ID: 949890583

View in Genome Browser
Species Human (GRCh38)
Location 3:8730935-8730957
Sequence GAGCCTCCTTACACACACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 133}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949890580_949890583 12 Left 949890580 3:8730900-8730922 CCAGCTAGGGGCACTGACCCTTT 0: 1
1: 0
2: 0
3: 6
4: 92
Right 949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 133
949890574_949890583 28 Left 949890574 3:8730884-8730906 CCCTCAGCACCGATCACCAGCTA 0: 1
1: 0
2: 0
3: 9
4: 82
Right 949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 133
949890575_949890583 27 Left 949890575 3:8730885-8730907 CCTCAGCACCGATCACCAGCTAG 0: 1
1: 0
2: 0
3: 7
4: 110
Right 949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 133
949890582_949890583 -6 Left 949890582 3:8730918-8730940 CCTTTCAGATAACAAATGAGCCT 0: 1
1: 0
2: 0
3: 10
4: 187
Right 949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 133
949890581_949890583 -5 Left 949890581 3:8730917-8730939 CCCTTTCAGATAACAAATGAGCC 0: 1
1: 0
2: 3
3: 13
4: 182
Right 949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 133
949890579_949890583 19 Left 949890579 3:8730893-8730915 CCGATCACCAGCTAGGGGCACTG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949890583 Original CRISPR GAGCCTCCTTACACACACCA AGG Intronic
901161075 1:7177124-7177146 GAGGCTCCTCCCACACACCGAGG + Intronic
902844501 1:19099297-19099319 GAGCCTCCTTCGACACCCCCTGG + Intronic
904491654 1:30864141-30864163 GAGTGTCCTTACACAAACCAAGG - Intergenic
905016584 1:34782250-34782272 GTCCCTCCTGACACACCCCAGGG - Intronic
905278867 1:36836281-36836303 GGCCCTCCTCTCACACACCATGG + Intronic
906814894 1:48868660-48868682 GAGCCATCTTACATAAACCAAGG - Intronic
907526774 1:55058287-55058309 CATCCTCCTTACACAGACAAGGG - Intronic
912497386 1:110100381-110100403 CATCCTCCTTCCACACCCCAAGG + Intergenic
913017690 1:114756397-114756419 GCCCCTCCTTACCCACACCAAGG + Intronic
916813621 1:168328690-168328712 CAGCCTCCTTACACACTGGAGGG - Intergenic
923839986 1:237659667-237659689 GATCTTCCTTAAACAGACCAAGG - Intronic
924349832 1:243104150-243104172 GAGCCACCGTACACAGCCCAAGG - Intergenic
924385171 1:243493110-243493132 GGGCCTCCAGACACACACCCTGG + Intronic
1062832595 10:615910-615932 GAGCCTCCCTACAGGCACAAAGG - Intronic
1062961881 10:1578545-1578567 GAGCCTCCAGACCCACGCCAAGG - Intronic
1063173298 10:3529099-3529121 CAGCTTCCTTCCACACATCAGGG + Intergenic
1064800891 10:19070729-19070751 GAGCCTCCATTCACACATCCAGG - Intronic
1065783069 10:29188821-29188843 GAGTGTACTTACACAAACCAAGG - Intergenic
1065809240 10:29426210-29426232 GAGTGTACTTACACAAACCAAGG - Intergenic
1069317864 10:67130287-67130309 GAGCCTCATCATACAAACCAAGG - Intronic
1070638003 10:78144778-78144800 GTGCCTCCCACCACACACCAAGG + Intergenic
1070941936 10:80356341-80356363 GAGATTCCTTACCCACACCTGGG + Intronic
1071682169 10:87717304-87717326 GGGCCTCATTACAGACAACAAGG + Intronic
1071728382 10:88222382-88222404 GAGCCTCCTCCCAGACTCCAAGG - Intergenic
1072440091 10:95446775-95446797 GAGCCTCCTTAACTCCACCATGG + Intronic
1074609046 10:115003895-115003917 GAGCTGCCTTACCCAGACCAGGG + Intergenic
1074913453 10:117933528-117933550 GAGTGTCCTTACACAAACCTAGG - Intergenic
1075266828 10:121007621-121007643 TAGCCTCCTTACCCCCACCATGG - Intergenic
1075676556 10:124299949-124299971 CAGCCTCCTGCCACCCACCAAGG + Intergenic
1075923882 10:126235302-126235324 GAGCCTCCTCCGACACACCCAGG - Intronic
1082286144 11:50320327-50320349 TTGTCTCCTTAAACACACCATGG + Intergenic
1083642421 11:64152757-64152779 GAGCTTCCTCCCACACACTAAGG + Intronic
1083936261 11:65871639-65871661 GGGCCTCCTTACCCACCCCTGGG + Intronic
1086393110 11:86386384-86386406 TAGTTTCCTTACACACACCCAGG - Intronic
1087122901 11:94593442-94593464 GAGCATCCTTACATTCAACAAGG - Intronic
1093972269 12:25386063-25386085 GAGCGTCCTTACACGTTCCAGGG - Intergenic
1096770445 12:53932957-53932979 GGGCCTCCTTAGTCCCACCATGG - Intergenic
1102423848 12:112825059-112825081 GAGCCTCTTTGCACTCAGCAGGG + Intronic
1104871242 12:131998229-131998251 GATCCTCCTAACACAGAGCAAGG - Intronic
1106620428 13:31366426-31366448 GAGTTTACTTACAGACACCAAGG - Intergenic
1107067138 13:36226577-36226599 GGGACTCCTGATACACACCATGG + Intronic
1108301651 13:49083248-49083270 GAGACTCCTCAAACACACAAAGG + Intronic
1110104165 13:71649245-71649267 GAGCGTACTTACACAAACCTAGG - Intronic
1110563893 13:76938518-76938540 GGGCCACCTCACACACAACACGG + Intergenic
1113236821 13:108285404-108285426 GAGCATACTTACACAAACCTAGG + Intronic
1120703367 14:87723093-87723115 GCTCCTCCTCAAACACACCAAGG - Intergenic
1122576991 14:102749029-102749051 CAGCCTCCTCTCTCACACCATGG - Intergenic
1122829648 14:104389556-104389578 AAGCCTTCAGACACACACCAGGG - Intergenic
1123695359 15:22875174-22875196 GAGCCTGCTGACCCCCACCAGGG - Intronic
1123699222 15:22902313-22902335 GCGCCTCCTTCCCCACACCCCGG - Intronic
1124026966 15:25975729-25975751 GAACCGCCTTGCACACACCCTGG - Intergenic
1124716033 15:32062877-32062899 GAGTCTACTTACACAGACCTAGG + Intronic
1128625292 15:69195687-69195709 CACCCTCATTATACACACCAGGG - Intronic
1129272031 15:74424080-74424102 GAGCATCCTCCCACCCACCAAGG + Intronic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133229863 16:4361349-4361371 CAGCCTCCTTACCCACAGCGAGG + Exonic
1133853970 16:9532326-9532348 GAGCTTCCTTACAAACACTGAGG - Intergenic
1136285020 16:29235689-29235711 GAGCCTCCTGAGGCACAGCAGGG + Intergenic
1138679068 16:58672071-58672093 GAGCCCCCTTCCACTCCCCAGGG - Intronic
1142090084 16:88205313-88205335 GAGCCTCCTGAGGCACAGCAGGG + Intergenic
1143543956 17:7585629-7585651 GAGCCCCCTTACCCACACCAGGG - Intronic
1145012744 17:19378882-19378904 GAGTCTCCACACAGACACCATGG + Exonic
1147643301 17:42018129-42018151 GAGCTTCCTTATAAACTCCAGGG - Intronic
1149529781 17:57385878-57385900 CAGACACCTAACACACACCATGG - Intronic
1153513170 18:5877684-5877706 CAGCCTCCTTACCCACACTGTGG - Intergenic
1154063907 18:11088824-11088846 CAGCCTCATAACTCACACCAAGG + Intronic
1155181297 18:23350473-23350495 GAGCCTGCATACACACACAGAGG - Intronic
1155335715 18:24763534-24763556 GAGCCCCCATACAGCCACCACGG - Intergenic
1157527786 18:48398219-48398241 AAGCCTTCTTCCACACAGCAAGG + Intronic
1160257058 18:77256329-77256351 AAACCTCCTTAGCCACACCAAGG - Intronic
1161520549 19:4721233-4721255 GTGCCCCCTTACCCACAGCAGGG - Intronic
1162235210 19:9303596-9303618 GAGCCTCCTTAAAAACCCAAAGG - Intronic
1165901228 19:39170190-39170212 GAGGCACCTGACACAGACCAGGG + Intronic
1166090915 19:40508344-40508366 GTGGCTCTTTACACCCACCATGG + Intronic
1167153440 19:47723226-47723248 CAGCCTCCACACACACAGCAGGG + Intronic
928723090 2:34142623-34142645 GAGCCTCCCCACCCACCCCATGG - Intergenic
929824543 2:45299948-45299970 GAGCCTTCTCTCACACGCCAGGG - Intergenic
930490776 2:52067553-52067575 GAGCATACTTACACAAACCTAGG - Intergenic
931671459 2:64652498-64652520 TAGCCTCTTTACACACATTATGG + Intronic
936256779 2:110922938-110922960 GGGCCTCCTTGCACCCTCCATGG + Intronic
936660479 2:114537516-114537538 GATCCTCCTTGTGCACACCAGGG - Intronic
937619671 2:123971135-123971157 TAGCCGCCTTACACATAGCAAGG + Intergenic
938101554 2:128501166-128501188 GAGCCTCCTCACCCACTCCAGGG - Intergenic
942792857 2:179780375-179780397 GGGCCTCCTGACCCACATCATGG + Intronic
945206489 2:207338111-207338133 GCTCCTCCTAACACACAGCAGGG + Intergenic
946712940 2:222524987-222525009 GAGCCTGCTGAGACACACCAAGG - Exonic
948912740 2:241012471-241012493 GAGCCACCCTAAAAACACCAGGG - Intronic
1168970955 20:1930275-1930297 GAGACACCTTGAACACACCAGGG - Intronic
1169023485 20:2348139-2348161 TATCTTCCTCACACACACCAGGG - Intergenic
1174460082 20:50676299-50676321 GGGCCTCATCCCACACACCATGG - Intronic
1175815507 20:61881303-61881325 GAGCCTCCTCTCAGACTCCATGG - Intronic
1175966787 20:62663980-62664002 GAGCCTCCATTCACCCCCCAGGG + Intronic
1175986243 20:62765449-62765471 GAGGCTCCCTACACACAGCTGGG - Intergenic
1176125648 20:63473370-63473392 GACCCTCCCTGCACACACCCTGG - Intergenic
1178744130 21:35231131-35231153 GGCCCTGATTACACACACCATGG - Intronic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1184900717 22:47444898-47444920 GAGCCTCCTAGCACCCAACAGGG + Intergenic
949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG + Intronic
950979113 3:17282874-17282896 GAGACTCCTTACACATTTCATGG + Intronic
957071755 3:75572833-75572855 GAACTTCCTTGCACACACCCTGG + Intergenic
959999861 3:112719816-112719838 GAGCCCCTCTACATACACCATGG - Intergenic
962069148 3:132014678-132014700 AACCCTCCTTATATACACCATGG - Intronic
962771713 3:138616641-138616663 GAGCCACCATGCACACTCCAAGG + Intronic
966806376 3:183810894-183810916 GAGCCCCCTTAAGCACACCCAGG - Exonic
973314901 4:48749619-48749641 GAGCCTCATTACTCACACCTGGG + Intronic
975077659 4:70232501-70232523 GAGTGTCCTTACACAAACCTAGG - Intronic
979231970 4:118356240-118356262 GAGTCTCCCTGCACACACAACGG + Intergenic
982302115 4:153890650-153890672 CAGCCTCCTTTCACAGACTAAGG - Intergenic
982441739 4:155443661-155443683 GAGGGTCCTGCCACACACCAAGG - Intergenic
983205702 4:164908613-164908635 GTGCCTCCTGACATACACCAGGG + Intergenic
984796433 4:183664405-183664427 GAGCCACATTGCACAGACCATGG - Intronic
996319363 5:122197112-122197134 GAGCCACCCAACCCACACCAGGG + Intergenic
996688422 5:126310516-126310538 GGGCCCCCTCACAGACACCAAGG - Intergenic
997740388 5:136248009-136248031 GATCCCCCTTACCCCCACCACGG + Intronic
999304427 5:150510468-150510490 GAGGCTCTTCACGCACACCAAGG - Intronic
1001768895 5:174277579-174277601 GATCCTCCTTACTCAGTCCATGG + Intergenic
1002430770 5:179202718-179202740 GTGTTTCCTTACTCACACCATGG + Intronic
1005565580 6:27090142-27090164 CAGCATCATTACACACATCAGGG - Intergenic
1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG + Intronic
1006960263 6:37922602-37922624 GAGTGTCCTTACACAAACCTAGG + Intronic
1007270222 6:40630578-40630600 GGGGCTCCCTGCACACACCATGG - Intergenic
1007374127 6:41444759-41444781 GGGCGTACTTACACACGCCAGGG - Intergenic
1010734697 6:79430958-79430980 GAGCTGTGTTACACACACCAAGG + Intergenic
1011215438 6:85000629-85000651 TAGCCTCCATGCAAACACCATGG - Intergenic
1018016522 6:159717214-159717236 GATGCTCCTTACTCCCACCAAGG + Intronic
1018385113 6:163296057-163296079 GAGTCTCCTAACACCCCCCAGGG - Intronic
1018952822 6:168390381-168390403 GTACCTCCTTACTCACCCCAGGG + Intergenic
1021585642 7:22204653-22204675 GTGCCTCCCTAAAAACACCAAGG - Intronic
1025836877 7:65102772-65102794 CTGTCTCCTTAAACACACCATGG + Intergenic
1025906655 7:65792208-65792230 CTGTCTCCTTAAACACACCATGG + Intergenic
1030481438 7:110109687-110109709 GAGCTTACTTACACAAACCTAGG - Intergenic
1032239257 7:130148381-130148403 GAGCCACCTTGCTCTCACCAGGG - Intergenic
1038593740 8:28866493-28866515 GAGCTTCCTTACAGACCCCAGGG + Intronic
1043591877 8:81842294-81842316 GCCCCTCCTTCCACACAGCAGGG - Intronic
1043733237 8:83711885-83711907 GAGGCTCCTCACACACTTCATGG - Intergenic
1049782505 8:144435355-144435377 GATCCTCCTGGAACACACCAGGG + Intronic
1051892462 9:21957006-21957028 GGGCTTCCCTACAAACACCATGG - Intronic
1059451028 9:114371617-114371639 GCCCCTCCACACACACACCAAGG - Intronic
1062288075 9:135782303-135782325 GAGACTCCTCTCACACACCGGGG - Intronic
1062362465 9:136194247-136194269 GTGCCTCCTTAGACACAGCGTGG + Intergenic
1185445596 X:256302-256324 GATCCCCCTTACACACCTCATGG + Intergenic
1186338282 X:8615831-8615853 CTGCCTCCATACACACACAATGG + Intronic
1186457903 X:9724949-9724971 TGGCCTCCTAACACACACTAGGG - Intergenic
1190908680 X:54752120-54752142 AAGACTCCTCATACACACCATGG - Intronic
1201918087 Y:19204218-19204240 GAGACTACATGCACACACCAAGG - Intergenic