergenic
1107548444 13:41455056-41455078 ATGTACACCCACTGCTTTATTGG + Intergenic
1109353811 13:61216463-61216485 GTGCACACCCCCTGCGATATAGG - Intergenic
1109354390 13:61220191-61220213 ATGTACACCTCCTGCTATATTGG - Intergenic
1109354485 13:61220802-61220824 GTGTACACCCTCTGCTATATTGG - Intergenic
1109355835 13:61229499-61229521 GTGTACACCCCCTGCTATATTGG + Intergenic
1109409290 13:61942813-61942835 ATGTATACCCACTGTTATATTGG + Intergenic
1109409304 13:61942883-61942905 CTGTACACCCACGGCTATATTGG + Intergenic
1109409642 13:61945571-61945593 ATGTACACCCCCTGCGATATTGG - Intergenic
1111810114 13:93089077-93089099 GTGTACACCCACTACTATATTGG - Intergenic
1111810245 13:93090072-93090094 GTGCACCCCCACTGCGATATTGG + Intergenic
1113417062 13:110136793-110136815 AGGCACACCCACAGCTTTGTGGG - Intergenic
1114144702 14:19961395-19961417 ATGAGCACACAATGCTATCTAGG + Intergenic
1114436032 14:22708592-22708614 ATGCACACTCCCTGCGATATTGG + Intergenic
1114436874 14:22713966-22713988 GTGCACACCCCCTGCGATATTGG - Intergenic
1114436929 14:22714272-22714294 GTGCACACCCCCTGCGATATTGG - Intergenic
1116517004 14:45816055-45816077 GTGTACACCCCCTGCTATATTGG - Intergenic
1116517213 14:45817380-45817402 ATGTACACCCCCTGCGATATGGG + Intergenic
1117037274 14:51742013-51742035 GTGTACACCCCCTGCTATATTGG + Intergenic
1117037978 14:51746606-51746628 GTGTACACCCCCTGCTATATTGG - Intergenic
1117038171 14:51747739-51747761 ATGTACACCCCCTGCGATATTGG + Intergenic
1117038229 14:51748044-51748066 ATGAACACCCACTGCTGTCTTGG + Intergenic
1117038948 14:51752702-51752724 ATGTACACCCACTGCTTTATTGG + Intergenic
1117041459 14:51772629-51772651 GTGTACACCCCCTGCTATATTGG + Intergenic
1121466579 14:94119305-94119327 AGGCACATCCACAGCTAACTGGG + Intergenic
1124242496 15:28041335-28041357 ATGCACACCCTCAGCAAACTAGG + Intronic
1125488129 15:40126583-40126605 ATGCACACCCCCTGTAATATTGG - Intergenic
1125488175 15:40126812-40126834 GTGCACACCCTCTGCCATATTGG - Intergenic
1125488645 15:40129851-40129873 ATGTACACCCCCTGCGATATTGG + Intergenic
1125488702 15:40130156-40130178 ATGTACACCCACTGCTATATTGG + Intergenic
1125488835 15:40131546-40131568 ATGTACACCCACAGCGATATTGG - Intergenic
1125489106 15:40133427-40133449 GTGTACACCCACTGCTATATTGG - Intergenic
1125550466 15:40540914-40540936 ATGTCCACACACTGCTCTCTTGG - Intronic
1129797553 15:78389579-78389601 ATGCACACCAACTGCACTTTGGG - Intergenic
1129900663 15:79145945-79145967 GTGCACACACACTGCTTTCCTGG - Intergenic
1130188610 15:81710979-81711001 ATGTACACCCCCTGGTATATTGG - Intergenic
1133504918 16:6402243-6402265 ATCCCCACCCACTGGTCTCTGGG + Intronic
1133754204 16:8750417-8750439 ATGCACAGCCTCTGCATTCTTGG - Exonic
1133991078 16:10708061-10708083 ATGTACACCCCCCGCTATATGGG + Intergenic
1135907880 16:26530060-26530082 GTGCACTCCCAATGCCATCTTGG + Intergenic
1137057344 16:35752028-35752050 CTGCACACCCACTGCGACCTGGG + Intergenic
1137564502 16:49524775-49524797 ACGCACACCGGCTGCCATCTGGG + Intronic
1143292566 17:5842843-5842865 TTGTACACCCACTGTTATATTGG + Intronic
1146298946 17:31673216-31673238 CTGCACACACACTGTTACCTGGG + Intergenic
1147673675 17:42190987-42191009 CTGCACAGCCCCTGCTACCTGGG - Intronic
1149718071 17:58813528-58813550 ATGAACAACCCCTACTATCTTGG - Intronic
1151829375 17:76540612-76540634 ATGCACAGCCACAGCTTCCTTGG - Intronic
1155543369 18:26888999-26889021 ATGTACACCCCCTGCGATATTGG - Intergenic
1159906003 18:74092977-74092999 ATTCACACCCACAGCTGTGTTGG + Intronic
1163598179 19:18232595-18232617 AGGCACACCCACAACTACCTGGG + Intronic
1166237565 19:41467590-41467612 GTGTACACCCACTGCGATATCGG + Intergenic
1166238155 19:41471390-41471412 ATGTACACCCCCTGCAATATTGG + Intergenic
1166242322 19:41502861-41502883 GTGTACACCCACTGCGATATGGG + Intergenic
1166244844 19:41518077-41518099 GTGCACACCCCCTGCGATATTGG + Intergenic
1166245698 19:41524051-41524073 GTGTACACCCACTGCGATATTGG + Intergenic
1167618884 19:50550574-50550596 ATGCACACACATTTTTATCTGGG - Intronic
1202644974 1_KI270706v1_random:131273-131295 GTGTACACCCACTGCGATATTGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
932349371 2:71019862-71019884 ATGCCCACCCAGTGCTATATTGG + Intergenic
932350104 2:71024622-71024644 ATGTACACCCACTGCTTTATTGG + Intergenic
932352389 2:71043221-71043243 TTGTACACCCCCTGCTATATTGG - Intergenic
932352431 2:71043448-71043470 ATGTACACCCCCTGCGATATTGG - Intergenic
932352657 2:71044519-71044541 ATGTACACCCCCTGCGATATTGG + Intergenic
932352711 2:71044824-71044846 ATGTACACTCACTGCTATATTGG + Intergenic
932353593 2:71050756-71050778 ATGTACACCCACTGCTTTATTGG + Intergenic
932735091 2:74248732-74248754 AAGCACATCCACTGTTTTCTAGG - Intronic
933447760 2:82403610-82403632 AGACACCCCCACTGCTATATTGG + Intergenic
933456684 2:82527089-82527111 ATGTACACCCCCTGCCATATTGG + Intergenic
933457085 2:82530084-82530106 ATGTACACCCACTGTTATATTGG - Intergenic
933457135 2:82530388-82530410 ATGTACACCCCCTGCCATATTGG - Intergenic
934507289 2:94904403-94904425 GTGTACACCCCCTGCTATATTGG - Intergenic
938364453 2:130723851-130723873 ATGCACAACCTTTGTTATCTGGG - Intergenic
940837024 2:158533574-158533596 ATGCACACACTCTGCAATGTGGG - Intronic
940871658 2:158865638-158865660 ATGCACACCCAGTGCTATATTGG + Intergenic
940872346 2:158870393-158870415 ATGTACACCCACTGCTTTATTGG + Intergenic
940873404 2:158878871-158878893 ATGTACACCCCCTGCGATATTGG + Intergenic
940873454 2:158879175-158879197 ATGTACACCCACTGCTATATTGG + Intergenic
940873681 2:158880787-158880809 AAGTACACCCACTGCTTTATTGG + Intergenic
941533348 2:166694924-166694946 ATGCACACCCAATGCTATATTGG + Intergenic
942317250 2:174707608-174707630 ATGTACACCAACTGCGATATTGG + Intergenic
942749507 2:179271765-179271787 ATGTACAGCCAGTGCTATTTGGG - Intergenic
943842558 2:192600602-192600624 GTGTACACCCCCTGCTATATTGG - Intergenic
943842602 2:192600830-192600852 ATGTACACCCCCTGCGATATTGG - Intergenic
1169890302 20:10444974-10444996 ATGCACACAGCCTGTTATCTGGG - Intronic
1170354142 20:15473913-15473935 ATGCAGACACACTTCTATGTTGG - Intronic
1171894936 20:30750194-30750216 GTGTACACCCACTGCGATATTGG - Intergenic
1172160340 20:32863622-32863644 ATGCTCATCCACTGCTCGCTGGG + Intronic
1173567714 20:44053650-44053672 ATGCACACACACTCCAAACTTGG + Intronic
1176002631 20:62839812-62839834 ATGCACGCACGCTGCTCTCTGGG + Intronic
1176002645 20:62839866-62839888 ACGCACACACACTGCTCTCTGGG + Intronic
1179671910 21:42955254-42955276 ATGTATACCCACTGCTTTATTGG - Intergenic
1180356985 22:11851171-11851193 GTGTACACCCACTGCGATATTGG + Intergenic
1180381277 22:12141160-12141182 GTGTACACCCACTGCGATATTGG - Intergenic
1181672793 22:24433556-24433578 GAGCACACCCACTGCGATGTCGG - Exonic
1183115762 22:35691527-35691549 ATGTACACCCCCTGCGATATTGG + Intergenic
1183115809 22:35691753-35691775 GTGTACACCCCCTGCTATATTGG + Intergenic
1183116162 22:35694228-35694250 ATGTACACCCACTGTTATATTGG - Intergenic
1183116213 22:35694519-35694541 ATGTACACCCCCTGCCATATTGG - Intergenic
1183116350 22:35695388-35695410 ATGTACACCCCCTGCGATATTGG + Intergenic
1183116382 22:35695539-35695561 GTGTACACCCACTGCGATATTGG + Intergenic
1183116397 22:35695615-35695637 TTGTACACCCCCTGCTATATTGG + Intergenic
1183116633 22:35697442-35697464 GTGTACACCCCCTGCTATATTGG + Intergenic
1183116719 22:35697964-35697986 ATGTACACCCCCTGCGATATTGG + Intergenic
1183116990 22:35699863-35699885 ATGTACACCCCCTGCGATATGGG - Intergenic
1183117051 22:35700250-35700272 ATGTACACCCACTGTTATATTGG - Intergenic
1183117103 22:35700553-35700575 ATGTACACCCCCTGCCATATTGG - Intergenic
1183117445 22:35702749-35702771 GTGTACACCCCCTGCTATATTGG + Intergenic
1183117529 22:35703273-35703295 ATGTACACCCCCTGCGATATTGG + Intergenic
1185284611 22:49994670-49994692 ATGCACTCCCACCGCAGTCTGGG - Exonic
949882449 3:8672515-8672537 ATGTACACCCCCTGCCATATTGG + Intronic
949882505 3:8672820-8672842 ATGCACACCCACTGCTATCTTGG + Intronic
949884720 3:8683963-8683985 ATGTACACCCACTGTTTTATTGG + Intronic
950073969 3:10174077-10174099 ATCCACACACACTCCCATCTTGG - Intronic
950327262 3:12122735-12122757 ATGCCCAGCCACTGATACCTTGG + Intronic
951409532 3:22345533-22345555 AGGCACATCCCCTGCTATCATGG + Intronic
952289068 3:31997822-31997844 ATGCACTCCCACTCCTGCCTGGG - Intronic
953537095 3:43784698-43784720 AAGCACACCCACTGTTATCCAGG + Intergenic
957044237 3:75361707-75361729 ATGTACACCCACTGCTTTATTGG - Intergenic
957044934 3:75366448-75366470 ATGCACACCCAGTGTTATATTGG - Intergenic
957076030 3:75603888-75603910 ATGTACACCCACTGCTTTATTGG - Intergenic
957076735 3:75608645-75608667 ATGCACACCCACTGCTATCTTGG - Intergenic
957076999 3:75610019-75610041 ATGTACACCCCCTGCGATATTGG + Intergenic
957077386 3:75612483-75612505 GTGTACACCCCCTGCTATATTGG + Intergenic
959982287 3:112529350-112529372 GTGTACACCCCCTGCTATATTGG - Intergenic
960090350 3:113632374-113632396 ATGCAAACCCACTTCTTTCTGGG - Intergenic
961271601 3:125693542-125693564 ATGTACACCCACTGCTATACTGG + Intergenic
961272406 3:125699056-125699078 ATGTACACCCACTGCTTTATTGG + Intergenic
961274555 3:125716534-125716556 ATGCACATCCAGTGCTATATTGG + Intergenic
961275269 3:125721293-125721315 ATGTACACCCACTGCTTTATTGG + Intergenic
961277486 3:125739170-125739192 ATGCACACCCAGTGCTATATTGG + Intergenic
961278181 3:125743915-125743937 ATGTACACCCACTGCTTTATTGG + Intergenic
961876224 3:130025741-130025763 ATGTACACCCACTGCTTTATTGG - Intergenic
961876940 3:130030501-130030523 ATGCACACTCAGTGCTATATTGG - Intergenic
964235651 3:154523973-154523995 ATGCAGCCCCACTGATATCCAGG + Intergenic
964888855 3:161515254-161515276 GTACACACCCACTGCGATATTGG + Intergenic
968143412 3:196277402-196277424 AAACACACCCACTGCTTTTTGGG + Intronic
968948929 4:3680233-3680255 CTGCACACCCACTGTGCTCTAGG - Intergenic
968989218 4:3897691-3897713 ATGCACACCCAGTGCTATATTGG - Intergenic
969020188 4:4134940-4134962 ATGCACACCCACTGCTATCTTGG - Intergenic
969020401 4:4136160-4136182 ATGTACACCCCCTGCGATATTGG + Intergenic
969020446 4:4136386-4136408 GTGTACACCCCCTGCTATATTGG + Intergenic
969022651 4:4148187-4148209 ATGTACACCCCCTGCGATATTGG + Intergenic
969022699 4:4148414-4148436 GTGTACACCCCCTGCTATATTGG + Intergenic
969024189 4:4160589-4160611 ATGTACACCCACTGCTTTATTGG - Intergenic
969025781 4:4171268-4171290 ATGCAGACCCAGTGCTATATTGG - Intergenic
969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG + Intronic
969728928 4:8941826-8941848 ATGCACACCTAGTGCTATATTGG + Intergenic
969733430 4:8971185-8971207 ATGTACACCCCCTGCGATATTGG - Intergenic
969733670 4:8972473-8972495 ATGCACACCCACGGCTATCTTGG + Intergenic
969734376 4:8977231-8977253 ATGTACACCCACTGCTTTATTGG + Intergenic
969785109 4:9451365-9451387 ATGCACACCCAGTGCTATATTGG + Intergenic
969785798 4:9456104-9456126 ATGTATACCCACTGCTTTATTGG + Intergenic
969788519 4:9475772-9475794 ATGCACACCCAGTGCTATATTGG + Intergenic
969789222 4:9480515-9480537 ATGTACACCCACTGCTTTATTGG + Intergenic
969793028 4:9505249-9505271 ATGTACACCCCCTGCGATATTGG - Intergenic
969793203 4:9506230-9506252 ATGTACACCCCCTGCGATATTGG + Intergenic
972086853 4:35228403-35228425 AGACACAGCCACTGCTATCTTGG + Intergenic
972382633 4:38533720-38533742 AGGCAGACCCACCGCAATCTGGG + Intergenic
972869315 4:43276922-43276944 ATGCACCTTTACTGCTATCTTGG + Intergenic
973105306 4:46328259-46328281 ACACACACACTCTGCTATCTTGG - Intronic
973371193 4:49249687-49249709 TTGTACACCCACTGCGATATTGG - Intergenic
973389811 4:49545624-49545646 TTGTACACCCACTGCGATATTGG + Intergenic
982542551 4:156692153-156692175 ATGCAAACCCACTGCATGCTTGG - Intergenic
983324190 4:166232379-166232401 ATGCACAAGCACTGATATCTTGG + Intergenic
983623535 4:169783707-169783729 GTGTACACCCACTGCGATATGGG - Intergenic
983623784 4:169785181-169785203 ATGTACACCCCCTGCGATATTGG - Intergenic
983624233 4:169787822-169787844 GTGTACACCCACTGCGATATTGG + Intergenic
990772547 5:59265359-59265381 AAGAAGACACACTGCTATCTAGG - Intronic
990909690 5:60841523-60841545 ATGCACAGCCAATTCTTTCTTGG + Intronic
992395651 5:76367355-76367377 ACGCACACACACTGCTCTCAAGG - Intergenic
994392689 5:99205312-99205334 ATGTACACCCCCTGCGATATTGG + Intergenic
994393124 5:99208158-99208180 TTGTACACCCACTGCGATATAGG + Intergenic
994393504 5:99210433-99210455 ATGTACACCCTCTGCGATATTGG + Intergenic
994395518 5:99223257-99223279 GTGTACACCCCCTGCTATATTGG + Intergenic
994395724 5:99224606-99224628 ATGTACACCCTCTGCGATATTGG + Intergenic
994396347 5:99228541-99228563 GTGTACACCCACTGCAATATTGG + Intergenic
994397107 5:99234165-99234187 ATGTACACCCACTGTTATATTGG - Intergenic
994835074 5:104841021-104841043 ATGCATACCCATTGCTATTCAGG + Intergenic
997682515 5:135766226-135766248 ATGTACACCCACCGCGATATGGG - Intergenic
997682836 5:135768150-135768172 GTGTACACCCACTGCGATATTGG + Intergenic
997683386 5:135771760-135771782 ATGTACACCCACTGCCGTATTGG - Intergenic
997684321 5:135778118-135778140 ATGTACACCCCCTGCTATATTGG - Intergenic
997684550 5:135779501-135779523 ATGTACACCCCCTGCAATATTGG - Intergenic
997685093 5:135782928-135782950 GTGCACACCCCCTGCGATATTGG - Intergenic
997686812 5:135794637-135794659 TTGTACACCCCCTGCGATCTTGG - Intergenic
997687266 5:135797184-135797206 GTGTACACCCACTGCGATATTGG - Intergenic
997687973 5:135801949-135801971 GTGTACACCCACTGCAATATTGG - Intergenic
997887309 5:137641708-137641730 AGGCTCACCCACTGCCATGTGGG + Intronic
998935674 5:147229685-147229707 ATGTACACCCACTGCTATGCTGG + Intergenic
998936309 5:147234101-147234123 GTGTACACCCACTACTATATTGG - Intergenic
999271139 5:150297049-150297071 ATTCCCACCCACTCCTATCCAGG + Exonic
1002181937 5:177435180-177435202 AGCCACACCCACTTCTGTCTGGG + Intronic
1004544598 6:16585702-16585724 ATACACCCCCACCACTATCTTGG + Intronic
1007060666 6:38937617-38937639 CTTCACACCCACTGTCATCTTGG - Intronic
1009228691 6:61039544-61039566 ATGCACACCTTCTGCAATATTGG + Intergenic
1009363478 6:62840414-62840436 GTGTACACCCCTTGCTATCTTGG - Intergenic
1009364374 6:62846626-62846648 GTGTACACCCACTGCGATATTGG + Intergenic
1009364735 6:62849207-62849229 GTGTACACCCACTGCAATATTGG - Intergenic
1009365702 6:62856244-62856266 GTGCACACCCCTTGCTATATTGG - Intergenic
1009367280 6:62865304-62865326 GTGCACACCCCCTGCAATGTTGG + Intergenic
1009367522 6:62867249-62867271 GTGCACACCCACTGCGATTTTGG + Intergenic
1009368383 6:62873723-62873745 ATGCACACCTCCTGCGATATTGG - Intergenic
1009368936 6:62877948-62877970 ATGTACACCCCCTGCAATATTGG - Intergenic
1010931763 6:81812374-81812396 ATGCAAGCCCATTGCTTTCTCGG - Intergenic
1011179159 6:84600065-84600087 ATGAACACCCAGTGATATCTTGG + Intergenic
1012774405 6:103482670-103482692 TTGTACACCCCCTGCTATGTTGG + Intergenic
1015974402 6:138774525-138774547 ATTGACACCCAGTGGTATCTGGG + Intronic
1016772044 6:147862496-147862518 ACGCACCCCCTCTGCTCTCTAGG + Intergenic
1020306861 7:6842204-6842226 ATGTACACACACTGCTTTATTGG - Intergenic
1020307601 7:6846969-6846991 ATGCACACCCACTGCTATCTTGG - Intergenic
1020307655 7:6847274-6847296 ATGTACACCCCCTGCGATATTGG - Intergenic
1020307835 7:6848264-6848286 ATGTACACCCCCTGCGATATTGG + Intergenic
1020312062 7:6875794-6875816 ATGTACACCCAGTGCTATATTGG - Intergenic
1020335469 7:7059160-7059182 ATGTACACCCCCTGCCATATTGG + Intergenic
1020335522 7:7059467-7059489 ATGTACACCCACTGTTATATTGG + Intergenic
1020335688 7:7060581-7060603 ATGTACACCCCCTGCGATATTGG + Intergenic
1020335738 7:7060887-7060909 ATGTACACCCACCGCTATATTGG + Intergenic
1020335886 7:7062156-7062178 GTGCACACCCCCTGCGATATTGG - Intergenic
1020336033 7:7063053-7063075 GTGTACACCCACTGCGATATTGG - Intergenic
1020336214 7:7064256-7064278 GTGTACACCCACTGCGATATTGG - Intergenic
1020336307 7:7064941-7064963 GTGTACACCCACTGCTATACTGG - Intergenic
1022424070 7:30251253-30251275 AGGCACAATCACTGCTGTCTGGG + Intergenic
1023906475 7:44525843-44525865 CTACAAACCCACTGCCATCTGGG - Intronic
1024345771 7:48311365-48311387 TTGCAAACCCACCTCTATCTTGG + Intronic
1029078025 7:97951151-97951173 ATGTACACCCACTGCTTTATTGG - Intergenic
1029078719 7:97955913-97955935 ATGCACACCCACTGCTATCTTGG - Intergenic
1029078771 7:97956218-97956240 ATGTACACCCCCTGCGATATTGG - Intergenic
1029078955 7:97957203-97957225 ATGTACACCCCCTGCGATATTGG + Intergenic
1029342978 7:99959529-99959551 ATGTACACCCCCTGCGATATTGG - Intergenic
1029343102 7:99960251-99960273 ATGTACACCCCCTGCGATATGGG - Intergenic
1029343173 7:99960704-99960726 GTGTACACCCCCTGCTATATTGG - Intergenic
1029343396 7:99962022-99962044 ATGTACACCCCCTGCGATATTGG - Intergenic
1029343879 7:99964898-99964920 GTACACACCCACTGCGATATTGG + Intergenic
1029822815 7:103160978-103161000 ATGCACACATATTGTTATCTTGG + Intergenic
1029843374 7:103388978-103389000 ATTCACACCCATTCCAATCTGGG + Intronic
1032316978 7:130847230-130847252 ATGCATACCCACTACCACCTTGG - Intergenic
1036032039 8:4984704-4984726 AAGCACAACCACTTCTATGTGGG + Intronic
1036238829 8:7065603-7065625 ATGTACACCCCCTGCGATATTGG + Intergenic
1036238879 8:7065908-7065930 ATGTACACCCACTGCTCTATTGG + Intergenic
1036239118 8:7067870-7067892 ATGTACACCCACTGCTTGATCGG + Intergenic
1036239980 8:7073358-7073380 ATGTACACCCACTGCTTTATTGG + Intergenic
1036262588 8:7252557-7252579 ATGCACACCCAGTGCTATATTGG - Intergenic
1036304000 8:7587001-7587023 ATGCACACCCAGTGCTATATTGG + Intergenic
1036314627 8:7711096-7711118 ATGCACACCCAGTGCTATATTGG - Intergenic
1036354855 8:8034993-8035015 ATGCACACCCAGTGCTATATTGG + Intergenic
1036817929 8:11915873-11915895 ATGTACACCCACTGCTCTATTGG - Intergenic
1036817978 8:11916178-11916200 ATGTACACCCCCTGCGATATTGG - Intergenic
1036820023 8:11932879-11932901 ATGTACACCCACTGCTTTATTGG - Intergenic
1036820890 8:11938462-11938484 ATGTACACCCACTGCTATACTGG - Intergenic
1036833010 8:12036672-12036694 GTGTACACCCCCTGCTATATTGG - Intergenic
1036833187 8:12037805-12037827 ATGTACACCCACTGCTTTATTGG - Intergenic
1036833879 8:12042550-12042572 ATGCACACCCAGTGCTATATTGG - Intergenic
1036855036 8:12284370-12284392 ATGTACACCCACTGCTTTATTGG - Intergenic
1036855725 8:12289115-12289137 ATGCACACCCAGTGCTATATTGG - Intergenic
1036903350 8:12688223-12688245 ATGTACACCCACTGCTTTATTGG - Intergenic
1036904050 8:12692961-12692983 ATGCACACCCAGTGCTATATTGG - Intergenic
1036905844 8:12707889-12707911 ATGTACACCCACTGCTTTACTGG - Intergenic
1036906930 8:12715118-12715140 ATGCACACCCAGTGCTATATTGG - Intergenic
1036906984 8:12715423-12715445 ATGTACACCCCCTGCGATATTGG - Intergenic
1037075818 8:14716450-14716472 ATGCACACTTACTGTTATTTTGG + Intronic
1038637873 8:29301999-29302021 ATGTACACCCCCTGCGATATTGG + Intergenic
1038639713 8:29313660-29313682 ATGTACACCCACTGTGATATTGG - Intergenic
1039610414 8:38914685-38914707 ATGCACACCCAGTGCTGACGTGG - Intronic
1039809902 8:41037451-41037473 ATGCAAACCCAAGGCCATCTGGG + Intergenic
1042846872 8:73177256-73177278 ACGAACACACACTGGTATCTAGG + Intergenic
1043614015 8:82103310-82103332 AGGCAGACCTACTGCAATCTGGG + Intergenic
1043633505 8:82365358-82365380 ATGCACACCTCCTGCGATATTGG - Intergenic
1043634152 8:82369148-82369170 ATGCACACCCTCTGCTATATTGG + Intergenic
1043635026 8:82374890-82374912 ATGTACACCCTCTGCAATATTGG - Intergenic
1045924055 8:107566532-107566554 ATGTACACCCCCTGCGATATTGG - Intergenic
1045925931 8:107578790-107578812 ATGTACACCCCCTGCAATATTGG - Intergenic
1045927366 8:107588545-107588567 ATGTACACCCTCTGCGATATTGG - Intergenic
1045927911 8:107592212-107592234 ATGTACACCCACTGTGATATTGG - Intergenic
1046401225 8:113706085-113706107 ATGGACACTCTCTTCTATCTAGG + Intergenic
1047203463 8:122784992-122785014 ATACACACCCCCTGCCCTCTAGG + Intronic
1050085572 9:1961771-1961793 ATGCATACCCACTGGTATTATGG + Intergenic
1050902304 9:10963792-10963814 ATGTACACCCCCTGCCATCTTGG + Intergenic
1050902357 9:10964094-10964116 ATGTACACCCACTGTTATATTGG + Intergenic
1050988693 9:12117785-12117807 ATGCACACACACACCTCTCTGGG + Intergenic
1051232025 9:14964472-14964494 GTGTACACCCCCTGCTATATTGG + Intergenic
1051233100 9:14973341-14973363 ATGTACACCCCCTGCTATATAGG + Intergenic
1056865070 9:90221869-90221891 ATGTACACCCCCTGCGATATTGG - Intergenic
1056865289 9:90223100-90223122 ATGCACAGCCAGTGCTATATTGG + Intergenic
1056866002 9:90227851-90227873 ATGTACACCCACTGCTTTATTGG + Intergenic
1056917024 9:90755055-90755077 ATGTACACCCACTGCTTTATTGG - Intergenic
1056917726 9:90759788-90759810 ATGCACACCCAGTGCTATATTGG - Intergenic
1056917780 9:90760093-90760115 ATGTACACCCCCTGCGATATTGG - Intergenic
1056917957 9:90761017-90761039 ATGTACACCCCCTGCGATATTGG + Intergenic
1057776890 9:98018680-98018702 TTCCACACTCACTGCAATCTTGG - Intergenic
1058517751 9:105793685-105793707 GTGTACACCCCCTGCTATGTTGG + Intergenic
1058518532 9:105798302-105798324 GTGCACACCCTCTGCAATATTGG + Intergenic
1058521055 9:105814565-105814587 ATGTACACCCCCTGCCATATTGG + Intergenic
1058521269 9:105815964-105815986 ATGTACACCCCCTGCCATATTGG + Intergenic
1058521421 9:105817261-105817283 GTGTACACCCCCTGCTATATTGG - Intergenic
1058521464 9:105817488-105817510 ATGTACACCCCCTGCGATATTGG - Intergenic
1058521895 9:105820173-105820195 ATGTACACCCACTGTTATATTGG + Intergenic
1058522066 9:105821269-105821291 ATGTACACCCCCTGCCATATTGG + Intergenic
1060488134 9:124062549-124062571 ATACAGACCCACTGCCCTCTGGG + Intergenic
1061278678 9:129584627-129584649 ATGCACAGCCCCTGCCCTCTGGG + Intergenic
1061636317 9:131911778-131911800 ATGCACAGCACCTGCTAGCTAGG - Intronic
1061647726 9:132019395-132019417 AAGCAAACACACTGCTTTCTAGG + Intronic
1203695621 Un_GL000214v1:94631-94653 GTGTACACCCACTGCGATATTGG - Intergenic
1203742043 Un_GL000218v1:11684-11706 GTGTACACCCACTGCGATATTGG + Intergenic
1203702241 Un_KI270742v1:6274-6296 GTGTACACCCACTGCGATATTGG + Intergenic
1203554221 Un_KI270743v1:192330-192352 TTGTACACCCACTGCGATATTGG + Intergenic
1203640652 Un_KI270751v1:9432-9454 GTGTACACCCACTGCGATATTGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185635049 X:1546156-1546178 ATTCACACCCTCTGCTCTCCTGG - Intergenic
1186654847 X:11601304-11601326 ATGCACCACCACTGCTCTTTTGG - Intronic
1187472327 X:19580154-19580176 AGGCCCACCCACTGCTTGCTTGG - Intronic
1201155574 Y:11129160-11129182 GTGTACACCCACTGCGATATTGG + Intergenic