ID: 949884908

View in Genome Browser
Species Human (GRCh38)
Location 3:8685054-8685076
Sequence CCTCATATCCAGAGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1284
Summary {0: 3, 1: 21, 2: 73, 3: 319, 4: 868}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949884908_949884913 -8 Left 949884908 3:8685054-8685076 CCTCTCTCCCTCTGGATATGAGG 0: 3
1: 21
2: 73
3: 319
4: 868
Right 949884913 3:8685069-8685091 ATATGAGGAAGATTTTCCCAGGG 0: 1
1: 4
2: 9
3: 48
4: 426
949884908_949884912 -9 Left 949884908 3:8685054-8685076 CCTCTCTCCCTCTGGATATGAGG 0: 3
1: 21
2: 73
3: 319
4: 868
Right 949884912 3:8685068-8685090 GATATGAGGAAGATTTTCCCAGG 0: 1
1: 3
2: 9
3: 45
4: 365
949884908_949884914 -7 Left 949884908 3:8685054-8685076 CCTCTCTCCCTCTGGATATGAGG 0: 3
1: 21
2: 73
3: 319
4: 868
Right 949884914 3:8685070-8685092 TATGAGGAAGATTTTCCCAGGGG 0: 1
1: 2
2: 7
3: 39
4: 313
949884908_949884918 18 Left 949884908 3:8685054-8685076 CCTCTCTCCCTCTGGATATGAGG 0: 3
1: 21
2: 73
3: 319
4: 868
Right 949884918 3:8685095-8685117 TGTACACCCCCTGCGATATTGGG 0: 162
1: 699
2: 1290
3: 1803
4: 1767
949884908_949884917 17 Left 949884908 3:8685054-8685076 CCTCTCTCCCTCTGGATATGAGG 0: 3
1: 21
2: 73
3: 319
4: 868
Right 949884917 3:8685094-8685116 GTGTACACCCCCTGCGATATTGG 0: 136
1: 715
2: 1086
3: 1464
4: 1293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949884908 Original CRISPR CCTCATATCCAGAGGGAGAG AGG (reversed) Intronic
904430544 1:30461347-30461369 CCTCACACCCAGAGGCAGATAGG + Intergenic
904695776 1:32330455-32330477 CCACATAGCATGAGGGAGAGTGG + Intronic
905593539 1:39186035-39186057 GCTCATAACCAAAGGGAGAGAGG - Intronic
908046738 1:60178678-60178700 TCTTGGATCCAGAGGGAGAGAGG - Intergenic
908452823 1:64273053-64273075 ACTGGTATCCAGAGGGAGAGAGG + Intergenic
908654402 1:66372681-66372703 GTTCATCTCCACAGGGAGAGGGG - Exonic
910071673 1:83221943-83221965 CTTAATATCCATAAGGAGAGAGG - Intergenic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
913674264 1:121126394-121126416 CCCCATATCCAGAGCCAGAGTGG - Intergenic
914026048 1:143913703-143913725 CCCCATATCCAGAGCCAGAGTGG - Intergenic
914664485 1:149821415-149821437 CCCCATATCCAGAGCCAGAGTGG - Intergenic
914671278 1:149872397-149872419 CCCCATATCCAGAGCCAGAGTGG + Intronic
915087582 1:153398595-153398617 TCTCATCTCCAGAGGAAGTGGGG - Intergenic
915902952 1:159859413-159859435 CCTCCTGTCCAGAGGCAGCGGGG + Intronic
922006957 1:221541059-221541081 CCAGATACCCAGAGGAAGAGGGG - Intergenic
923652112 1:235883701-235883723 CCAAAGAGCCAGAGGGAGAGAGG - Intergenic
923656954 1:235925319-235925341 CCTCATTCACACAGGGAGAGGGG + Intergenic
923825073 1:237491384-237491406 CCTCATGTACAGAGTGAGTGGGG - Intronic
923899096 1:238305703-238305725 CCCCATTTCAAGAGGGAGAATGG - Intergenic
924200400 1:241652474-241652496 CCTGATATCCATAGGGACATAGG - Exonic
924860080 1:247911461-247911483 CCTAATATCCACGGGGGGAGAGG + Intergenic
924860158 1:247911900-247911922 TCTAATATCCAGATGGAAAGGGG + Intergenic
1062909168 10:1201251-1201273 CTGCATTTGCAGAGGGAGAGAGG - Intronic
1062960455 10:1569454-1569476 TCTCATTCCCAGAGGGAGCGTGG + Intronic
1063386111 10:5617229-5617251 CCCCATATCCAGACAGAGTGAGG - Intergenic
1063585779 10:7350916-7350938 CCACAGATCCAGAGGGTGTGTGG - Intronic
1063881181 10:10534513-10534535 CCTCTGAGCCAGAGGGAGAAAGG + Intergenic
1064395049 10:14975211-14975233 CCTAATATCCGGAGGGGGAGAGG + Intronic
1064395186 10:14976033-14976055 CCTAATATCCAGGGGGGGACCGG + Intronic
1064396100 10:14983335-14983357 CCTAATATCCAGAGGGGGAGAGG + Intronic
1064396232 10:14984158-14984180 CGTCATATCCAGGCGGGGAGAGG + Intronic
1064396880 10:14989567-14989589 TCCTATATTCAGAGGGAGAGAGG + Intergenic
1064396893 10:14989642-14989664 CCTAATATCCACAGGGAGAGAGG + Intergenic
1064396902 10:14989717-14989739 CCTAACATCCAGAGTGAAAGAGG + Intergenic
1064396932 10:14989871-14989893 CCTAATGTCCAGGGGAAGAGAGG + Intergenic
1064396969 10:14990097-14990119 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1064399811 10:15012112-15012134 CCTAATATCCACAGGGAGAGAGG + Intergenic
1064399822 10:15012187-15012209 CCTAACATCCAGAGTGAAAGAGG + Intergenic
1064399853 10:15012341-15012363 CCTAGTATCCAGGGGAAGAGAGG + Intergenic
1064630374 10:17305089-17305111 CGTAATATTCAGAGGGAGATAGG + Intergenic
1065118060 10:22501326-22501348 CCTAATTTTAAGAGGGAGAGAGG - Intergenic
1065195901 10:23265224-23265246 CCTCATATCCACAGAGCGGGAGG - Intergenic
1065207316 10:23369703-23369725 ACCAATGTCCAGAGGGAGAGAGG + Intergenic
1065801788 10:29358988-29359010 CCTGATCTCCAGAGGGCCAGCGG + Intergenic
1067044124 10:42974950-42974972 CCTCAGGTCCAGTGGGAGAGGGG + Intergenic
1068872799 10:61963443-61963465 GCTCATAGCCACAGGAAGAGCGG + Intronic
1071742207 10:88372241-88372263 CCTGATTGCCAGGGGGAGAGGGG - Intronic
1072731787 10:97851066-97851088 CCTCATTTCAGGAGGGAGATTGG + Intronic
1075462922 10:122630739-122630761 CCTCACCTCCAGACGGAGAGGGG - Intronic
1076587750 10:131560880-131560902 CCACATCTCCTGGGGGAGAGGGG + Intergenic
1076646353 10:131957579-131957601 CTTCATCTCCACAGGGAGATGGG - Intronic
1076646390 10:131957726-131957748 CTTCATCTCCACAGGGAGATGGG - Intronic
1076811990 10:132891360-132891382 CCTGAGCTCCAAAGGGAGAGGGG - Intronic
1077552562 11:3207535-3207557 CAGCATATGCACAGGGAGAGGGG - Intergenic
1077604761 11:3601968-3601990 TCTAATATCCAGCGGGGGAGAGG + Intergenic
1078832438 11:14990983-14991005 TCTCATATCCATGGGGTGAGAGG + Intronic
1078832692 11:14992346-14992368 CCTAATTTCCAGGGGGAGAAAGG + Intronic
1078832722 11:14992495-14992517 CCTAATATCCAGTGGGGGAGGGG + Intronic
1079038446 11:17041081-17041103 TCTAATATCCAAAGGGGGAGAGG - Intergenic
1079038657 11:17042409-17042431 CCTAATATCCAGAGCAAAAGAGG - Intergenic
1079038669 11:17042484-17042506 CCTAATATCCAGAGGGCAAGAGG - Intergenic
1079038707 11:17042705-17042727 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1079038733 11:17042819-17042841 CCTAATATCCAGAGGGCGAGAGG - Intergenic
1079038836 11:17043436-17043458 CCTAATATCTAGGGGGAGAGAGG - Intergenic
1079038855 11:17043587-17043609 CCTAATATCCAAACGGGGAGAGG - Intergenic
1079471994 11:20787155-20787177 CATAAAGTCCAGAGGGAGAGGGG - Intronic
1081447845 11:43147627-43147649 CCTAATATCCAATGGGGGAGAGG - Intergenic
1081447972 11:43148385-43148407 CCTAATATCCAGGGGAGGAGAGG - Intergenic
1081448068 11:43149091-43149113 CCTAATATTCAAAGGGGGAGAGG - Intergenic
1081448097 11:43149236-43149258 CCTAATATCCAGGTGGGGAGAGG - Intergenic
1081448119 11:43149384-43149406 CCTAAAATCCAGAAAGAGAGAGG - Intergenic
1081448208 11:43149847-43149869 CCTAATATCCAGAGGAGGAGAGG - Intergenic
1081448353 11:43150747-43150769 CCTAATATCCAGGTGGGGAGAGG - Intergenic
1081448446 11:43151655-43151677 CCTAATATCCAGGGACAGAGAGG + Intergenic
1081448568 11:43152404-43152426 CCTAATATCGAGAGGGGGAGAGG + Intergenic
1081448622 11:43152707-43152729 CCTAATATCCAAAGGTAGAGAGG + Intergenic
1081448737 11:43153380-43153402 CCTAATATCCAGAGGGGGAGTGG + Intergenic
1081448827 11:43153909-43153931 CCTAATATCCCGGGGAAGAGAGG + Intergenic
1081448876 11:43154196-43154218 TCTAATATCCAGAGGGGGAGTGG + Intergenic
1081449036 11:43155320-43155342 CTTAATATCCAGGGAGAGAGAGG + Intergenic
1081449404 11:43157599-43157621 CCTAATAACCGGAGGGGGAGAGG - Intergenic
1081449615 11:43159000-43159022 CCTAGTATCCCGAGGGGGAGAGG - Intergenic
1081449734 11:43160058-43160080 CCTAATATCCATGGGGTGAGAGG + Intergenic
1081449865 11:43160893-43160915 CCTAATATCCAAAGAAAGAGAGG + Intergenic
1081449879 11:43160969-43160991 CCTAATATCCAAAGGCAGAGAGG + Intergenic
1081449960 11:43161416-43161438 TCTAATATTCAGTGGGAGAGAGG + Intergenic
1081450827 11:43169494-43169516 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1081450936 11:43170226-43170248 TCTAATATCCAGGGGGAGAGAGG - Intergenic
1081451020 11:43171149-43171171 CCTAATAGCCAGCGGGGGAGAGG + Intergenic
1081451161 11:43171996-43172018 CCTAATATCCAAAGGTAGAGAGG + Intergenic
1081451222 11:43172370-43172392 CCTAATATCCAGGGAGGGAGAGG + Intergenic
1081827914 11:46076005-46076027 CTTTCTAACCAGAGGGAGAGTGG + Intronic
1082168270 11:48971016-48971038 CCTAATATCCGGAGGGCGAGAGG - Intergenic
1082168477 11:48972376-48972398 CCTAATATCCGGAGGGGGAGAGG - Intergenic
1082234967 11:49813576-49813598 CCTAATATCCGGAGGGGGAGAGG + Intergenic
1082235175 11:49814933-49814955 CCTAATATCCGGAGGGCGAGAGG + Intergenic
1082608668 11:55274547-55274569 CCTAATATCCGGAGGGGGAGAGG + Intergenic
1082666646 11:55982930-55982952 CCTAATATCCAAAGGGGGAGCGG + Intergenic
1082785187 11:57312864-57312886 CCTGGTAGCCAGGGGGAGAGGGG + Exonic
1082936575 11:58662484-58662506 CCTAATATCCAAAGAGGGAGGGG - Intronic
1082936734 11:58663624-58663646 CCTAATATCCAAAGGGAGAGAGG - Intronic
1082936807 11:58664117-58664139 CCTAATATCCAGGGGGAGAGAGG - Intronic
1082936830 11:58664269-58664291 CCTAATATCCAAACGGGGAGAGG - Intronic
1083397210 11:62400160-62400182 CCTCATATCCTGGGGGGCAGTGG - Intergenic
1084227374 11:67725623-67725645 CCTAATATCCACAGGGAGAGAGG + Intergenic
1084227386 11:67725698-67725720 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1084227417 11:67725852-67725874 CTTAATATCCAGGGGAAGAGAGG + Intergenic
1084227452 11:67726078-67726100 CCTAATATCCAGGGGGAAAGAGG + Intergenic
1084260661 11:67976552-67976574 TCTAATATCCAGCGGGGGAGAGG + Intergenic
1084260746 11:67977096-67977118 CCCCATATCCAGGTGGGGAGAGG + Intergenic
1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG + Intergenic
1084260804 11:67977395-67977417 CCTAATATCCACAGGGAGAGAGG + Intergenic
1084260838 11:67977549-67977571 CCTAGTATCCAGGGGAAGAGAGG + Intergenic
1084260876 11:67977774-67977796 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1084260914 11:67978003-67978025 CCGAATATCCAAAGAGAGAGAGG + Intergenic
1084261830 11:67984079-67984101 CGTCATATCCAGGCGGGGAGGGG + Intergenic
1084261988 11:67984770-67984792 CCTAATATCCAGGCGGCGAGAGG - Intergenic
1084262089 11:67985753-67985775 CCTAGTATCCCGAGGGGGAGAGG + Intergenic
1084262113 11:67985908-67985930 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1084807748 11:71590786-71590808 CCTAATGTCCAGGGGGAAAGAGG - Intronic
1084807806 11:71591149-71591171 CCTAATATCCAGAGCGAAAGAGG - Intronic
1084807817 11:71591224-71591246 CCTAATATCCACAGGGAGAAAGG - Intronic
1084809039 11:71601187-71601209 CCTCATATTAAGAGGCCGAGAGG - Intronic
1084809066 11:71601365-71601387 CCTAGTATCCCGAGGGGGAGAGG - Intronic
1084809170 11:71602351-71602373 CCTAATATCCAGGGGGCGAGAGG + Intronic
1084809181 11:71602426-71602448 CCTAATATCCAGGGACAGAGAGG + Intronic
1084810839 11:71610106-71610128 CGTCATATCCAGGGTGGGAGAGG - Intergenic
1084810960 11:71610929-71610951 CCTAATATCTGGAGGGGGAGAGG - Intergenic
1084811774 11:71616343-71616365 CCTAATATCCAGGGGGAAAGAGG - Intergenic
1084811840 11:71616722-71616744 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1084811849 11:71616797-71616819 CCTAATATCCACAGGGAGAGAGG - Intergenic
1084811863 11:71616872-71616894 CCTCATATCCAGAGGGCGAGAGG - Intergenic
1084811909 11:71617097-71617119 CCCCATATCCAGGTGGGGAGAGG - Intergenic
1084844854 11:71890790-71890812 CCTAATATCCAGGGGGGAAGAGG - Intronic
1084844892 11:71891016-71891038 CCTAATGTCCAGGGGAAGAGAGG - Intronic
1084844934 11:71891243-71891265 CCTAATATCCACAGGGAGAGAGG - Intronic
1084845079 11:71892087-71892109 TCTAATATCCAGCGGGGGAGAGG - Intronic
1084846789 11:71907305-71907327 CGTAATATCCAGTGGGGGAGAGG - Intronic
1084847618 11:71912712-71912734 CCTAATATCCAGGGGGAAAGAGG - Intronic
1084847687 11:71913132-71913154 CCTAATATCCAGAGCGAAAGAGG - Intronic
1084847698 11:71913207-71913229 CCTAATATCCACAGGGAGAGAGG - Intronic
1086444304 11:86857992-86858014 CCTAATATCCAGAAGGCAAGAGG + Intronic
1086444365 11:86858366-86858388 CCTAATATCCAGGGAGGGAGAGG + Intronic
1086444393 11:86858517-86858539 CCTAATATCCAAGGGAAGAGAGG + Intronic
1086444420 11:86858666-86858688 CCTAATATCCAGTGGGCGACAGG + Intronic
1086444636 11:86860013-86860035 CCTAATATCCAAAGGGGGAGAGG + Intronic
1086444901 11:86861526-86861548 CATAATATCCAGTTGGAGAGGGG + Intronic
1086701936 11:89907968-89907990 CCTAATATCCGGAGGGGGAGAGG - Intergenic
1086704232 11:89936558-89936580 CCTAATATCCGGAGGGGGAGAGG + Intergenic
1086888909 11:92233959-92233981 CCTCATATCCAAAGAGAAAGAGG + Intergenic
1088747388 11:112815600-112815622 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1088987441 11:114922101-114922123 CTGCATATGCTGAGGGAGAGAGG - Intergenic
1089100884 11:115961529-115961551 CCTCAGAGCCAGCTGGAGAGGGG - Intergenic
1092432035 12:8417796-8417818 TCCTATATTCAGAGGGAGAGAGG + Intergenic
1092432051 12:8417871-8417893 CCTAATATCCACAGGGAGAGAGG + Intergenic
1092432062 12:8417946-8417968 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1092432093 12:8418100-8418122 CCTAGTATCCAGGGGGAGAGAGG + Intergenic
1092432131 12:8418326-8418348 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1092433152 12:8424608-8424630 CCTAATATCCAGGAGGGGAGAGG + Intergenic
1092435055 12:8440966-8440988 CCTAGTATCCAGGGGAAGAGAGG + Intergenic
1092435094 12:8441191-8441213 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1092435558 12:8444385-8444407 CCTAATATCCAGAGGGGGAGAGG + Intergenic
1092435681 12:8445208-8445230 CGTCATATCCAGGGGGGGAGGGG + Intergenic
1092435737 12:8445362-8445384 CCTAAGAGCCAGGGGGAGAGAGG + Intergenic
1092436064 12:8447560-8447582 CCTAATATCCAGGGGGCGAGAGG - Intergenic
1092436197 12:8448732-8448754 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1092664783 12:10783980-10784002 ACTCATCTCCATGGGGAGAGAGG - Intergenic
1093282599 12:17212578-17212600 ACAGATATCCAGAGAGAGAGAGG - Intergenic
1094022181 12:25926216-25926238 CCTCATTTCCTGAGGCAGAGTGG - Intergenic
1095697005 12:45154840-45154862 CATAATATCCAGGGGGAAAGAGG + Intergenic
1095697184 12:45155884-45155906 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1095697223 12:45156111-45156133 CCTAATATCTAGAAGGGGAGAGG + Intergenic
1095697300 12:45156622-45156644 CCTAATATCCAAAGGGGGATAGG + Intergenic
1095697314 12:45156698-45156720 CCCAATATCCAGGGGGTGAGAGG + Intergenic
1095697530 12:45158003-45158025 TCTAATATCCAGGGGGTGAGAGG + Intergenic
1095939537 12:47717084-47717106 CCTCAGAGCCAGAGGGAAAGGGG + Intronic
1096506224 12:52095280-52095302 CGTAATATCCAGTGGGGGAGAGG - Intergenic
1096506250 12:52095358-52095380 CATAATATCCAGCGGGGGAGAGG - Intergenic
1096506376 12:52096175-52096197 CCTAATATCCGGAGGGGGAGAGG - Intergenic
1096506467 12:52097015-52097037 CCTAATATCCAAAGGTGGAGAGG + Intergenic
1096506795 12:52098780-52098802 CCTAATATCCAAGGGAAGAGAGG - Intergenic
1096506823 12:52098934-52098956 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1096506856 12:52099155-52099177 CCTAATATCCAGAGGGCGACAGG - Intergenic
1096506890 12:52099377-52099399 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1096506913 12:52099475-52099497 CCTAATATCCAGAGGGCGAGAGG - Intergenic
1096508686 12:52114759-52114781 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1096508698 12:52114833-52114855 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1096508708 12:52114908-52114930 CGTAATATCCAGAGCGAAAGAGG + Intergenic
1096508738 12:52115062-52115084 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1096508774 12:52115287-52115309 CCTAATATCCAGCGGGGAAGAGG + Intergenic
1096562940 12:52450065-52450087 CCTCATATCTACAGGAAGAAAGG + Exonic
1096565091 12:52471725-52471747 CCTCATATCTACAGGAAGAAAGG + Exonic
1096567103 12:52491165-52491187 CCTCATATCTACAGGAAGAAAGG + Exonic
1096570157 12:52518272-52518294 CCTCATAGGCAGAGAGGGAGGGG + Intronic
1097432658 12:59528967-59528989 CCTTATATCCAGAGGGAAAGAGG + Intergenic
1097432672 12:59529043-59529065 CCTAATATCCAGGAGGGGAGAGG + Intergenic
1097432839 12:59530087-59530109 CCTAATAGCCAGGGGGTGAGAGG + Intergenic
1097432974 12:59530826-59530848 CATAATATCCAGAGCGGGAGAGG + Intergenic
1097433144 12:59531626-59531648 CCTAATATCCAGATGGGGAGAGG + Intergenic
1097433201 12:59532000-59532022 CTTTATATCCAGGGGAAGAGAGG + Intergenic
1097433403 12:59533313-59533335 CGTAATATCCAGTGGGGGAGAGG + Intergenic
1097434009 12:59538786-59538808 CCAAATATCCAGGGGGTGAGAGG + Intergenic
1097434146 12:59539687-59539709 CCTAATATCCAGTGGAGGAGAGG + Intergenic
1097434365 12:59541053-59541075 CCTAATATCCAGGGGTGGAGAGG + Intergenic
1097434387 12:59541201-59541223 CCTAATATCCAGTGGGGGAGAGG + Intergenic
1097434837 12:59543997-59544019 CCTAATATCCAAGGTGAGAGGGG + Intergenic
1097434897 12:59544375-59544397 CCAAATATCCAGAAGGGGAGAGG + Intergenic
1097434960 12:59544749-59544771 CCTAATATACAGCGGGAAAGGGG + Intergenic
1097435227 12:59546631-59546653 CCTAATAGCCAGGGAGAGAGAGG + Intergenic
1097435246 12:59546782-59546804 CCGAATATCCAGAGTGGGAGAGG + Intergenic
1097435752 12:59550606-59550628 CCTTATATCCAGGGGGAAAGAGG + Intergenic
1097435931 12:59551837-59551859 CGTAATATCCAGGGGGAAAGAGG + Intergenic
1097436006 12:59552268-59552290 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1097436091 12:59552865-59552887 CATAATATCTAGGGGGAGAGAGG + Intergenic
1097436182 12:59553384-59553406 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1097436200 12:59553460-59553482 CCTAATATTCAGACGGGGAGAGG + Intergenic
1097436211 12:59553536-59553558 CCTAATATCCAGGGAGGGAGAGG + Intergenic
1097436310 12:59554074-59554096 CCTAATATTTAGAGGGAGAGAGG + Intergenic
1098479050 12:70939763-70939785 CCTAATATCCAGGGCGGGAGAGG - Intergenic
1098479192 12:70940602-70940624 TCTAATATCCAGAAGGGGAGAGG - Intergenic
1098479211 12:70940753-70940775 CCTAATATCCAAGGGGGGAGAGG - Intergenic
1098479260 12:70941051-70941073 CCTAATATCCAGAGACTGAGAGG - Intergenic
1098479519 12:70942762-70942784 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1098479717 12:70944179-70944201 CCTAATATCCAGGGGGTGAGAGG - Intergenic
1098479747 12:70944332-70944354 CCTAATATCCAAGGGGAGAGAGG - Intergenic
1098479828 12:70944856-70944878 CTTAATATCCAGTGGGGGAGAGG - Intergenic
1098479839 12:70944932-70944954 CCTAATATCCAGTGGGGGAGAGG - Intergenic
1099071166 12:78047536-78047558 CCTAAAAGCCAGAGGGAGTGAGG - Intronic
1099178980 12:79456051-79456073 CATGATATCCAGTGGGGGAGAGG + Intergenic
1099180304 12:79468308-79468330 CCTAATATCCAGTGGGGGAGAGG + Intergenic
1099180385 12:79468767-79468789 ACTAATATCCAGTGGGGGAGAGG + Intergenic
1099180431 12:79469071-79469093 TCTAATATCCAGGGGGAGAGAGG + Intergenic
1099180581 12:79470055-79470077 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1099180617 12:79470352-79470374 CCTAATATCCAGAGAGGGAGAGG + Intergenic
1099180813 12:79471448-79471470 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1099181081 12:79473224-79473246 CCTAATATCCATGGGGTGAGAGG + Intergenic
1099181101 12:79473375-79473397 CCTAATATCCAGTGGGGGAGAGG + Intergenic
1099181133 12:79473599-79473621 CCTAATATCCACAAGGGGAGAGG + Intergenic
1099181156 12:79473750-79473772 CCTAATATCCAGGGAGAGAGAGG + Intergenic
1099181221 12:79474129-79474151 CCTAATATCCATGGGGGGAGAGG + Intergenic
1099181253 12:79474354-79474376 CCTAATATCCAGGCGGAAAGAGG + Intergenic
1099181396 12:79475262-79475284 CCTAATATCCAAATGGAGACAGG + Intergenic
1099181412 12:79475338-79475360 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1099181439 12:79475490-79475512 CCTAATATCCAGGCGGGGAGAGG + Intergenic
1099246385 12:80197791-80197813 GCTCACATCCAGAGGGACTGTGG - Intergenic
1099503909 12:83448564-83448586 CCTCATAACCAGTGGGAGATAGG + Intergenic
1104946403 12:132416756-132416778 CCTCATCCCTAGAGGGAGGGGGG + Intergenic
1105772992 13:23630400-23630422 CCTCAGATCCAGATAGAGAGGGG - Intronic
1106789792 13:33143017-33143039 CCTCACATGCAGAGAGAGAGAGG - Intronic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1107544735 13:41425298-41425320 CCTAATATCCGGAGGGGGAGAGG + Intergenic
1107544862 13:41426121-41426143 CGTCGTATCCAGGGGGGGAGGGG + Intergenic
1107544887 13:41426198-41426220 CCTCATATCCAGGGGGGGAGAGG + Intergenic
1107545069 13:41427507-41427529 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1107545337 13:41428600-41428622 CGTAATATCCAGGGGGTGAGAGG + Intergenic
1107548059 13:41452343-41452365 CGTAATATCCAGGGGGGGAGAGG - Intergenic
1107548179 13:41453167-41453189 CCTAATATCCGGAGGGGGAGAGG - Intergenic
1107548260 13:41454054-41454076 CCTAATATCCAAAGGTGGAGAGG + Intergenic
1107548466 13:41455169-41455191 CCTAATATCCAGGGGAAGAGAGG - Intergenic
1107548495 13:41455323-41455345 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1107548518 13:41455473-41455495 CCTACTATCCAGAGGGAGAGAGG - Intergenic
1107631952 13:42351423-42351445 CCCCCTATGCAGAGGGAGAAGGG - Intergenic
1108052937 13:46463854-46463876 CGTAATATCCAGAGGGTTAGAGG - Intergenic
1108052974 13:46464011-46464033 CGTCATATCCACAGGGCGAGAGG - Intergenic
1108053104 13:46464378-46464400 CCTCAGAGCCAGGGGGGGAGAGG - Intergenic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108817962 13:54314225-54314247 CCTAATATTCAGAGGCGGAGAGG - Intergenic
1108817991 13:54314399-54314421 CCTAGTATCCTGAGGGGGAGAGG - Intergenic
1108818086 13:54315383-54315405 CCTAATATCCAGGGGGCGAGAGG + Intergenic
1108818097 13:54315458-54315480 CCTAATATCCAGGGACAGAGAGG + Intergenic
1109354145 13:61218572-61218594 CCTAATATCCACAGTCAGAGAGG + Intergenic
1109354156 13:61218648-61218670 CCTAATATCCACAGAGGGAGAGG + Intergenic
1109354341 13:61219858-61219880 CCTAATATCCAGGGGAGGAGGGG + Intergenic
1109354880 13:61223468-61223490 CCTAATATCTAGCGGGGGAGAGG + Intergenic
1109354975 13:61224099-61224121 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1109355351 13:61226513-61226535 CCTAATATCCAGGGGGGCAGAGG - Intergenic
1109355575 13:61228021-61228043 CCTAATATCCAGGGGGCGAAAGG - Intergenic
1109355590 13:61228097-61228119 CCTAATCTCCAGAGGGGGAGAGG - Intergenic
1109355602 13:61228173-61228195 CCTAATATCCAGACAGGGAGAGG - Intergenic
1109355615 13:61228249-61228271 CCTCATATCCAGGTTGGGAGAGG - Intergenic
1109355961 13:61230206-61230228 CCTAATATCCAGAAGGAGAGAGG - Intergenic
1109356099 13:61231095-61231117 CTTAATATCCAGGGAGAGAGAGG - Intergenic
1109409677 13:61945836-61945858 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1109409712 13:61946062-61946084 CCTAATATCGAGAAGGGGAGAGG + Intergenic
1109840753 13:67914567-67914589 CGTAATATCCAGGGGGCGAGAGG - Intergenic
1109840828 13:67914801-67914823 CGTCATATCCAGGGGGCGAGAGG - Intergenic
1109840847 13:67914880-67914902 CTTCATATCCAGGGGGGAAGAGG - Intergenic
1109840871 13:67914959-67914981 CCTAAAAACCAGAGGGGGAGAGG - Intergenic
1109840942 13:67915403-67915425 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1109840967 13:67915581-67915603 CCTAGTATCCCGAGGGGGAGAGG - Intergenic
1109983215 13:69938548-69938570 CTCCATATCCAGAGGGATAATGG - Intronic
1110672669 13:78199899-78199921 GCTCATACCCAGGGGAAGAGAGG + Intergenic
1110718316 13:78732846-78732868 CCTGAATTCCAGAGGGAGAAGGG - Intergenic
1111802410 13:92996820-92996842 CTTCATGACAAGAGGGAGAGAGG + Intergenic
1111809996 13:93088359-93088381 TCTAATATCCAGCGGGAAAGAGG + Intergenic
1111810127 13:93089193-93089215 CCTAATATCCGGAGGTGGAGAGG + Intergenic
1111810333 13:93090697-93090719 CCTAATATCCAGGGTGGGAGAGG - Intergenic
1111810502 13:93092047-93092069 CCTCATATTCAAAGGTGGAGAGG + Intergenic
1111810517 13:93092123-93092145 TCTAATATCCAGGGGGCGAGAGG + Intergenic
1111810634 13:93092797-93092819 CCTTATATCGAGAGGGAGATAGG + Intergenic
1111810682 13:93093034-93093056 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1111811021 13:93095125-93095147 TCTAATATCCAGCGGGAAAGAGG + Intergenic
1111811037 13:93095201-93095223 CCTAATATCCAGTGGGGAAGAGG + Intergenic
1111811156 13:93096020-93096042 CCTAATATCCGGAGGTGGAGAGG + Intergenic
1113939369 13:114010549-114010571 GTTCATATCCACAGGGAGAGAGG + Intronic
1114435836 14:22707349-22707371 CCTAATATCCATCGGGGGAGAGG - Intergenic
1114435862 14:22707499-22707521 CGTAATATCCAGGGGAAGAGAGG - Intergenic
1114435915 14:22707798-22707820 CCTAATTTCCAGGGGGCGAGAGG - Intergenic
1114435981 14:22708248-22708270 CATAATATCCAGGGGGGGAGAGG - Intergenic
1114436328 14:22710439-22710461 CATAATATCCAGGGGGAAAGAGG - Intergenic
1114436358 14:22710661-22710683 CATAATATTCAGAGGGGGAGAGG - Intergenic
1114436536 14:22711670-22711692 CCGAATATCCAAAGGGGGAGAGG + Intergenic
1114436576 14:22711974-22711996 CCTAATATCCAAAGTGAGAGAGG + Intergenic
1114436641 14:22712395-22712417 TCTCATATCTAGAGAGGGAGAGG + Intergenic
1114436815 14:22713626-22713648 CCTAATATCCAGGGCGGGAGAGG + Intergenic
1114436846 14:22713781-22713803 CCTAATATCCAGGAGGGGAGAGG + Intergenic
1114437020 14:22714854-22714876 CCTAATATCCAGAGCGAGAGAGG + Intergenic
1116516859 14:45815117-45815139 CCTAATATCCAGGGGGTGAGAGG + Intergenic
1116516904 14:45815421-45815443 CCTAATATTCAGAGGGAGATAGG + Intergenic
1116517043 14:45816311-45816333 TTTAATATCCAGAGGGGGAGAGG + Intergenic
1116517142 14:45816913-45816935 CCTAATATCCATGGGGGGAGAGG + Intergenic
1116517301 14:45817762-45817784 CCTAATATCCAGGGCGGGAGAGG + Intergenic
1116517345 14:45817982-45818004 CCCAATATCCATAGGGGGAGAGG + Intergenic
1116517425 14:45818534-45818556 CCTAATATCCAGAGGGAGAGAGG - Intergenic
1116517641 14:45819836-45819858 CCTTATATCCAGGGTGAAAGAGG - Intergenic
1116517686 14:45820138-45820160 CCTAATATCCAGAAAGAGAGAGG - Intergenic
1116517821 14:45821074-45821096 CCTAATATCCAGAGGGTAAGAGG + Intergenic
1116517906 14:45821765-45821787 CCTAATATACAGTGGAAGAGAGG + Intergenic
1116518188 14:45823583-45823605 CGTAATATCCAAAGGGGGAGAGG + Intergenic
1116518237 14:45823894-45823916 CGTAATATCCAAAGGGGGAGAGG + Intergenic
1116518327 14:45824422-45824444 CCTAATATTCAAAGGGGGAGAGG + Intergenic
1116518413 14:45824950-45824972 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1116518512 14:45825550-45825572 CCTAATATCCAGGTGAAGAGAGG + Intergenic
1116518670 14:45826619-45826641 CCTAATATCCAGGGGGAAAGAGG + Intergenic
1116518712 14:45826865-45826887 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1116518863 14:45827790-45827812 TCTAATATCCAGTGGAAGAGAGG + Intergenic
1116518953 14:45828370-45828392 TATAATATCCAGAGGGGGAGAGG + Intergenic
1116519172 14:45829841-45829863 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1116519263 14:45830524-45830546 TCTAATATCCAGTGGGGGAGAGG + Intergenic
1116519297 14:45830752-45830774 CCTAATATCCAGTGGGAGAGAGG + Intergenic
1116519384 14:45831221-45831243 CGTAATATCCAGGGGGCGAGGGG - Intergenic
1116519437 14:45831682-45831704 CCTAATATCCAGAGGGAGATAGG - Intergenic
1116519684 14:45833176-45833198 CCTAATATCCAGTGGGGGAGAGG - Intergenic
1116519710 14:45833328-45833350 CCTAATATCCACAGGGGAAGAGG - Intergenic
1116519840 14:45834327-45834349 CCTAATATCCAGAAAGAGAGAGG - Intergenic
1117037102 14:51741030-51741052 CCTCATATCCAGGGAAAGAGAGG - Intergenic
1117037138 14:51741223-51741245 CCTTATATCGAGAAGGGGAGAGG - Intergenic
1117037176 14:51741445-51741467 CCTCATATCTAGGTGGAGAGAGG - Intergenic
1117037414 14:51743276-51743298 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1117037585 14:51744033-51744055 CGTAATATCCAGTGGGGGAGAGG + Intergenic
1117037654 14:51744575-51744597 CTTCATATCCCGGGGGGGAGTGG - Intergenic
1117037827 14:51745310-51745332 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1117037857 14:51745511-51745533 CCTAGTATCCCGAGGGGGAGAGG - Intergenic
1117037971 14:51746571-51746593 CCTAATATCCAGAGACGGAGAGG + Intergenic
1117038207 14:51747927-51747949 CCTAATATCCGGAGGGGGAGAGG - Intergenic
1117039042 14:51753268-51753290 CCTAATATCCAGGGGGGAAGAGG - Intergenic
1117039079 14:51753494-51753516 CCTAATGTCCAGGGGAAGAGAGG - Intergenic
1117039112 14:51753648-51753670 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1117039123 14:51753723-51753745 CCTAATATCCACAGGGAGAGAGG - Intergenic
1117039137 14:51753798-51753820 TCCTATATTCAGAGGGAGAGAGG - Intergenic
1117039277 14:51754571-51754593 TCTAATATCCAGCGGGGGAGAGG - Intergenic
1117039945 14:51760277-51760299 CGTCATATCCAGGGTGGGAGTGG + Intergenic
1117041466 14:51772664-51772686 CCTAATATCCAGAGACGGAGAGG - Intergenic
1117041582 14:51773720-51773742 CCTAGTATCCCGAGGGAGAGAGG + Intergenic
1120829963 14:88989257-88989279 CTTGATATCCAGAGAGAGAAGGG + Intergenic
1122268848 14:100559285-100559307 CATCTTCTCCAGAGGGAGAGAGG - Intronic
1123114645 14:105889192-105889214 CCTCATCTTTAGAGGGAGTGCGG + Intergenic
1123162648 14:106294087-106294109 CCTGAAATCCACAGGCAGAGGGG - Intergenic
1202900487 14_GL000194v1_random:33777-33799 CCTAATATCCAGGGGGGTAGAGG - Intergenic
1125488207 15:40127004-40127026 TCTAATATCCAGGGGAAGAGAGG + Intergenic
1125488564 15:40129348-40129370 CCTAATATCCGGAGGGCGAGAGG - Intergenic
1125488683 15:40130039-40130061 CCCAATATCCGGAGGGGGAGAGG - Intergenic
1125489003 15:40132719-40132741 CCTAATATCCAGCGGGAAACAGG + Intergenic
1125489028 15:40132864-40132886 CCTGATATCCAAGGGGTGAGTGG + Intergenic
1126097431 15:45099530-45099552 CCTCCGATCCTGAGGGAGAGAGG + Intronic
1128740290 15:70079039-70079061 CCTCATAACCAGAGTGAGCTGGG - Intronic
1128777178 15:70329416-70329438 CCTCATGTCCAAGGGGAGGGAGG - Intergenic
1128945109 15:71814499-71814521 CATCATTTGCAAAGGGAGAGAGG + Intronic
1129662282 15:77559807-77559829 CATAATATCCAGAAGGAGAGAGG + Intergenic
1129662341 15:77560181-77560203 CTTAATATCCAGCGGGGGAGAGG + Intergenic
1129662370 15:77560332-77560354 CGTAATATCCAGTGGGGGAGAGG + Intergenic
1130188594 15:81710869-81710891 CCTAATATCCAGGGGGTGAGAGG + Intergenic
1130188714 15:81711625-81711647 CCTAATATCGAGAGGGGGAGAGG + Intergenic
1130188739 15:81711776-81711798 CCTTATATCCAAAGGTAGAGAGG + Intergenic
1130188957 15:81713117-81713139 CCTAATATCCGGAGGGGGAGAGG + Intergenic
1133990924 16:10707150-10707172 CATAATATCCAGGGGGTGAGTGG - Intergenic
1133991317 16:10709727-10709749 TCTAATATCCAGAGGGGAAGAGG - Intergenic
1133991360 16:10710024-10710046 TGTAATATCCAGGGGGAGAGAGG - Intergenic
1133991484 16:10710815-10710837 CTTAATATCCAGAGGGGGAGAGG - Intergenic
1133992074 16:10716473-10716495 CATAATATCCAGGGGGTGAGTGG - Intergenic
1133992185 16:10717263-10717285 TTTAATATCCAGAGGGGGAGGGG - Intergenic
1133992256 16:10717633-10717655 CGTAATATCCAGGGGAAGAGAGG - Intergenic
1135697910 16:24606452-24606474 CCTAACATTTAGAGGGAGAGAGG - Intergenic
1135941417 16:26825373-26825395 TCTCTTTTCCAGAGGGAGAGAGG - Intergenic
1136654788 16:31703353-31703375 CATCATACCCACAGGGAGAAGGG - Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139948443 16:70657374-70657396 CCCAGGATCCAGAGGGAGAGAGG - Intronic
1140895545 16:79321410-79321432 CATTTTATCCAGAGGAAGAGAGG + Intergenic
1140905737 16:79407474-79407496 ACACACATGCAGAGGGAGAGAGG - Intergenic
1140931541 16:79632816-79632838 CCTCAGATTCGGAGGAAGAGGGG - Intergenic
1141472605 16:84249717-84249739 CCTCATTTCCAGACACAGAGGGG - Intergenic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1142137067 16:88456294-88456316 TGTCACCTCCAGAGGGAGAGAGG + Intronic
1143292470 17:5842205-5842227 CTTCATATCCAGCAGGGGAGAGG - Intronic
1143292547 17:5842726-5842748 CCTGATATCTGGAGGGGGAGAGG - Intronic
1144779607 17:17801206-17801228 CCTCCTATCCAGATGGAGCCTGG + Intronic
1145052198 17:19671364-19671386 CCTCATTTCCAGAGAGGGAAAGG - Intronic
1146480858 17:33203792-33203814 CCACATACTCAGAGAGAGAGTGG - Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1154356794 18:13627746-13627768 GCTTATAGCCAGAGGGACAGAGG + Intronic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155542688 18:26884487-26884509 CCTAATATCCGGAGGGGGAGAGG - Intergenic
1155542913 18:26886000-26886022 CCTAATATCTAGGGGGAGTGAGG - Intergenic
1155543111 18:26887176-26887198 CCTAATATCGAGAGAGGGAGAGG - Intergenic
1155543240 18:26887940-26887962 CCTAATATCCAGGGGGCAAGAGG - Intergenic
1156191721 18:34727936-34727958 CCTAATATTAAGAGGGAGGGGGG + Intronic
1156885163 18:42126880-42126902 CTTCATAAACAGTGGGAGAGTGG + Intergenic
1157574173 18:48732647-48732669 CCTCATGTCCAGAAGGAGCTGGG - Intronic
1159108866 18:64032985-64033007 CATCAGATCCAGAGGGAGCAAGG - Intergenic
1159752694 18:72322586-72322608 TCTAATATCCAGAAGGAAAGTGG + Intergenic
1163059964 19:14753440-14753462 CATCATATCCTGCGGGAGAAAGG - Intronic
1163330369 19:16632860-16632882 GCTCATATCCACAGGGTCAGAGG - Intronic
1163365172 19:16871949-16871971 CCACTTATCCTGAGGGAGGGTGG + Intronic
1164541165 19:29122501-29122523 CTTCTTCTCCAGAAGGAGAGGGG - Intergenic
1166236406 19:41460249-41460271 CCTAATATCCAGAAGGGGAGAGG - Intergenic
1166236668 19:41461905-41461927 CCTAATATCCAGGGGGGGAGAGG - Intergenic
1166236701 19:41462065-41462087 CCTAATATCCAGGGGAGGAGAGG - Intergenic
1166237040 19:41464246-41464268 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1166237073 19:41464396-41464418 CTTAATATCCAGAAGGAAAGAGG - Intergenic
1166237360 19:41466259-41466281 TCTAATATACAGAGGGGGAGAGG - Intergenic
1166237636 19:41468076-41468098 CCTAATATCCAGCGGTGGAGAGG - Intergenic
1166237720 19:41468686-41468708 CCTAATATCAAGGGGGAGAGAGG - Intergenic
1166237753 19:41468839-41468861 CCTAATATCCAGGGCGGGAGAGG - Intergenic
1166237791 19:41469065-41469087 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1166237829 19:41469290-41469312 TTTAATATCCAGATGGAGAGAGG - Intergenic
1166237883 19:41469680-41469702 CCTAATATCCAGGGAGGGAGAGG - Intergenic
1166238076 19:41470887-41470909 CCTAATATCCAGGGTGTGAGAGG - Intergenic
1166238256 19:41472171-41472193 CGTAATATCCAGAGGTAGAGAGG - Intergenic
1166238583 19:41474083-41474105 CCTAATATCCAGTGGGGGAGAGG - Intergenic
1166238741 19:41475103-41475125 CCTAATATCCAGGGTGGGAGAGG - Intergenic
1166242235 19:41502278-41502300 CCTAATATCCAGTGGGGAAGAGG - Intergenic
1166242399 19:41503347-41503369 CATAATATCCAGAGGGGGAGGGG - Intergenic
1166242575 19:41504316-41504338 CATAATATCCAGAAGAAGAGAGG - Intergenic
1166242688 19:41504976-41504998 CGTAATATCCAGACGGGGAGAGG - Intergenic
1166243955 19:41512622-41512644 CCTAATATCCAGAAGGAAAGAGG - Intergenic
1166244017 19:41513083-41513105 CCTAATATCCAGGGGGGGAGGGG - Intergenic
1166244034 19:41513159-41513181 CCTAATATCCAGGAAGAGAGAGG - Intergenic
1166244074 19:41513506-41513528 CCTAATATCCAGAGTAAGAGAGG - Intergenic
1166244291 19:41514891-41514913 CCGAATATCCAGAGGGGGAAAGG - Intergenic
1166244681 19:41517059-41517081 CCTAATATCCAGGGGGAAAGAGG - Intergenic
1166244715 19:41517209-41517231 CCTAATATCCAGAAGGAAAGAGG - Intergenic
1166244768 19:41517584-41517606 CATAATATATAGAGGGAGAGAGG - Intergenic
1166245157 19:41519902-41519924 CCTAATATCCAGGGGTAAAGAGG - Intergenic
1166245525 19:41522911-41522933 CCTAATATTTAGAGGGACAGAGG - Intergenic
1166245753 19:41524423-41524445 CCTAATATCCAGCGGTGGAGAGG - Intergenic
1166245838 19:41525033-41525055 CCTAATATCAAGGGGGAGAGAGG - Intergenic
1166245869 19:41525186-41525208 CCTAATATCCAGGGCGGGAGAGG - Intergenic
1166245900 19:41525409-41525431 CCTAATATCAGGAGGGGGAGAGG - Intergenic
1166245920 19:41525511-41525533 CCTAATATCCAGTGGAAGAGAGG - Intergenic
1202643975 1_KI270706v1_random:124015-124037 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1202644688 1_KI270706v1_random:129488-129510 CCTAATATCCTGGGGAAGAGAGG + Intergenic
1202644937 1_KI270706v1_random:131086-131108 CCTAATATCCATAGGGGTAGAGG + Intergenic
925916297 2:8609019-8609041 CCTTATAAAAAGAGGGAGAGAGG - Intergenic
927477925 2:23428284-23428306 CCTCACATGCAGGGGGACAGCGG - Intronic
927924973 2:27005703-27005725 CATGACATCCAAAGGGAGAGTGG + Intronic
929027009 2:37614577-37614599 CCTCCTCTCCAGAGGAGGAGTGG + Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930283577 2:49400682-49400704 CCTCACATACAGATGGAGATAGG + Intergenic
932350199 2:71025185-71025207 CCTAATATCCAGGGGGGAAGAGG - Intergenic
932350236 2:71025410-71025432 CCTAATGTCCAGGGGAAGAGAGG - Intergenic
932350268 2:71025564-71025586 CCTAATATCCAGAGCGAAAGAGG - Intergenic
932350279 2:71025639-71025661 CCTAACATCCACAGGGAGAGAGG - Intergenic
932350293 2:71025714-71025736 CCTAACATCCAGAGGGAGAGAGG - Intergenic
932352370 2:71043112-71043134 CCTAATATCCAGGCGGCGAGAGG + Intergenic
932352534 2:71043805-71043827 CGTCATATCGGGGGGGAGAGGGG - Intergenic
932352692 2:71044707-71044729 CCTAATATCCGGAGGGGGAGAGG - Intergenic
932352829 2:71045900-71045922 CCTACTATCCAGAGGGAGGGAGG - Intergenic
932353687 2:71051318-71051340 CCTAATATCCAGGGGGGAAGAGG - Intergenic
932353724 2:71051542-71051564 CCTAATATCCAGGGGAAGAGAGG - Intergenic
932353767 2:71051771-71051793 CCTAATATCCACAGGGAGAGAGG - Intergenic
932353780 2:71051845-71051867 CCTTATATCCAGAGGGAGAGGGG - Intergenic
932752555 2:74380509-74380531 CCTTACATCCTGGGGGAGAGGGG - Intronic
933456482 2:82525877-82525899 CCTCATATCCAGAGGGTGAGTGG - Intergenic
933456512 2:82526035-82526057 CCTAATATCCAGTGGGAAAGAGG - Intergenic
933456570 2:82526416-82526438 CCTAATAACCAGGGGAAGAGAGG - Intergenic
933456606 2:82526600-82526622 CCTTGTATCGAGAGGGGGAGAGG - Intergenic
933456753 2:82527440-82527462 CCTAATATCCAGGGGGCGAGAGG - Intergenic
933456869 2:82528772-82528794 CCTAGTATCCGGAGGGGGAGAGG + Intergenic
933456929 2:82529151-82529173 CCTAATATGCAAGGGGAGAGAGG + Intergenic
933457104 2:82530201-82530223 CCTAATATCCGGAGGGGGAGAGG + Intergenic
934143673 2:89072156-89072178 CATAATATCCAGGGAGAGAGAGG + Intergenic
934143782 2:89072844-89072866 CCTAATATCCAGTGGGGGAAAGG + Intergenic
934143836 2:89073151-89073173 CGTAATATTCAGAGGGGGAGAGG + Intergenic
934143926 2:89073601-89073623 CCTAATATCCAGGGGAGGAGGGG + Intergenic
934225314 2:90126957-90126979 CCTAATATCCAGGGGAGGAGGGG - Intergenic
934225406 2:90127407-90127429 CGTAATATTCAGAGGGGGAGAGG - Intergenic
934225565 2:90128399-90128421 CATAATATCCAGGGAGAGAGAGG - Intergenic
934506335 2:94897551-94897573 CCTAATATCCAGGTGGGGAGAGG + Intergenic
934507168 2:94903704-94903726 CCTAATATCAAGTGGGGGAGAGG + Intergenic
934507262 2:94904223-94904245 CCTAATATCCATGGGGGGAGTGG + Intergenic
934507334 2:94904672-94904694 CCTAATATCCCGGGGAAGAGTGG + Intergenic
934591040 2:95550463-95550485 CCTAATATCCAGGGGGAAAGAGG - Intergenic
934591062 2:95550611-95550633 CCTAATATCCAAGGGGGGAGAGG - Intergenic
935331143 2:101978920-101978942 CCTCCTCTTCAGAGGGAAAGGGG - Intergenic
936557372 2:113508374-113508396 CGTAATATCCAGCGGGGGAGAGG + Intergenic
936557667 2:113510220-113510242 CCTAATAGCCAGCGGGGGAGGGG - Intergenic
936557697 2:113510371-113510393 CCTAATATCCAGGGGGCGAGAGG - Intergenic
936557802 2:113511368-113511390 CCTGGTATCCCGAGGGGGAGAGG + Intergenic
936557829 2:113511546-113511568 CCTAATATTCAGAGGCCGAGAGG + Intergenic
937092630 2:119216612-119216634 CCTGGTAGCCATAGGGAGAGTGG - Intergenic
937749170 2:125453831-125453853 CCTTATATTCTAAGGGAGAGAGG - Intergenic
938595695 2:132785120-132785142 CCTCAGGTACAGAGGGAGAGGGG - Exonic
940205230 2:151195178-151195200 CCACCTATACAGAGGGAGTGAGG - Intergenic
940869753 2:158849958-158849980 CCTAATATCCAGGGGGGAAGAGG - Intronic
940869790 2:158850183-158850205 CCTAATGTCCAGGGGAAGAGAGG - Intronic
940869829 2:158850412-158850434 CCTAATATCTACAAGGAGAGAGG - Intronic
940869884 2:158850711-158850733 CCCCATATCCAGGTGGGGAGAGG - Intronic
940871640 2:158865521-158865543 CCTAATATCCAGAGGGGGAGAGG - Intergenic
940872439 2:158870957-158870979 CCTAATATCCAGGGGGGAAGAGG - Intergenic
940872475 2:158871182-158871204 CCTAATGTCCAGGGGAAGAGAGG - Intergenic
940872504 2:158871336-158871358 CCTAATATCCAGAGCGAAAGAGG - Intergenic
940872514 2:158871411-158871433 CCTAATATCCACAGGGAGAGAGG - Intergenic
940872528 2:158871486-158871508 CCTAATATCCAGAGGGAGAGAGG - Intergenic
940872574 2:158871712-158871734 CCCCATATCCAGGTGGGGAGAGG - Intergenic
940872666 2:158872248-158872270 TCTAATATCCAGCGGGGGAGAGG - Intergenic
940873318 2:158878242-158878264 CATAATATCCAGGGGGGGAGGGG - Intergenic
940873438 2:158879059-158879081 CCTAATATCCGGAGGGGGAGAGG - Intergenic
940873723 2:158881052-158881074 CCTAATATCCAGAGCGAAAGAGG - Intergenic
940873734 2:158881127-158881149 CCTAATATCCACAGGGAGAGAGG - Intergenic
940873750 2:158881202-158881224 CCTACTATCCAGAGGGAGAGAGG - Intergenic
940874672 2:158887166-158887188 CCTAATATCCAGGGGAAGAGAGG - Intergenic
940874701 2:158887320-158887342 CCTAATATCCAGAGCGAAAGAGG - Intergenic
940874711 2:158887395-158887417 CCTAATATCCACAGGGAGAGAGG - Intergenic
940874726 2:158887470-158887492 CCTAATACCCAGAGGGAGAGAGG - Intergenic
940874770 2:158887694-158887716 CCCCATATCCAGGTGGGGAGAGG - Intergenic
940891828 2:159042717-159042739 ACTAATTTCCAGAGAGAGAGGGG + Intronic
941067769 2:160922361-160922383 CCTCATTTTCAGTGGGAGAGGGG + Intergenic
941533173 2:166693820-166693842 CCTAATATCCAGAGGGAGAGAGG - Intergenic
941533748 2:166697683-166697705 CCTAATATCCATGGGGGGAGAGG + Intergenic
941533775 2:166697834-166697856 CCTAATGTCCAGCGGGGGAGTGG + Intergenic
941533838 2:166698209-166698231 CCTCATATTCAGGGGACGAGAGG + Intergenic
942066643 2:172277710-172277732 TGGCATATCCAGAGGGAGATGGG + Intergenic
942316988 2:174706011-174706033 CCTAATATCCTGGGGGGGAGAGG - Intergenic
942317007 2:174706130-174706152 CCTAATATACAGGGGGAAAGAGG - Intergenic
942317110 2:174706741-174706763 CCTAATATCCAGCAGGGGAGAGG - Intergenic
942317253 2:174707643-174707665 CATAATATCCAGAGGGAAAGAGG - Intergenic
942317685 2:174710131-174710153 CCTAATATCCAGAGGGGAAGAGG - Intergenic
942317712 2:174710283-174710305 CCTAATATCCAAGGGGAGAGAGG - Intergenic
942317739 2:174710434-174710456 CCTAATATCCAGGGGGTGAGAGG - Intergenic
942812834 2:180018349-180018371 CGTAATATCCAGATGGGGAGAGG - Intergenic
942813261 2:180021924-180021946 CGTAATATCCAGGGTGAGAGAGG - Intergenic
942813301 2:180022061-180022083 CGTAATATCCAGTGGGGGAGAGG + Intergenic
943842333 2:192598891-192598913 CGTAATAACCAGAGGGGGAGAGG - Intergenic
943842409 2:192599335-192599357 CCTAATATTCAGAGGCCGAGAGG - Intergenic
943842540 2:192600492-192600514 CCTAATATCCAGGGGGCAAGAGG + Intergenic
943842637 2:192601092-192601114 CCTAATATCTAGGTGGAGAGAGG + Intergenic
943842713 2:192601504-192601526 CCTCATATCCAGGGGATGAGAGG + Intergenic
945729322 2:213513872-213513894 TGTTATATCCAGTGGGAGAGAGG + Intronic
946623808 2:221589752-221589774 CCTAGTGTCCAGATGGAGAGAGG + Intergenic
946849358 2:223890045-223890067 CCTCATATACAGAGGCTGTGTGG - Intronic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
948654683 2:239469307-239469329 CCTCCTATCCGGAGGATGAGAGG - Intergenic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG + Intronic
1170871565 20:20211142-20211164 CATCAAATCCAGAGGGAAAATGG + Intronic
1171051446 20:21862817-21862839 CCTCAAGCCCAGAGGGGGAGGGG + Intergenic
1171096805 20:22340094-22340116 CCGCAAATCTGGAGGGAGAGGGG + Intergenic
1171893935 20:30742957-30742979 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1171893986 20:30743279-30743301 TGTAATATCCAGAGGGGGAGAGG - Intergenic
1171894634 20:30748406-30748428 CCTAATATCCCGGGGAAGAGAGG + Intergenic
1171894898 20:30750007-30750029 CCTAATATCCATAGGCGGAGAGG + Intergenic
1175175567 20:57109800-57109822 CCCCGTATCAAGAAGGAGAGAGG + Intergenic
1176606942 21:8841581-8841603 CCTAATATCCATAGGGGGAGAGG - Intergenic
1176619861 21:9048555-9048577 CCTAATATCCAGGGGGGTAGAGG - Intergenic
1177347301 21:19890432-19890454 CCCCATATCTTGAGGGAGAGAGG + Intergenic
1179001103 21:37458918-37458940 CCTCATCTCCTGACTGAGAGTGG + Intronic
1179173328 21:38989910-38989932 CCTCTTATCCAGTTTGAGAGAGG + Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179671597 21:42953406-42953428 TCTAATATCCAGTGGGGGAGAGG + Intergenic
1179671691 21:42953935-42953957 CCTAATATCCCAATGGAGAGAGG + Intergenic
1179671758 21:42954316-42954338 CCTAATATCCAGAGCCAAAGAGG + Intergenic
1179671788 21:42954470-42954492 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1179671804 21:42954546-42954568 CCTAATATCCAACGGGGGAGAGG + Intergenic
1179671829 21:42954695-42954717 CCTCATATCCAGGGGGGAAGAGG + Intergenic
1180357023 22:11851357-11851379 CCTAATATCCATAGGGGGAGAGG - Intergenic
1180357995 22:11858422-11858444 CCTAATATCCAGGTGGGGAGAGG - Intergenic
1180380273 22:12133911-12133933 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1180381239 22:12140974-12140996 CCTAATATCCATAGGGGGAGAGG + Intergenic
1180595351 22:16969574-16969596 ACTGAGACCCAGAGGGAGAGGGG - Intronic
1180637507 22:17272666-17272688 GCTCATTCCCAGAGGGAGGGAGG - Intergenic
1181437933 22:22921198-22921220 CTTCACCCCCAGAGGGAGAGGGG - Intergenic
1182768711 22:32777649-32777671 CCTCAGATTTACAGGGAGAGAGG + Intronic
1182773175 22:32810626-32810648 CCTCATGGGCAGAGGCAGAGGGG - Intronic
1183115798 22:35691712-35691734 CCTAATAGCCAGCGGGGGAGAGG - Intergenic
1183115826 22:35691863-35691885 CCTAATATCCAGGGGGTGAGAGG - Intergenic
1183116005 22:35693293-35693315 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1183116181 22:35694333-35694355 CCTAGTATCCGGAGGGGGAGAGG + Intergenic
1183116513 22:35696702-35696724 CCTAGTATCCCGAGGGGGAGAGG + Intergenic
1183116755 22:35698150-35698172 CCTAATAGCCAGCGGGGGAGAGG - Intergenic
1183116773 22:35698226-35698248 CCTAATATCCAGGGACAGAGAGG - Intergenic
1183116782 22:35698301-35698323 CCTAATATCCAGGGGGCAAGAGG - Intergenic
1183116951 22:35699667-35699689 CCTAATATGCAGGGGGAGAGAGG + Intergenic
1183117071 22:35700367-35700389 CCTAGTATCCGGAGGGGGAGAGG + Intergenic
1183117339 22:35702127-35702149 CCTGATATCCAGGGGGTGAGTGG - Intergenic
1183117370 22:35702285-35702307 CCTAATATCCAGCGGGAAAGAGG - Intergenic
1183117426 22:35702667-35702689 CCTCATATCCAGGGGAAGAGAGG - Intergenic
1183427269 22:37746514-37746536 CCTCATTTCCCGAAGGCGAGAGG + Intronic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
1185280959 22:49969680-49969702 CCTCATATCCCATGGGGGAGCGG + Intergenic
949882484 3:8672703-8672725 CCTAATATCCGGAGGGGGAGAGG - Intronic
949883066 3:8676564-8676586 CCTAATATTCAGAGGCCGAGAGG - Intronic
949884853 3:8684750-8684772 CCTAATGTCCAGGGGAAGAGAGG - Intronic
949884883 3:8684904-8684926 CCTAATATCCAGAGCGAAAGAGG - Intronic
949884894 3:8684979-8685001 CCTAATATCCACAGGGAGAGAGG - Intronic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
957043919 3:75359845-75359867 TCTAATATCCAGCGGGGGAGAGG + Intergenic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
957044068 3:75360690-75360712 CCTAATATCCACAGGGAGAGAGG + Intergenic
957044077 3:75360765-75360787 CCTAATATCCAGAGTGAAAGAGG + Intergenic
957044143 3:75361144-75361166 CCTAATATCCAGATGGGAAGAGG + Intergenic
957075847 3:75602796-75602818 TCCTATATTCAGAGGGAGAGAGG + Intergenic
957075861 3:75602871-75602893 CCTAATATCCACAGGGAGAGAGG + Intergenic
957075870 3:75602946-75602968 CCTAATATCCAGAGCGAAAGAGG + Intergenic
957075899 3:75603100-75603122 CCTAATGTCCAGGGGAAGAGAGG + Intergenic
957075937 3:75603325-75603347 CCTAATATCCAGGGGGGAAGAGG + Intergenic
957076757 3:75608762-75608784 CCTAATATCCGGAGGGGGAGAGG + Intergenic
957076899 3:75609662-75609684 CATCATATCCAGGGGGGGAGAGG + Intergenic
957077194 3:75611522-75611544 CCTAATATTCAGAGGCTGAGAGG + Intergenic
957077404 3:75612593-75612615 CCTCAAATCCAGGGGGTGTGAGG - Intergenic
957077534 3:75613741-75613763 CCTAATATTCAGAGGCCGAGAGG + Intergenic
958841932 3:99216186-99216208 GCTCATATACAGGGGCAGAGGGG + Intergenic
959982197 3:112528848-112528870 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982214 3:112528946-112528968 CCTAATATCCAGGAGGAGAGAGG + Intergenic
959982225 3:112529022-112529044 CCTAATATCCAGGCGGAGAGAGG + Intergenic
959982253 3:112529169-112529191 CCTAATATCCAGAGGGCGACAGG + Intergenic
959982267 3:112529240-112529262 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982281 3:112529315-112529337 CCTAATATCCAGAGGGAGAGAGG + Intergenic
959982329 3:112529620-112529642 CCTAATATCCAAGGGGGGAGAGG + Intergenic
959982354 3:112529769-112529791 CCTAATATCCAGGGGGGAAGAGG + Intergenic
961271409 3:125692450-125692472 CATAATATCCAGGGGGGGAGAGG - Intergenic
961271433 3:125692527-125692549 CGTAATATCCAGGGGGGGAGAGG - Intergenic
961271586 3:125693425-125693447 CCTAATATCCGGACGGGGAGAGG - Intergenic
961272496 3:125699619-125699641 CCTCATATCCAGGGTGGAAGAGG - Intergenic
961272530 3:125699844-125699866 CCTAATGTCCAGGGGAAGAGAGG - Intergenic
961272560 3:125699999-125700021 CCTAATATCCAGAGCGAAAGAGG - Intergenic
961272572 3:125700074-125700096 CCTAATATACCCAGGGAGAGAGG - Intergenic
961272627 3:125700373-125700395 CCCAATATCCAGGTGGAGAGAGG - Intergenic
961275359 3:125721857-125721879 CCTAATATCCAGGGGGGAAGAGG - Intergenic
961275395 3:125722083-125722105 CCTAATGTCCAGGGGAAGAGAGG - Intergenic
961275422 3:125722237-125722259 CCTAATATCCAGAGCGAAAGAGG - Intergenic
961275445 3:125722387-125722409 TCCTATTTCCAGAGGGAGAGAGG - Intergenic
961275574 3:125723155-125723177 TCTAATATCCAGCGGGGGAGAGG - Intergenic
961278304 3:125744704-125744726 CCTAATGTCCAGGGGAAGAGAGG - Intergenic
961278332 3:125744858-125744880 CCTAATATCCAGAGCGAAAGAGG - Intergenic
961278339 3:125744933-125744955 CCTAATATCCACAGGGAGAGAGG - Intergenic
961278353 3:125745008-125745030 CCTTATATCCAGAGGGAGAGAGG - Intergenic
961278486 3:125745776-125745798 CCTAATATCCAGCGGGGGAGAGG - Intergenic
961481679 3:127184498-127184520 CCTCAGATCCACAGGTGGAGGGG + Intergenic
961875911 3:130023879-130023901 TCTAATATCCAGCGGGGGAGAGG + Intergenic
961876055 3:130024723-130024745 CCTAATATCCACAGGGAGAGAGG + Intergenic
961876066 3:130024798-130024820 CCTAATATCCAGAGTGAAAGAGG + Intergenic
961876134 3:130025178-130025200 CCTAATATCCAGGGGGGAAGAGG + Intergenic
963122886 3:141791178-141791200 CCTCACATTCAGAGGGATAATGG + Intronic
964888669 3:161514083-161514105 TCTAATATCCAGTGGGGGAGAGG - Intergenic
964888846 3:161515213-161515235 TCTAATATGCAGAGGGGGAGAGG - Intergenic
964888899 3:161515515-161515537 CCTAATATTCAGGGGAAGAGAGG - Intergenic
964888954 3:161515891-161515913 CCTAATATCCAGAGGGGGAGAGG - Intergenic
964889071 3:161516594-161516616 TCTGATATCCAGAGGGGAAGAGG - Intergenic
964889449 3:161518665-161518687 CCTAATATCCAAGGGGAGAGGGG - Intergenic
964889856 3:161521231-161521253 CTTAATATCCAGAGAGGGAGAGG - Intergenic
965399556 3:168200195-168200217 CCAAATATCCAGGGGGATAGAGG - Intergenic
965399582 3:168200345-168200367 CCTAATATCCAGTGAGGGAGAGG - Intergenic
965399654 3:168200800-168200822 CCTAATATCCAAGGGGGGAGAGG - Intergenic
965399682 3:168200949-168200971 CCTAATATCCAGTGGGGGAGAGG - Intergenic
965399724 3:168201177-168201199 CCTAATATCCAGGTGGGGAGAGG - Intergenic
965399772 3:168201479-168201501 CCTAATATCCAGGTGGAGAGAGG - Intergenic
965399812 3:168201778-168201800 CCAAATATCCAGGGGGTGAGAGG - Intergenic
965399827 3:168201854-168201876 CCTAATATCCAGGTGGGGAGTGG - Intergenic
966976268 3:185086103-185086125 CCTCAGATCCAGAGGGAACAAGG + Intronic
968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG + Intronic
968988276 4:3891625-3891647 TCTAATATCCAGCGGGGGAGAGG + Intergenic
968988417 4:3892468-3892490 CCTAATAACCACAGGGAGAGAGG + Intergenic
968988428 4:3892543-3892565 CCTAATATCCAGAGCGAAAGAGG + Intergenic
968988455 4:3892697-3892719 TCTCATGTCCAGGGGAAGAGAGG + Intergenic
968988495 4:3892923-3892945 CCTAATATCCAGGGGGAAAGAGG + Intergenic
969019268 4:4128925-4128947 TCTAATATCCAGCGGGGGAGAGG + Intergenic
969019398 4:4129694-4129716 TCCTATATTCAGAGGGAGAGAGG + Intergenic
969019411 4:4129769-4129791 CCTAATATCCGCAGGGAGAGAGG + Intergenic
969019422 4:4129844-4129866 CCTAATATCCAGAGCGAAAGAGG + Intergenic
969019451 4:4129997-4130019 CCTAATGTCCAGGGGAAGAGAGG + Intergenic
969019487 4:4130222-4130244 CCTAATATCCAGGGGGAAAGAGG + Intergenic
969020208 4:4135057-4135079 CCTAATATCCGGAGGGGGAGAGG + Intergenic
969020559 4:4137477-4137499 CCTAGTATCCCGAGGGAGAGAGG + Intergenic
969022706 4:4148449-4148471 CCTTATATCCAGGGACAGAGAGG - Intergenic
969022717 4:4148524-4148546 CCTAATATCCAGGGGGCGAGAGG - Intergenic
969022843 4:4149690-4149712 CCTCATATTCAGAGGCCGAGAGG + Intergenic
969024030 4:4159572-4159594 CCTAATATCCACAGGGAGAGAGG + Intergenic
969024041 4:4159647-4159669 CCTAACATCCAGAGCGAAAGAGG + Intergenic
969024066 4:4159801-4159823 CCTAATGTCCAGGGGAAGAGAGG + Intergenic
969024103 4:4160027-4160049 CCTAATATCCAGGGGGGAAGAGG + Intergenic
969025008 4:4166059-4166081 CCTAATATCCACAGGGAGAGAGG + Intergenic
969025021 4:4166134-4166156 CCTAATATCCCGAGCGAAAGAGG + Intergenic
969025050 4:4166288-4166310 CCTAATGTCCAGGGGAAGAGAGG + Intergenic
969025086 4:4166512-4166534 CCTAATATCCAGGGGGAAAGAGG + Intergenic
969025881 4:4171857-4171879 CGTCATATCCAGGGGGCGAGAGG + Intergenic
969728911 4:8941709-8941731 CCTAATATCCAGAGAGGGAGAGG - Intergenic
969729720 4:8947117-8947139 CCTAATATCCAGGGGGGAAGAGG - Intergenic
969729761 4:8947343-8947365 CCTCATGTCCAGGGGAAGAGAGG - Intergenic
969729791 4:8947497-8947519 CCTAACATCCAGAGCGAAAGAGG - Intergenic
969730986 4:8957472-8957494 CCTCATATTAAGAGGCCGAGAGG - Intergenic
969731113 4:8958637-8958659 CCTAATATCCGGGGGGCGAGAGG + Intergenic
969731124 4:8958712-8958734 CCTAATATCCAGGGACAGAGAGG + Intergenic
969733246 4:8969681-8969703 CCTAATATTCAGAGGCCGAGAGG - Intergenic
969733273 4:8969859-8969881 CCTAGTATCCCGAGGGAGAGAGG - Intergenic
969733650 4:8972356-8972378 CCTAATATCCGGAGGGGGAGAGG - Intergenic
969734503 4:8978019-8978041 CCTAGTATCCAGGGGAAGAGAGG - Intergenic
969734535 4:8978173-8978195 CCTCATATCCAGAGCGAAAGAGG - Intergenic
969734547 4:8978249-8978271 CCTAATATCCACAGGGAGAGAGG - Intergenic
969734563 4:8978324-8978346 CCTCGTATCCAGAGGGCGAGAGG - Intergenic
969734605 4:8978550-8978572 CCCCATATCCAGGTGGGGAGAGG - Intergenic
969734686 4:8979094-8979116 TCTAATATCCAGCGGGGGAGAGG - Intergenic
969785918 4:9456894-9456916 CCTAATGTCCAGGGGAAGAGAGG - Intergenic
969785958 4:9457124-9457146 CCTAATATCCACAGGGAGAGAGG - Intergenic
969785973 4:9457199-9457221 TCCTATATTCAGAGGGAGAGAGG - Intergenic
969786079 4:9457894-9457916 TCTAATATCCAGCGGGGGAGAGG - Intergenic
969789374 4:9481455-9481477 CCTAATATCCAGAGCGAAAGAGG - Intergenic
969789390 4:9481532-9481554 ACTGATATCCATAGGGAGAGAGG - Intergenic
969790601 4:9491659-9491681 CCTCATATTAAGAGGAAGAGAGG - Intergenic
969790738 4:9492827-9492849 CCTAATATCCAGGGGGCGAGAGG + Intergenic
969790749 4:9492899-9492921 CCTAATATCCAGGGACAGAGAGG + Intergenic
969792835 4:9503757-9503779 CCTAATATTCAGAGGCCGAGAGG - Intergenic
969792863 4:9503935-9503957 CCTAGTATCCCGAGGGAGAGAGG - Intergenic
969792968 4:9504912-9504934 CCTAATATCCAGGGGGAGAGAGG + Intergenic
969793235 4:9506418-9506440 CCTAATATCCGGAGGGGGAGAGG - Intergenic
969825951 4:9758677-9758699 CGTCATATCCAGCGGGGGAGTGG - Intergenic
969825973 4:9758754-9758776 CATCATATCCAGGGGTGGAGAGG - Intergenic
969826115 4:9759460-9759482 CCTAATATTCAGAGGCCGAGAGG - Intergenic
969826140 4:9759638-9759660 CCTAGTATCCCGAGGGGGAGAGG - Intergenic
970113976 4:12672058-12672080 CCTCATATGTAGAGAGAGTGTGG - Intergenic
971025720 4:22586698-22586720 CCTAATATCCAGCGGGGGAAAGG - Intergenic
971025895 4:22587741-22587763 CCTAATATCCAGGGGGCGAGAGG - Intergenic
971025989 4:22588779-22588801 CCTAGTATCCGGAGGGGGAGAGG + Intergenic
972436359 4:39039292-39039314 CTTCATATGCAGGGGGAGGGTGG + Intergenic
972981220 4:44704258-44704280 CTTCATGTCCAGTAGGAGAGGGG + Intronic
973371159 4:49249500-49249522 CCTAATATCCATAGGGGGAGAGG + Intergenic
973389846 4:49545811-49545833 CCTAATATCCATAGGGGGAGAGG - Intergenic
973390101 4:49547408-49547430 CCTAATATCCCGGGGAAGAGAGG - Intergenic
973722249 4:53736189-53736211 CAACAAGTCCAGAGGGAGAGAGG - Intronic
979420347 4:120497684-120497706 AATAATATCCAGTGGGAGAGGGG - Intergenic
980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG + Intergenic
980391687 4:132155656-132155678 CTTCAAATCCACAGGGACAGAGG - Intergenic
980666902 4:135952230-135952252 CCTCATTTCCAGAGGAAAAGTGG + Intergenic
983623401 4:169782938-169782960 CATAACATCCAGAGGGGGAGGGG + Intergenic
983623448 4:169783162-169783184 CGTAATATCCAGGGGAAGAGAGG + Intergenic
983623530 4:169783672-169783694 CGTAATATCCAGGAGGAGAGAGG + Intergenic
983623889 4:169785827-169785849 CCTAATATCGAGGGGGGGAGAGG + Intergenic
983624345 4:169788501-169788523 CATAATATCCAGAGAGGGAGAGG - Intergenic
983624586 4:169789988-169790010 CCTAATTTCCAGGGGGAGATAGG - Intergenic
983624611 4:169790138-169790160 CGTAATATCCAGGGGAAGAGAGG - Intergenic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
988296520 5:29370078-29370100 ATTCTTATCCACAGGGAGAGAGG - Intergenic
989710031 5:44387791-44387813 GCTCATATCTAGAGGTAGTGGGG + Intronic
994391546 5:99197837-99197859 CATTATATCCAGTGGGGGAGAGG - Intergenic
994391842 5:99199775-99199797 CATAATATCCGGGGGGAGAGAGG - Intergenic
994392057 5:99201117-99201139 CATAATATCCAGGGGGAGAGAGG - Intergenic
994393334 5:99209322-99209344 CCTAATATCCAGAAGAAAAGTGG - Intergenic
994393406 5:99209848-99209870 TCTAATATCCAGAGGAGGAGAGG - Intergenic
994393423 5:99209942-99209964 CCTAATATTCAGGGGGAAAGAGG - Intergenic
994393545 5:99210692-99210714 CCTAATATACAGGGCGAGAGAGG - Intergenic
994393564 5:99210844-99210866 CCTAATATCCAGGGGTGGAGAGG - Intergenic
994393975 5:99213456-99213478 CTTAATATCCAGGGGGTGAGAGG - Intergenic
994394011 5:99213690-99213712 CCTAATATGCAGGGGAAGAGAGG - Intergenic
994394051 5:99214057-99214079 CCTAATATCCAGGTGGAAAGAGG - Intergenic
994394085 5:99214283-99214305 CTTAATATCCAGAGGAGGAGAGG - Intergenic
994394097 5:99214357-99214379 CCTAATATCCAGGGGGAAAGAGG - Intergenic
994394201 5:99215031-99215053 CCTAATATCCAGAAGAAAAGAGG - Intergenic
994394569 5:99217497-99217519 CATAATATCCAGGGGGAGAGAGG - Intergenic
994394751 5:99218544-99218566 CCTAATATCCAGAAGTGGAGAGG - Intergenic
994394772 5:99218696-99218718 CCTAATATCCAGGGGAAGAGAGG - Intergenic
994394989 5:99220076-99220098 CCTAACATCCAGAGGGGAAGAGG - Intergenic
994395101 5:99220687-99220709 CCTAATATCCAGGGAGGGAGAGG - Intergenic
994395525 5:99223292-99223314 CCTAATATCCAAGGGGAGAGAGG - Intergenic
994395563 5:99223519-99223541 TCTAATATCCAGAGGGTCAGAGG - Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
994396066 5:99226673-99226695 CCTAATATCCAGGGGGTGAGAGG - Intergenic
994396257 5:99227953-99227975 CCTAATATCCACTGGGGGAGAGG - Intergenic
994396282 5:99228105-99228127 CCTAATATCCAGAGGGTGAGAGG - Intergenic
994396336 5:99228502-99228524 CCTAATATCCAGGGGGAAAGAGG - Intergenic
994396376 5:99228732-99228754 CCTAATATCCAGGGAGAGAGAGG - Intergenic
994397225 5:99234954-99234976 CTTAATATCCAGTAGGAGAGAGG + Intergenic
994397245 5:99235097-99235119 CGTAATATCCAGGGGGAGAGAGG + Intergenic
997201260 5:132011451-132011473 CCTCATAGCCTGCGGGAGATGGG + Intronic
997682207 5:135764622-135764644 CGTAATATCCAGGGGGGGAGAGG + Intergenic
997682287 5:135765056-135765078 CGTAATATCCAGGGGGAGAAAGG + Intergenic
997682371 5:135765484-135765506 GGTAATATCCAGAGGGTGAGGGG + Intergenic
997683754 5:135774379-135774401 CCTAATATCCAGGGTGGGAGAGG + Intergenic
997683765 5:135774455-135774477 CTTAATATCCAGAAGGGGAGAGG + Intergenic
997683937 5:135775639-135775661 TCTTATATCCAGAAGGGGAGAGG + Intergenic
997684150 5:135777025-135777047 CCTAATATCCAGGGGAAGAGAGG + Intergenic
997684245 5:135777626-135777648 CCTAATATCGAGGAGGAGAGAGG + Intergenic
997684484 5:135779165-135779187 CCTAATATCCAGAGCATGAGAGG + Intergenic
997684500 5:135779240-135779262 CCTGATATCTAAGGGGAGAGAGG + Intergenic
997684543 5:135779466-135779488 CCTAATATCCAAGGGGAGAGAGG + Intergenic
997684972 5:135782217-135782239 CCTAATATCCAGGGAGGGAGAGG + Intergenic
997685073 5:135782819-135782841 CCTAATATCCAGAGGGGAAGAGG + Intergenic
997685195 5:135783577-135783599 ACTAATATCCAGTGGGGGAGAGG + Intergenic
997685313 5:135784437-135784459 CCTAATATCCACAGTGGGAGAGG + Intergenic
997685508 5:135785544-135785566 CGTAATATCCAGGGGGGGAGAGG + Intergenic
997685576 5:135785779-135785801 CGTAATATCCAGGGGGCGAGAGG + Intergenic
997685950 5:135788305-135788327 CGTAATATCCGGGGGGAGAGAGG + Intergenic
997686778 5:135794299-135794321 CCAAATATCCAGGGGGTGAGAGG + Intergenic
997686947 5:135795428-135795450 CCTAATATCCAGGGAGAGAGGGG + Intergenic
997687167 5:135796561-135796583 CATAATATCCACAGGGGGAGAGG + Intergenic
997687203 5:135796775-135796797 CCTAATATCCAGGGGGAAAAAGG + Intergenic
997687288 5:135797365-135797387 TCTAATATCGTGAGGGAGAGAGG + Intergenic
997687414 5:135798267-135798289 TCTAATATCCAGGGGGAAAGAGG + Intergenic
997687733 5:135800469-135800491 CCTAATATGCAGGGGAAGAGAGG + Intergenic
997687803 5:135800854-135800876 CGTAACATCCAGAGGGGGAGAGG + Intergenic
998291271 5:140916818-140916840 GCTCAGAACCAGAGGGATAGGGG - Intronic
998747988 5:145283511-145283533 CAGCAAATGCAGAGGGAGAGGGG - Intergenic
998935656 5:147229568-147229590 CCTAGTATCCGGAGGGGGAGAGG - Intergenic
998935779 5:147230667-147230689 CCTAATAGCCAGCGGGGGAGAGG + Intergenic
998935882 5:147231345-147231367 CCTAATATCCAGGGGAAGAGAGG + Intergenic
998935969 5:147231798-147231820 CCTTATATCCAGGGAGAGGGAGG + Intergenic
998936209 5:147233388-147233410 CCTAATATCCAGCGGGAAAGAGG + Intergenic
1001958273 5:175863341-175863363 CCACATTTCCTGAGGGAGATTGG - Intronic
1003962821 6:11224828-11224850 CCTCATCTCCTGTGGGAGTGAGG + Intronic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006041704 6:31261455-31261477 CCTCATCTCCATGGGGACAGAGG + Intergenic
1006065818 6:31462056-31462078 CCTCATCTCCATAGAGACAGAGG + Intergenic
1007664507 6:43506389-43506411 CCTCCTTTCCAGAGGGAGGGAGG - Exonic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1009046180 6:58240062-58240084 TCTTATATCCAGGGGGAGACAGG + Intergenic
1009046225 6:58240358-58240380 CCTAATATCCAGAATGGGAGAGG + Intergenic
1009046356 6:58241186-58241208 TCTAATATCCAGAGGGGGAGAGG + Intergenic
1009046368 6:58241259-58241281 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1009046517 6:58242171-58242193 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1009046529 6:58242247-58242269 CCTAATATCCAGGAGGGGAGAGG + Intergenic
1009046616 6:58242776-58242798 CCTAACATCCAGAGGAAAAGAGG + Intergenic
1009046693 6:58243293-58243315 CCTAATATCCACGGGGGGAGGGG + Intergenic
1009046754 6:58243658-58243680 CCTAATATCCAGTGGAATAGAGG + Intergenic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1009048004 6:58250915-58250937 TGTAATATCCAGGGGGAGAGAGG + Intergenic
1009048068 6:58251421-58251443 CCTAATATCCAGGGTGGGAGAGG + Intergenic
1009048198 6:58252292-58252314 CATAATATCCAGAGGGAAAGAGG + Intergenic
1009048306 6:58253008-58253030 CTTAATATCCAAAGGGTGAGAGG + Intergenic
1009048314 6:58253081-58253103 TCTAATATCCAAAGGAAGAGAGG + Intergenic
1009048412 6:58253678-58253700 CCTAATATCCATGGGGAGAAAGG + Intergenic
1009048587 6:58254800-58254822 TCTAATATTCAGAGGGTGAGAGG + Intergenic
1009048676 6:58255466-58255488 CCTAATATCTAGTGGAAGAGAGG - Intergenic
1009049393 6:58259848-58259870 TCTAATATCCAGGGGGTGAGAGG - Intergenic
1009049443 6:58260227-58260249 CCTAATATCCAGGGAAAGAGAGG - Intergenic
1009049492 6:58260532-58260554 CCTAATATCCAGGGAAAGAGAGG - Intergenic
1009049753 6:58262311-58262333 CCTAATATCCAAGTGGAGAGAGG - Intergenic
1009049762 6:58262386-58262408 CCTGATATCCAGGGGGGAAGAGG - Intergenic
1009049800 6:58262689-58262711 TCTAATATTCAGAGGGAAAGAGG - Intergenic
1009049816 6:58262827-58262849 CCTAATATCCAGAGAGAAAGAGG - Intergenic
1009049836 6:58262978-58263000 CCTAATATCCAAATGGAAAGAGG - Intergenic
1009049919 6:58263515-58263537 CCTAATATTTAGAAGGAGAGTGG - Intergenic
1009050026 6:58264265-58264287 CCTAATATCCAGACGGGGAGAGG - Intergenic
1009050051 6:58264417-58264439 CCAAATATTCAGAGGGGGAGAGG - Intergenic
1009221990 6:60994367-60994389 TCTTATATCCAGGGGGAGACAGG + Intergenic
1009222016 6:60994520-60994542 CATAATATCCAGTGGGGGAGAGG + Intergenic
1009222037 6:60994669-60994691 CCTAATATCCAGAATGGGAGAGG + Intergenic
1009222172 6:60995503-60995525 CCTAATATCCAGAGGGGGAGAGG + Intergenic
1009222185 6:60995576-60995598 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1009222202 6:60995652-60995674 CCTAATATCAAGGGGGAGAGAGG + Intergenic
1009222301 6:60996258-60996280 CCTAATATCCAGGGGTGGAGAGG + Intergenic
1009222332 6:60996487-60996509 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1009222344 6:60996563-60996585 CCTAATATCCAGGAGGGGAGAGG + Intergenic
1009222388 6:60996864-60996886 CATAATATTCAGAGGGAAAGAGG + Intergenic
1009222426 6:60997088-60997110 CCTAACATCCAGAGGAAAAGAGG + Intergenic
1009222502 6:60997606-60997628 CCTAATATCCACTGGGGGAGGGG + Intergenic
1009222565 6:60997971-60997993 CCTAATATCCAGTGGAATAGAGG + Intergenic
1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG + Intergenic
1009223930 6:61006054-61006076 CCAAATATCCAGAGGAGGAGAGG + Intergenic
1009223953 6:61006202-61006224 CCTAATATCCAGGGTGGGAGAGG + Intergenic
1009224074 6:61007072-61007094 CATAATATCGAGAGGGAAAGAGG + Intergenic
1009224184 6:61007861-61007883 TCTAATATCCAAAGGAAGAGAGG + Intergenic
1009224287 6:61008456-61008478 CCTAATATCCATGGGGAGAAAGG + Intergenic
1009224450 6:61009561-61009583 TCTAATATTCAGAGGGTGAGAGG + Intergenic
1009224458 6:61009636-61009658 TCTTATATCCATAGGGAGACAGG + Intergenic
1009224948 6:61013082-61013104 TCTAATATCCAGGGGGTGAGAGG - Intergenic
1009224998 6:61013461-61013483 CCTAATATCCAGGGAAAGAGAGG - Intergenic
1009225043 6:61013766-61013788 CCTAATATCCAGAGAAGGAGAGG - Intergenic
1009225260 6:61015324-61015346 CCTAATTTCCAGGGGAAGAGAGG - Intergenic
1009225295 6:61015557-61015579 CCTAATATTCAAGGGGAGAGAGG - Intergenic
1009225306 6:61015632-61015654 CCTGATATCCAGGGGGGAAGAGG - Intergenic
1009225365 6:61016086-61016108 CCTAATATCCAGAGAGAAAGAGG - Intergenic
1009225385 6:61016237-61016259 CCTAATATCCAAATGGAAAGAGG - Intergenic
1009225464 6:61016774-61016796 CCTAATATTTAGAAGGAGAGTGG - Intergenic
1009225568 6:61017525-61017547 CCTAATATCCAGACGGGGAGAGG - Intergenic
1009225734 6:61018799-61018821 CGTAATATCCAGAGGGGAAGAGG - Intergenic
1009225878 6:61019707-61019729 CCTAATATCCAGGGGGGTAGAGG - Intergenic
1009226365 6:61023781-61023803 CATAATATCCAGTGGGGGAGAGG + Intergenic
1009226478 6:61024516-61024538 CCTAATATTCAGAGGGGGAGAGG + Intergenic
1009226511 6:61024812-61024834 CCTAATATCCAGAGGTGGGGAGG + Intergenic
1009226640 6:61025752-61025774 CCTAATATCCAGAAGGGGAGAGG - Intergenic
1009227031 6:61029480-61029502 CCTAATATCCAGAAAGGGAGAGG - Intergenic
1009227130 6:61030229-61030251 CCTAATATCCAGGGAGCGAGAGG - Intergenic
1009227189 6:61030536-61030558 CCTAATATCCAGAGGGGAAGAGG - Intergenic
1009227454 6:61032188-61032210 ACTAATATCCAGGGGGAAAGAGG - Intergenic
1009227833 6:61034245-61034267 CGTAATATCCAGAAGGGGAGTGG - Intergenic
1009228110 6:61035871-61035893 TCTAATATCCATGGGGAGAGAGG - Intergenic
1009228290 6:61036918-61036940 CCTAATATCCAGAAAGTGAGAGG - Intergenic
1009228798 6:61040262-61040284 CCTAATATCCAGAGTGAAAGAGG - Intergenic
1009228867 6:61040719-61040741 TGTAATATCCAGGGGGAGAGAGG - Intergenic
1009362770 6:62835581-62835603 CCTAATTTCCAGAGGGAGGGAGG + Intergenic
1009362794 6:62835767-62835789 CATAATATCTAGAGGAAGAGAGG + Intergenic
1009362814 6:62835919-62835941 CCTTATATCCAGTAGGGGAGAGG + Intergenic
1009362961 6:62836974-62836996 GCTAATATCCAGAGGGAAAGAGG + Intergenic
1009363054 6:62837652-62837674 CCTAATAACCAGGGGGAAAGAGG + Intergenic
1009363236 6:62838788-62838810 CCTAATATCCAGGGGAGGAGAGG + Intergenic
1009363265 6:62839015-62839037 CCTAATATCCAGAGGGCAAGAGG + Intergenic
1009363428 6:62840145-62840167 CCTAATATCCAGGGGCGGAGAGG + Intergenic
1009363472 6:62840379-62840401 TCTAATATCCAGTGGGGGAGAGG + Intergenic
1009363561 6:62840885-62840907 TATAATATCCAGGGGGAGAGAGG + Intergenic
1009363597 6:62841113-62841135 CCTAATATCTAGTGGAAGAGAGG + Intergenic
1009364004 6:62844119-62844141 CCTAAATTCCAGGGGGAGAGAGG + Intergenic
1009364476 6:62847409-62847431 CCTGATATCCAGAAGGAAAGAGG - Intergenic
1009364543 6:62847855-62847877 CTTAATATCCAGTGGGAGAGAGG - Intergenic
1009364745 6:62849249-62849271 CCTAATATCCACGGGGAGAGAGG + Intergenic
1009364953 6:62850780-62850802 CCTAATATCCAGGGAGAGAGAGG + Intergenic
1009364993 6:62851007-62851029 CCTAATATCCAGAGAGGAAGAGG + Intergenic
1009365220 6:62852687-62852709 CCTAGTATCCAGGGGGAGAGAGG + Intergenic
1009365511 6:62854792-62854814 CCTAATATCCAGACGGAGAGAGG + Intergenic
1009365580 6:62855398-62855420 TCTAATATCCAGAGGAAGAGAGG + Intergenic
1009365990 6:62858232-62858254 TCTAATATTCAGAGGGAAAGAGG + Intergenic
1009367679 6:62868542-62868564 CATAATATCCAGAGGGGGAGAGG - Intergenic
1009367767 6:62869001-62869023 CATAATATCCAGTGGGGGAGAGG - Intergenic
1009367999 6:62870520-62870542 CCTAATATCCAGATGGAAAGAGG + Intergenic
1009368042 6:62870895-62870917 CCTAATATCAAGGGGGAAAGAGG + Intergenic
1009368055 6:62871040-62871062 CCTAATATCCAGGAGGAAAGAGG + Intergenic
1009368081 6:62871264-62871286 CTTAATATCCAGAAGGAAAGAGG + Intergenic
1009368542 6:62874889-62874911 CCTAGTATCCAGGGAGAGAGAGG + Intergenic
1009368587 6:62875187-62875209 CCTAATATTCAGAGGGGGAGAGG + Intergenic
1009368812 6:62877010-62877032 CCTAATATCCAGATGGGGAGAGG + Intergenic
1009368890 6:62877686-62877708 TTTCATATCCAGGGGAAGAGAGG + Intergenic
1009369021 6:62878592-62878614 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1009369057 6:62878819-62878841 CCTAACTTCCAGGGGGAGAGAGG + Intergenic
1009369088 6:62879048-62879070 CCTAATATCTAGAGGAAGGGAGG + Intergenic
1009369199 6:62879850-62879872 CCTAATATTCAGAGGGAAAGAGG + Intergenic
1009369335 6:62880831-62880853 CCTAATATCCAAGGGAAGAGAGG + Intergenic
1009369463 6:62881738-62881760 CCTAATATCAAAAAGGAGAGAGG + Intergenic
1009369557 6:62882339-62882361 CCTAATATCTAGAAGAAGAGAGG + Intergenic
1009369684 6:62883187-62883209 CCTAATACCCAGACGGAGAGAGG + Intergenic
1009369706 6:62883335-62883357 CCTAATATCCAGGAGGGGAGAGG + Intergenic
1010215760 6:73400014-73400036 CCTCCTAGTCAGATGGAGAGGGG - Intronic
1010575248 6:77522060-77522082 CCTCATAAAAAGAGGCAGAGAGG - Intergenic
1012773789 6:103478570-103478592 TCTGATATCCAGAGTGGGAGAGG + Intergenic
1012773839 6:103478937-103478959 CCTAATATCCAAAAGGAAAGAGG + Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1012774072 6:103480479-103480501 TCTAATATCCAGAGGAAAAGAGG + Intergenic
1012774087 6:103480556-103480578 CCTAACATCCAGGGAGAGAGAGG + Intergenic
1012774099 6:103480644-103480666 TCTCATATCCAGTGGGGGAGAGG - Intergenic
1012774109 6:103480720-103480742 TCTAATATCCAGAAGGGGAGAGG - Intergenic
1012774120 6:103480795-103480817 CCTTATATCCAGGTGGAGAGAGG - Intergenic
1012774249 6:103481633-103481655 CCTAATATCCAGAGCGGGGGTGG - Intergenic
1012774916 6:103486096-103486118 CATAATATTCAGAGGGGGAGAGG - Intergenic
1012775001 6:103486662-103486684 TCTCATATCCAGAGGCGGAGAGG + Intergenic
1012775013 6:103486738-103486760 CCTAATATCCTAAAGGAGAGAGG + Intergenic
1012775244 6:103488245-103488267 CCTAATATCCAGGGGTGGAGAGG + Intergenic
1012775274 6:103488468-103488490 CCTAATATCCAAAAGGACAGAGG + Intergenic
1012775425 6:103489443-103489465 CCTAATATCCAGTGGAGGAGAGG + Intergenic
1012775652 6:103490875-103490897 CCTCATATGCAAAAGGGGAGAGG + Intergenic
1013599737 6:111692738-111692760 CCTCAGACTCAGAAGGAGAGTGG - Intronic
1015224306 6:130838961-130838983 CCTGATATACAGAGGGCCAGTGG + Intergenic
1019472101 7:1226689-1226711 CCTCTGAGGCAGAGGGAGAGGGG + Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019705292 7:2494547-2494569 GCTCACATCCAGAGGGGGAAGGG + Intergenic
1020306546 7:6840344-6840366 TCTAATATCCAGCGGGGGAGAGG + Intergenic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1020306696 7:6841186-6841208 CCTAATATCCACAGGGAGAGAGG + Intergenic
1020306707 7:6841261-6841283 CCTCATATCCAGAGCGAAAGAGG + Intergenic
1020306738 7:6841415-6841437 CCTAGTATCCAGGGGAAGAGAGG + Intergenic
1020306779 7:6841640-6841662 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1020307623 7:6847086-6847108 CCTAATATCCGGAGGGGGAGAGG + Intergenic
1020307740 7:6847908-6847930 CGTCATATCCAGGGGGGGAGAGG + Intergenic
1020307814 7:6848136-6848158 CCTAAGAGCCAGGGGGAGAGAGG + Intergenic
1020307895 7:6848601-6848623 CCTAATATCCAGGCGGCGAGAGG - Intergenic
1020307996 7:6849587-6849609 CCTAGTATCCCGAGGGGGAGAGG + Intergenic
1020311153 7:6869814-6869836 CCTAATATCCACAGGGAGAGAGG + Intergenic
1020311198 7:6870116-6870138 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1020311259 7:6870496-6870518 CCTAATACCCAGGGGGAAAGAGG + Intergenic
1020334971 7:7056226-7056248 CGTAATATCCAGGGGGAGAGAGG + Intergenic
1020335043 7:7056650-7056672 CATAATATCCAGGGGGACAGAGG + Intergenic
1020335053 7:7056725-7056747 CATAATATCCAGAGGGGGAGAGG + Intergenic
1020335441 7:7058969-7058991 CCTAATATGCAGGGGGGGAGAGG - Intergenic
1020335505 7:7059350-7059372 CCTAATATCCGGAGGCGGAGAGG - Intergenic
1020335835 7:7061892-7061914 CCTAATATCGAGAAGGGGAGAGG + Intergenic
1020335895 7:7062197-7062219 CCTAATATCCAAAGGTAGAGAGG + Intergenic
1020336004 7:7062870-7062892 CCTAATAGCCAGGGGAAGAGAGG + Intergenic
1020336209 7:7064221-7064243 CCTGATATCCAGCGGGAAAGCGG + Intergenic
1020336318 7:7065058-7065080 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1021775716 7:24053432-24053454 GCACAAATACAGAGGGAGAGAGG - Intergenic
1021903602 7:25311854-25311876 CCTCATATGTGGAGGGAGGGAGG + Intergenic
1022211339 7:28213033-28213055 CTTCATATCCATGGGGAGATTGG + Intergenic
1022508275 7:30920308-30920330 GCTCAGATACAGAGGGACAGGGG + Intronic
1023878538 7:44306033-44306055 CCAAATACCCAGAGGGAGGGGGG + Intronic
1027570145 7:79855877-79855899 CTTCATAACAAGAGGGATAGTGG - Intergenic
1028417717 7:90596898-90596920 CCCCAGATCCTGAGGAAGAGGGG - Intronic
1028765055 7:94545998-94546020 CTTCTTATACAGAGGCAGAGTGG + Intronic
1028773148 7:94650268-94650290 CCTCTTCTCCAGAGGGAAATAGG - Intronic
1029077704 7:97949289-97949311 TCTAATATCCAGCGGGGGAGAGG + Intergenic
1029077836 7:97950058-97950080 CCTCATATCCAGAGGGCGAGAGG + Intergenic
1029077849 7:97950133-97950155 CCTAATATCCACAGGGAGAGAGG + Intergenic
1029077862 7:97950208-97950230 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1029077896 7:97950361-97950383 CCTAGTATCCAGGGGAAGAGAGG + Intergenic
1029077932 7:97950586-97950608 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1029078739 7:97956030-97956052 CCTAATATCCGGAGGGGGAGAGG + Intergenic
1029078860 7:97956850-97956872 CGTCATATCCAGGGGGGGAGAGG + Intergenic
1029079014 7:97957540-97957562 CCTAATATCCAGGCGGCGAGAGG - Intergenic
1029079134 7:97958695-97958717 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1029079229 7:97959219-97959241 CGTCATATCCAGGGTGTGAGAGG + Intergenic
1029079330 7:97959530-97959552 CCTAATATCCAGGGGGGGAGAGG + Intergenic
1029301003 7:99582377-99582399 CCTAATATCCAGGGGGAGAAAGG - Intronic
1029301073 7:99582756-99582778 CCTAATATCCAGGAGAAGAGAGG - Intronic
1029301319 7:99584117-99584139 CCTAATATCCAGAGAGAGAGAGG - Intronic
1029301357 7:99584334-99584356 CCTAGTATCCAGAGGGGGAGAGG - Intronic
1029301568 7:99585757-99585779 CCTATTATCCAGTGGGGGAGAGG - Intronic
1029301585 7:99585833-99585855 CCTAATATCCAAGGGAAGAGAGG - Intronic
1029301653 7:99586275-99586297 TCTAATATCCAGAGGGAGAGAGG - Intronic
1029301665 7:99586351-99586373 CCTAATATCCATGGGGAAAGTGG - Intronic
1029301677 7:99586427-99586449 CCTAATATCAAGGGGGGGAGAGG - Intronic
1029301856 7:99587402-99587424 CCTAATATCCAGTGGAACAGAGG - Intronic
1029301981 7:99588080-99588102 ACTAATATCCAGTGGAAGAGAGG - Intronic
1029301987 7:99588144-99588166 CCTAATAGCCAGTGGGAGAGAGG - Intronic
1029342565 7:99956929-99956951 CCTAATCTCCAGAGGGGAAGAGG + Intergenic
1029343065 7:99960016-99960038 CATAATATCCAGTGGGGGAGAGG + Intergenic
1029343269 7:99961276-99961298 CCTAATATCCGGGGGGGGAGAGG + Intergenic
1029343296 7:99961425-99961447 CCTAATATCCAGGGGCAGAGAGG + Intergenic
1029343414 7:99962136-99962158 CCTAATATCCAGGGGGTGAGAGG + Intergenic
1029343438 7:99962288-99962310 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1029343486 7:99962592-99962614 TTTAATATCCAGAAGGAGAGAGG + Intergenic
1029343725 7:99964022-99964044 CCTAATATCCATGGGAAGAGAGG - Intergenic
1029343738 7:99964098-99964120 CTTAATATCCAGAGGAGGAGAGG - Intergenic
1029343897 7:99965008-99965030 CATAATATCCAGGGGAAGAGAGG - Intergenic
1029344087 7:99966201-99966223 CCTAATATCCAGGGGTGGAGAGG - Intergenic
1031297701 7:120024323-120024345 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1032262724 7:130350003-130350025 TCTCATATCCACAGGGAGGCTGG - Exonic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1035236181 7:157498990-157499012 CCTCATTTCCAGAGGCACACAGG - Intergenic
1035311153 7:157969833-157969855 CCTGATCTCCTAAGGGAGAGAGG + Intronic
1035681588 8:1492664-1492686 CCTCACAGCCGGAGGCAGAGGGG + Intergenic
1036238862 8:7065791-7065813 CCTAATATCCGGAGGGGTAGAGG - Intergenic
1036238939 8:7066877-7066899 CCTAATATCCAAAGGTGGAGAGG + Intergenic
1036239145 8:7067989-7068011 CCTAATATCCAGGGGAAGACAGG - Intergenic
1036239173 8:7068143-7068165 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1036240067 8:7073919-7073941 CCTAATATCCAGGGGGAAACAGG - Intergenic
1036240105 8:7074144-7074166 CCTCATATCCAGGGGAAGAGAGG - Intergenic
1036240134 8:7074298-7074320 CCTAAAATCCAGAGTGAAAGAGG - Intergenic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1036240159 8:7074448-7074470 CCTCACATCCAGAGGGAGAGAGG - Intergenic
1036240172 8:7074523-7074545 CCTACTATCCAGAGGGCGACAGG - Intergenic
1036240197 8:7074671-7074693 CCTATTATCCAGGCGGAGAGAGG - Intergenic
1036240211 8:7074747-7074769 CCTAATATCCTGGGGGAGAGAGG - Intergenic
1036240237 8:7074847-7074869 CCTAATATCCAGAGGGCCAGAGG - Intergenic
1036817635 8:11913794-11913816 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1036817659 8:11913947-11913969 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1036817859 8:11915073-11915095 CCTAATATCCAAAGGTGGAGAGG - Intergenic
1036817946 8:11915990-11916012 CCTAATATCCGGAGGGGGAGAGG + Intergenic
1036818090 8:11916894-11916916 CGTAATATCCAGTGGGGGAGAGG + Intergenic
1036819718 8:11930990-11931012 TCTAATATCCAGCGGGGGAGAGG + Intergenic
1036819842 8:11931760-11931782 TCTTATATTCAGAAGGAGAGAGG + Intergenic
1036819856 8:11931835-11931857 CCTAATATCCACAGGGAGAGAGG + Intergenic
1036819867 8:11931910-11931932 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1036819897 8:11932064-11932086 CCTAATGTCCAGGGGAAGAGAGG + Intergenic
1036819933 8:11932289-11932311 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1036820609 8:11936564-11936586 CCTCACATCCAGGGGAAGAGAGG + Intergenic
1036820720 8:11937246-11937268 CCTAATATCCATGGGGAAAGGGG + Intergenic
1036832886 8:12035943-12035965 TCTAATATCCAGCGGGGGAGAGG + Intergenic
1036833018 8:12036711-12036733 TCCTATATTCAGAGGGAGAGAGG + Intergenic
1036833030 8:12036786-12036808 CCTAATATCCACAGGGAGACAGG + Intergenic
1036833042 8:12036861-12036883 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1036833069 8:12037015-12037037 CCTAATGTCCAGGGGAAGAGAGG + Intergenic
1036833143 8:12037469-12037491 CCGCATATCCAAAGAGGGAGAGG + Intergenic
1036903169 8:12687132-12687154 TCCTATATTCAGAGGGAGAGAGG + Intergenic
1036903184 8:12687207-12687229 CCTAATATCCACAGGGAGAGAGG + Intergenic
1036903193 8:12687282-12687304 CCTAACATCCAGAGCGAAAGAGG + Intergenic
1036903221 8:12687436-12687458 CCTAATGTCCAGGGGAAGAGAGG + Intergenic
1036905539 8:12706028-12706050 TCTAATATCCAGTGGGGGAGAGG + Intergenic
1036905667 8:12706796-12706818 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1036905680 8:12706871-12706893 CCTAATATCCACAGGGAAAGAGG + Intergenic
1036905690 8:12706946-12706968 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1036905721 8:12707100-12707122 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1036906646 8:12713064-12713086 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1036906672 8:12713218-12713240 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1036906873 8:12714330-12714352 CCTCACATCCAAAGGTGGAGAGG - Intergenic
1036906950 8:12715235-12715257 CCTAATATCCGGAGGGGGAGAGG + Intergenic
1036907080 8:12716063-12716085 CCTCATATTCACGGGGGGAGAGG + Intergenic
1038586607 8:28795339-28795361 CCTCATAAGAAGAGGAAGAGAGG + Intronic
1038637441 8:29299287-29299309 CGCCATATCCAGTGGGCGAGAGG + Intergenic
1038637527 8:29299815-29299837 CATAATATCCAGAAGGAGAGAGG + Intergenic
1038637554 8:29299964-29299986 CGTAATATCCAGGGGGCGAGAGG + Intergenic
1038637605 8:29300350-29300372 CCTAATATCCAGGAGGGGAGAGG - Intergenic
1038637668 8:29300588-29300610 CATAATATCCAAGGGGAGAGAGG - Intergenic
1038637961 8:29302561-29302583 TCTAATATCCAGGAGGAGAGAGG - Intergenic
1038638104 8:29303471-29303493 CCTAATATCCAGCCGGGGAGAGG - Intergenic
1038639625 8:29312880-29312902 CCTAATATCCAGGGACAGAGAGG - Intergenic
1038639651 8:29313032-29313054 CCTAATATCCAGTGGGGGAAAGG - Intergenic
1041945372 8:63434738-63434760 CCTCATCTCCAGTGAGACAGAGG - Intergenic
1042836953 8:73087659-73087681 CATCATATCTGGAGGGAAAGAGG - Intronic
1042935650 8:74055335-74055357 CTTCAAATGCAGAGGGACAGAGG - Intergenic
1043633421 8:82364867-82364889 CATAATATCCAGTGGGGGAGAGG + Intergenic
1043633525 8:82365472-82365494 CCTAATATCCAGAGGGGGATAGG + Intergenic
1043633589 8:82365785-82365807 CCTAATATCCGGTGGGAAAGAGG + Intergenic
1043633684 8:82366399-82366421 CCTAATATCCGGGGGAAGAGAGG + Intergenic
1043633710 8:82366552-82366574 CCTAATATTCAGTGGGGGAGAGG + Intergenic
1043633792 8:82367072-82367094 CCTAATATCCAGAGGGGGAAAGG + Intergenic
1043633998 8:82368200-82368222 CCTAATATCCAGGTGGGGAGAGG - Intergenic
1043634079 8:82368666-82368688 CCTAATATTCAAAGAGAGAGAGG - Intergenic
1043634223 8:82369639-82369661 CGTAATATCCAGGGGGAGAGAGG - Intergenic
1043634380 8:82370625-82370647 CATAATATCCAGGCGGAGAGAGG - Intergenic
1043634754 8:82373033-82373055 CGTAATATCCAGAAGGGGAGAGG + Intergenic
1043635391 8:82377004-82377026 CCTAACATCCAGAGGGGGAGAGG + Intergenic
1043635482 8:82377535-82377557 CCTAATATCCAGGGGGAAAAAGG + Intergenic
1043635594 8:82378132-82378154 CGTAACATCCAGAGGGTGAGGGG + Intergenic
1043635713 8:82378861-82378883 CGTAATATCCAGTGAGAGAGAGG + Intergenic
1044500754 8:92952760-92952782 CCTTCTATCCAGAGGGAAAGGGG - Intronic
1045636002 8:104190688-104190710 TCTCATATCTATAGGGAAAGAGG - Intronic
1045923880 8:107565295-107565317 CATAATATTCAGAGGGGGAGAGG + Intergenic
1045923922 8:107565700-107565722 CATAATATCCAGTGGGAAAGAGG + Intergenic
1045924564 8:107569870-107569892 CCTAATATCCAGTGGAAAAGAGG + Intergenic
1045924850 8:107571729-107571751 CCTTATAACCAGGGGGAGAGAGG + Intergenic
1045924880 8:107571878-107571900 CCTTATATCCAGTGGGGGAGTGG + Intergenic
1045924898 8:107572029-107572051 TCTCATATCCAGTGGGGGAGAGG + Intergenic
1045925096 8:107573340-107573362 CCTAATATTCAGAGAGGGAGGGG + Intergenic
1045925274 8:107574582-107574604 CCTAAAATCCAGTGGAAGAGAGG + Intergenic
1045925450 8:107575715-107575737 CCTAATATCCAGCGTGGGAGAGG + Intergenic
1045925749 8:107577616-107577638 CCTAATATTCAGAAGGAAAGAGG + Intergenic
1045926060 8:107579689-107579711 CCTAATATCCAGCGGGGGAGAGG + Intergenic
1045926093 8:107579917-107579939 CCTAATATCCAGGCGGACAGAGG + Intergenic
1045926138 8:107580291-107580313 CCTAATATCCAGGTGGGGAGAGG + Intergenic
1045926235 8:107580975-107580997 CCTAATATACAGAGGGAGAGAGG + Intergenic
1045926270 8:107581206-107581228 CCTAATATCCAAAAGGGGAGAGG + Intergenic
1045926326 8:107581664-107581686 CCTAATATCCAGAGGAAAAGAGG + Intergenic
1045926374 8:107581962-107581984 TCTAATATCCAGAGGAGGAGAGG - Intergenic
1045926829 8:107585044-107585066 CCTAATATTCAGGGGAAGAGAGG - Intergenic
1045927060 8:107586484-107586506 TCTGATATCCAGAGAGGGAGAGG - Intergenic
1045927349 8:107588435-107588457 CATAATATTCAGAGGGGGAGAGG + Intergenic
1045927387 8:107588659-107588681 CATAATATCCAGGGGGAAAGAGG + Intergenic
1045927778 8:107591351-107591373 CCTAATATCCAGCGTGGGAGAGG + Intergenic
1047131631 8:122026971-122026993 GCTCATATCCAGATTCAGAGTGG + Intergenic
1048179546 8:132182487-132182509 CCTCATCTCCCCAGGGAGGGTGG + Intronic
1048875940 8:138837243-138837265 CCTTATAACCAGAGTGAAAGAGG - Intronic
1049894983 9:104563-104585 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1049895011 9:104741-104763 CCTGGTATCCCGAGGGGGAGAGG - Intergenic
1049895113 9:105757-105779 CCTAATATCCAGGGGGCGAGAGG + Intergenic
1049895144 9:105907-105929 CCTAATAGCCAGCGGGGGAGGGG + Intergenic
1049895166 9:105983-106005 CCTTATATCGAGAGGGGGATAGG + Intergenic
1049895201 9:106176-106198 CCTCATATCCAGGGGAAGAGAGG + Intergenic
1049895631 9:108925-108947 CGTAATATCCAGCGGGGGAGAGG - Intergenic
1050454507 9:5820523-5820545 CCTCATTTCATGAGTGAGAGAGG - Intronic
1050902494 9:10965027-10965049 CCTAATATGCAGTGGGAGAGAGG - Intergenic
1050902517 9:10965178-10965200 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1050902543 9:10965356-10965378 CCTAGTATCCCGAGGGGGAGAGG - Intergenic
1050902644 9:10966248-10966270 CCTAATATCCAGGGGGCAAGAGG + Intergenic
1050902673 9:10966399-10966421 CCTAATAGCCAGCGGGGGAGAGG + Intergenic
1051231955 9:14964066-14964088 CCTAATATCCAGGGGAGGAGAGG - Intergenic
1051232108 9:14965031-14965053 CCTAATATCCAAGGGGTGAGAGG - Intergenic
1051232144 9:14965255-14965277 CCTAATATCCAGGTGGGGAGAGG - Intergenic
1051232194 9:14965548-14965570 CGTAATATCCAGAGGGGGAGAGG - Intergenic
1051232338 9:14966381-14966403 CCTAATATTCAGAAAGAGAGAGG - Intergenic
1051615547 9:19002376-19002398 CCTCATAGAAAGAGTGAGAGAGG - Intronic
1052238653 9:26245718-26245740 CCACATATTCAGAGGGAGGCTGG - Intergenic
1052662976 9:31459727-31459749 CCCCAAATCCAGAGAGACAGGGG + Intergenic
1053072122 9:35107768-35107790 CCCCAGATCCAGGGGGACAGGGG - Exonic
1053736501 9:41106378-41106400 CCTCATATTCAGAGACCGAGAGG - Intergenic
1053737389 9:41109703-41109725 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1053737416 9:41109881-41109903 CCTGGTATCCCGAGGGGGAGAGG - Intergenic
1053737517 9:41110896-41110918 CCTAATATCCAGGGGGCGAGAGG + Intergenic
1053737619 9:41111498-41111520 CCTAATATCTAGGTGGAGAGAGG + Intergenic
1053737665 9:41111722-41111744 CCTTATATAGAGAGGGGGAGGGG + Intergenic
1053737700 9:41111915-41111937 CCTCATATCCAGGGGAAGAGAGG + Intergenic
1053737803 9:41112531-41112553 CCTGATATCCAGGGGGTGAGTGG + Intergenic
1053738059 9:41114068-41114090 CCTAATATTCAGAGGCAGAGAGG - Intergenic
1053738185 9:41115263-41115285 CCTAATATCCAGGGGGCAAGAGG + Intergenic
1053738196 9:41115338-41115360 CCTAATATCCAGGGACAGAGAGG + Intergenic
1053738334 9:41116083-41116105 CCTTATATCGAGAGGGGGATAGG + Intergenic
1053738369 9:41116276-41116298 CCTTATGTCCAGGGGAAGAGAGG + Intergenic
1053738808 9:41119103-41119125 CGTAATATCCAGCGGGGGAGAGG - Intergenic
1054353749 9:64042761-64042783 CCTAATATCCATAGGGGGAGAGG - Intergenic
1054354005 9:64044359-64044381 CCTAATATCCCGGGGAAGAGAGG - Intergenic
1054354651 9:64049417-64049439 TGTAATATCCAGAGGGGGAGAGG + Intergenic
1054354700 9:64049736-64049758 CCTAATATCCAGGTGGGGAGAGG - Intergenic
1054689536 9:68312212-68312234 CGTAATATCCAGCGGGGGAGAGG + Intergenic
1054689981 9:68315039-68315061 CCTTATATCCAGGGGAAGAGAGG - Intergenic
1054690018 9:68315232-68315254 CCTTATATCGAGAGGGGGATAGG - Intergenic
1054690154 9:68315980-68316002 CCTAATATCCAGGGACAGAGAGG - Intergenic
1054690165 9:68316055-68316077 CCTAATATCCAGGGGGCAAGAGG - Intergenic
1054690288 9:68317251-68317273 CCTAATATTCAGAGGCAGAGAGG + Intergenic
1054690546 9:68318789-68318811 CCTGATATCCAGGGGGTGAGTGG - Intergenic
1054690649 9:68319404-68319426 CCTCATATCCAGGGGAAGAGAGG - Intergenic
1054690684 9:68319597-68319619 CCTTATATAGAGAGGGGGAGGGG - Intergenic
1054690731 9:68319821-68319843 CCTAATATCTAGGGGGAGAGAGG - Intergenic
1054690832 9:68320423-68320445 CCTAATATCCAGGGGGCGAGAGG - Intergenic
1054690933 9:68321438-68321460 CCTGGTATCCCGAGGGGGAGAGG + Intergenic
1054690960 9:68321616-68321638 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1054691870 9:68325022-68325044 CCTCATATTCAGAGACCGAGAGG + Intergenic
1055574513 9:77648045-77648067 CCTCCTCCCCAGAGCGAGAGTGG - Exonic
1056864878 9:90220383-90220405 CCTAATATTCAGAGGCCGAGAGG - Intergenic
1056864989 9:90221456-90221478 CCTAATATCCAAAGGTGGAGAGG + Intergenic
1056865003 9:90221532-90221554 CCTAATATCCAGGCGGCGAGAGG + Intergenic
1056865116 9:90222073-90222095 CGTCATAGCCAGGGGGGGAGAGG - Intergenic
1056865142 9:90222151-90222173 CGTCATATCCAGCGGGGGAGAGG - Intergenic
1056865272 9:90222983-90223005 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1056866093 9:90228417-90228439 CCTAATATCCAGGGGGGAAGAGG - Intergenic
1056866130 9:90228637-90228659 CCTAATGTCCAGGGGAAGAGAGG - Intergenic
1056866161 9:90228791-90228813 CCTAATATCCAGAGCGAAAGAGG - Intergenic
1056866173 9:90228866-90228888 CCTAATATCCACAGGGAGAGAGG - Intergenic
1056866187 9:90228941-90228963 CCTAATATCCAGAGGGAGAGAGG - Intergenic
1056916840 9:90753968-90753990 CCTAATATCCAGAGGGAGAGAGG + Intergenic
1056916853 9:90754043-90754065 CCTAATATCCACAGGAAGAGAGG + Intergenic
1056916865 9:90754118-90754140 CCTAATATCCAGAGCGAAAGAGG + Intergenic
1056916899 9:90754272-90754294 CCTAATGTCCAGGGGAAGAGAGG + Intergenic
1056916935 9:90754492-90754514 CCTAATATCCAGGGGGGAAGAGG + Intergenic
1056917745 9:90759905-90759927 CCTAATATCCGGAGGGGGAGAGG + Intergenic
1056917880 9:90760734-90760756 CGTCATATCCAGCGGGGGAGAGG + Intergenic
1056918251 9:90763051-90763073 CCTAAGAGCCAGAGGGGGAGAGG + Intergenic
1056995844 9:91458488-91458510 CCCAATATCAAGAAGGAGAGAGG - Intergenic
1057200612 9:93137814-93137836 CCCCATTTCCAGAAGGACAGAGG + Intergenic
1058517898 9:105794439-105794461 CCTAATATCCAGGGGGGGAGAGG + Intergenic
1058518150 9:105795780-105795802 CCTAATATCCAGGGAAAGAGAGG - Intergenic
1058518276 9:105796618-105796640 CCTAATATCCAGGGAGGGAGAGG - Intergenic
1058518381 9:105797291-105797313 TCTAATATCCAGGGGGAGAGGGG - Intergenic
1058518739 9:105799537-105799559 CCTAATATCCAGGTGGGGAGAGG - Intergenic
1058519001 9:105801201-105801223 CCTAATATCCAGCGGGTGAGAGG - Intergenic
1058519085 9:105801702-105801724 CCTAATATCCAGAAGGGAAGAGG - Intergenic
1058519249 9:105802763-105802785 CCTAATATCCAGGGTGAGAGAGG - Intergenic
1058519294 9:105802994-105803016 CCTAATATCCAGGAGGGGAGAGG - Intergenic
1058519612 9:105805091-105805113 CCTAATATCCAGGTGGGGAGAGG - Intergenic
1058519864 9:105806732-105806754 CCTAATATCCAGGGGCGGAGAGG - Intergenic
1058519934 9:105807191-105807213 CCTAATATAGAGAGGGTGAGAGG - Intergenic
1058520106 9:105808265-105808287 CCTAATATCCAGGGGGAGAGAGG - Intergenic
1058520584 9:105811258-105811280 CCTAATATCCAGGGGAAGAGAGG + Intergenic
1058520598 9:105811343-105811365 CCTAATATCCAAAGGTAAAGAGG + Intergenic
1058521083 9:105814752-105814774 CCTAATATCCAGAGGGGGAGAGG - Intergenic
1058521188 9:105815479-105815501 CCTAATATCCAGGGGAGGAGAGG - Intergenic
1058521236 9:105815772-105815794 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1058521250 9:105815848-105815870 CCTGATATCCAGAAGGGGAGAGG - Intergenic
1058521303 9:105816152-105816174 CCTAGTATCCGGAGGGGGAGAGG - Intergenic
1058521542 9:105817969-105817991 CCTTATATCGAGAGGGGGAGAGG + Intergenic
1058521575 9:105818160-105818182 CCTAATATCCAGGAGAAGAGAGG + Intergenic
1058521638 9:105818540-105818562 CCTAATATCCAGTGGGAAAGAGG + Intergenic
1058521665 9:105818693-105818715 CCTGATATTCAGGGGGTGAGTGG + Intergenic
1058521876 9:105820056-105820078 CCTAATATCCGGAGGGGGACAGG - Intergenic
1058521985 9:105820781-105820803 CCTAATATCCAGGAGGGGAGAGG - Intergenic
1058522037 9:105821077-105821099 CCTAATATGCAGGGGGAGAGAGG - Intergenic
1058522100 9:105821457-105821479 CCTAGTATCCGGAGGGGGAGAGG - Intergenic
1058522196 9:105822417-105822439 CCTAAAATCCAGGGGGCGAGAGG + Intergenic
1058674617 9:107389733-107389755 CCTCACTGGCAGAGGGAGAGTGG - Intergenic
1059018849 9:110551931-110551953 CCAGATATCCAGATGGAAAGAGG - Intronic
1059713296 9:116889277-116889299 CCACATATCCAGAGAGATAGTGG - Intronic
1060224023 9:121780603-121780625 CCCCATGTCCAGAGGCAGACAGG + Intronic
1060779613 9:126401763-126401785 CCCCATGTCCAGAGGGAAGGCGG - Intronic
1061040944 9:128140030-128140052 CCTAATATTCAGAGGCCGAGAGG + Intergenic
1061894405 9:133639703-133639725 CCTCAGATCCACAGGGACTGAGG + Intronic
1061956186 9:133962403-133962425 CTTTCTATCCAGAGGCAGAGGGG + Intronic
1203695583 Un_GL000214v1:94444-94466 CCTAATATCCATAGGGGGAGGGG + Intergenic
1203742081 Un_GL000218v1:11871-11893 CCTAACATCCATAGGGGGAGAGG - Intergenic
1203742095 Un_GL000218v1:11947-11969 CCTAATATCCAGGGGAAGAGTGG - Intergenic
1203742339 Un_GL000218v1:13469-13491 CCTAATATCCCGGGGAAGAGAGG - Intergenic
1203742988 Un_GL000218v1:18541-18563 TGTAATATCCAGAGGGGGAGAGG + Intergenic
1203743041 Un_GL000218v1:18863-18885 CCTAATATCCAGGTGGGGAGAGG - Intergenic
1203702278 Un_KI270742v1:6461-6483 CCTAATATCCATAGGCGGAGAGG - Intergenic
1203702530 Un_KI270742v1:8058-8080 CCTAATATCCCGGGGAAGAGAGG - Intergenic
1203703251 Un_KI270742v1:13517-13539 CCTAATATCCAGGTGGGGAGAGG - Intergenic
1203554255 Un_KI270743v1:192517-192539 CCTAATATCCATAGGGGGAGAGG - Intergenic
1203567051 Un_KI270744v1:100504-100526 CCTAATATCCGGGGGGGGAGAGG + Intergenic
1203640690 Un_KI270751v1:9619-9641 CCTAATATCCATAGGGGGAGGGG - Intergenic
1192138992 X:68631515-68631537 GCTCAGAGCCAGAGGGAGATGGG + Intergenic
1195894603 X:109733056-109733078 CCCCATTTCCAGAGGGGGACTGG - Intronic
1197712784 X:129683877-129683899 GCTCTTACCCAGAGGGAGATGGG + Intergenic
1198202642 X:134437210-134437232 CCCCATATCCAGATGGAGTCAGG + Intergenic
1200247891 X:154535554-154535576 CTGCACATCCAGAGGGAGGGAGG + Intronic
1200747529 Y:6915736-6915758 CCTCCTATCCAGCAGGAGTGGGG - Intronic
1201155612 Y:11129347-11129369 CTTAATATCCATAGGGGGAGAGG - Intergenic
1201155625 Y:11129423-11129445 CCTAATATCCAGGGGAAGAGTGG - Intergenic
1201155870 Y:11130944-11130966 CCTAATATCCCGGGGAAGAGAGG - Intergenic
1201156514 Y:11136010-11136032 TGTAATATCCAGAGGGGGAGAGG + Intergenic
1201156565 Y:11136329-11136351 CCTAATATCCAGGTGGGGAGAGG - Intergenic