ID: 949890723

View in Genome Browser
Species Human (GRCh38)
Location 3:8731999-8732021
Sequence CTGGATAAGAAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 925
Summary {0: 1, 1: 1, 2: 10, 3: 69, 4: 844}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949890723_949890728 26 Left 949890723 3:8731999-8732021 CCTTCCTCTTTCTTCTTATCCAG 0: 1
1: 1
2: 10
3: 69
4: 844
Right 949890728 3:8732048-8732070 GTAGACATCTTGTGCCTATGAGG 0: 1
1: 0
2: 3
3: 21
4: 185
949890723_949890726 -4 Left 949890723 3:8731999-8732021 CCTTCCTCTTTCTTCTTATCCAG 0: 1
1: 1
2: 10
3: 69
4: 844
Right 949890726 3:8732018-8732040 CCAGACTCAGAGATGATGATTGG 0: 1
1: 0
2: 1
3: 17
4: 204
949890723_949890727 -1 Left 949890723 3:8731999-8732021 CCTTCCTCTTTCTTCTTATCCAG 0: 1
1: 1
2: 10
3: 69
4: 844
Right 949890727 3:8732021-8732043 GACTCAGAGATGATGATTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 138
949890723_949890729 29 Left 949890723 3:8731999-8732021 CCTTCCTCTTTCTTCTTATCCAG 0: 1
1: 1
2: 10
3: 69
4: 844
Right 949890729 3:8732051-8732073 GACATCTTGTGCCTATGAGGTGG 0: 1
1: 0
2: 1
3: 21
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949890723 Original CRISPR CTGGATAAGAAGAAAGAGGA AGG (reversed) Intronic
900492903 1:2961517-2961539 GTGGATGAGAAGACAGAGCAAGG + Intergenic
900510546 1:3058142-3058164 CTGGCTCTGAAGACAGAGGAAGG - Intergenic
901226946 1:7618883-7618905 CTGGATTAAAAAAAAAAGGATGG - Intronic
901300418 1:8196337-8196359 TTGGCTAGGAAGAAAGAGGAAGG + Intergenic
901387528 1:8920995-8921017 CTGGAATAGAACAAAGAAGACGG - Intergenic
901388565 1:8927435-8927457 CTGGAATAGAACAAAGAAGATGG - Intergenic
901826031 1:11861936-11861958 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
902293596 1:15451105-15451127 CTGGCTCTGAAGATAGAGGAAGG + Intergenic
902744352 1:18463523-18463545 CTGGCTCTGAAGACAGAGGATGG - Intergenic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
904262586 1:29298375-29298397 TTGGAAAAGAAGGAAGTGGAAGG - Intronic
904389476 1:30172499-30172521 CTAGATCAGAGGAAAGTGGATGG + Intergenic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904933213 1:34107056-34107078 CTGGATCAGCAGCAAGAGAAAGG + Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905274148 1:36806244-36806266 CTGGTGAAGAACAACGAGGAGGG - Exonic
905861034 1:41351605-41351627 CCTGATTAGAACAAAGAGGAGGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
906958408 1:50397160-50397182 CTGGTGTTGAAGAAAGAGGAAGG - Intergenic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
907649071 1:56276148-56276170 CTGGAGACGAACAGAGAGGAGGG - Intergenic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907829364 1:58049589-58049611 TTGGAATAGAAGAAAGAGCATGG + Intronic
908314600 1:62920464-62920486 CTCGATAAGAAGAGAGTGGCTGG + Intergenic
909597183 1:77419499-77419521 ATGGAAAAGAAGAAAGAAAAAGG + Intronic
909622698 1:77685047-77685069 CTCTATAAGTAGAAAGAGCAAGG - Intergenic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910501599 1:87898029-87898051 GTGGATAAATAGAAAGAGTAAGG + Intergenic
911060185 1:93740725-93740747 CTGGACTAGAACAAAAAGGATGG - Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911971238 1:104440516-104440538 CTGGGTAAAAAGCAAGTGGATGG - Intergenic
913182407 1:116334876-116334898 CAGCATAAGAATGAAGAGGAGGG + Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
914082975 1:144426538-144426560 CTGTTTAAAAAGAAAAAGGACGG + Intronic
914203289 1:145505452-145505474 GTGGAAAAGAACACAGAGGAAGG + Intergenic
914237218 1:145823375-145823397 GTGGAAAAGAACACAGAGGAAGG + Intronic
914482411 1:148078606-148078628 GTGGAAAAGAACACAGAGGAAGG + Intergenic
914568640 1:148892660-148892682 TTTGATGAGAAGGAAGAGGAGGG - Intronic
914998646 1:152566501-152566523 CTGCCTGAGTAGAAAGAGGATGG + Intronic
915205690 1:154268983-154269005 AGGGATAGGAAGGAAGAGGAAGG - Intronic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916777712 1:167985412-167985434 CTGGGTTTGAAGATAGAGGAAGG - Intronic
916871537 1:168919881-168919903 CAGGAAAAGAAGAAAGAAAATGG + Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917498117 1:175561039-175561061 CTGAATTAGAAGAACAAGGAAGG - Intronic
917693076 1:177488945-177488967 CTTGATTAGAAGAATGATGAGGG + Intergenic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918056394 1:181025320-181025342 CTGGAGTAGAAGGAAAAGGATGG + Intergenic
918129186 1:181609988-181610010 CTGGATAACAAGACATGGGATGG - Intronic
918477987 1:184946465-184946487 CTCAAAAAGAGGAAAGAGGAAGG + Intronic
918617370 1:186561224-186561246 CAAGTTAAGAAGAAAGAGCAAGG + Intergenic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
920206977 1:204299350-204299372 GAGGACAGGAAGAAAGAGGAGGG + Intronic
920645303 1:207798923-207798945 CTGGCTTGGAAGACAGAGGAAGG + Intergenic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
922029827 1:221787209-221787231 TTGGAAAAGAAAAAAGAGAATGG + Intergenic
922287465 1:224182976-224182998 CCGGAGAAGATGAAAAAGGAAGG - Intronic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
922985399 1:229862406-229862428 TTGGTTAAAAAAAAAGAGGAGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
924005148 1:239600763-239600785 AAGGAAAAGAAGAAAAAGGAAGG - Intronic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924927675 1:248699012-248699034 CAGGAAAAGAACAAAGAAGATGG - Intergenic
1063091227 10:2867632-2867654 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1063164303 10:3446032-3446054 ATGGATGCAAAGAAAGAGGAGGG + Intergenic
1063197835 10:3759675-3759697 CAGGAAAGGAAGAAAAAGGAAGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063671158 10:8101297-8101319 CTAGATAAAAAGAAAGACCAAGG + Intergenic
1064359403 10:14650051-14650073 CCAGATAGGAAGAAGGAGGAAGG + Intronic
1065307905 10:24385672-24385694 CTGGATGAGAGGAAAGGGCAGGG - Intronic
1065404366 10:25347248-25347270 CTGGCTTTGAAGAAAGAGAAAGG - Intronic
1065739138 10:28781206-28781228 CTGGCTTTGAAGACAGAGGAAGG - Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1066034255 10:31465907-31465929 ACAGATAAGATGAAAGAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068724825 10:60289362-60289384 GGGGAGAAGAAGAAAGAGGGTGG - Intronic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069369702 10:67734127-67734149 CAGGAAAAGAGAAAAGAGGAAGG - Intergenic
1070180662 10:74010223-74010245 CTTGTTAAGAAGAAAAAGGTAGG - Intronic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071030277 10:81171736-81171758 CTGGAAAAGGTGAAAAAGGAAGG + Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071988396 10:91075567-91075589 TTGGACAAGAGGAAAGAGAAGGG + Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072231024 10:93414113-93414135 CTGGCTAGGAAGAGACAGGAAGG - Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1073562248 10:104506804-104506826 CCGGAAAAGAAGGAAAAGGAGGG - Intergenic
1074402550 10:113153876-113153898 AAGTATGAGAAGAAAGAGGAAGG - Intronic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1074997832 10:118773117-118773139 ATAGATAAGAAGAGAGAGGCTGG - Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075204837 10:120437853-120437875 CTGAACATGATGAAAGAGGAAGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1076514107 10:131033533-131033555 CTGGATACGCAGAAAGATGGAGG + Intergenic
1077455821 11:2679704-2679726 CTGGACAAGAATACAGAGAACGG - Intronic
1077588692 11:3474762-3474784 ATGGGTAATAAGAAAAAGGATGG + Intergenic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079609145 11:22409232-22409254 GTGGAAAACAAGAAAGAGCAGGG + Intergenic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1079978522 11:27123926-27123948 CTGGGAAAGAAGTAAAAGGAAGG - Intronic
1080527233 11:33135755-33135777 CTGGATTTGAAGAAAAAAGAAGG - Intronic
1080726940 11:34907387-34907409 CTGGAAAAGACAAAAGAGAAAGG - Intronic
1081041813 11:38223087-38223109 TTGGGGAAGAAGAAAGAGAAAGG + Intergenic
1081129875 11:39365796-39365818 GTTGATGAGAAGATAGAGGAGGG + Intergenic
1081188306 11:40072386-40072408 CTGGCTTTGAAGACAGAGGAAGG + Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081302502 11:41469410-41469432 GTAGAAAAGAAGAAAGAGTAGGG + Intergenic
1081655079 11:44851648-44851670 ATGTATGAGAAGAGAGAGGAGGG - Intronic
1081844896 11:46233282-46233304 CTGGTTTTGAAGACAGAGGAAGG + Intergenic
1082016968 11:47496800-47496822 CTGACTAAGAATAAAGAGGTAGG + Intronic
1082649635 11:55773368-55773390 CTGGATAGGAAAAAAGAGATAGG - Intergenic
1082775221 11:57239444-57239466 CAGGAGAAGAACCAAGAGGATGG + Intergenic
1082888980 11:58118306-58118328 GGGGATAAGAAGAAAGAACATGG + Intronic
1082917404 11:58452437-58452459 ATGAATAAGAAGAAAGGGAAAGG + Intergenic
1082969872 11:59008799-59008821 CTGGATAACAAAAAAGATAAGGG + Intronic
1083295308 11:61712161-61712183 CTGGCCAAGAAGCACGAGGAGGG + Intronic
1083575637 11:63789092-63789114 CTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1083830498 11:65229366-65229388 CTGGCTTTGAAGACAGAGGAAGG + Intergenic
1084112226 11:67021846-67021868 CTGGAACAGAACAAAGAGAAAGG - Intronic
1084244387 11:67846389-67846411 ATGGGTAATAAGAAAAAGGATGG + Intergenic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084828300 11:71748172-71748194 ATGGGTAATAAGAAAAAGGATGG - Intergenic
1084839617 11:71834583-71834605 CTGGAGAAGAAAACACAGGATGG + Intronic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085501729 11:77030637-77030659 CTGGATGAGAAGAATGAAGGGGG - Intergenic
1085703397 11:78764797-78764819 CTGGAGAAGAAGGAAGTAGAAGG + Intronic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086482531 11:87258358-87258380 ATGTATAAGAGGAAAGAGGCTGG - Intronic
1087231559 11:95671781-95671803 CTGTATCAGAAGGAAGAAGAAGG + Intergenic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1088497538 11:110446657-110446679 CAGGTTGGGAAGAAAGAGGAAGG - Intronic
1089061654 11:115630722-115630744 CTGGAAAACAAAAGAGAGGAGGG - Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089390531 11:118098784-118098806 CTGGATAAGTAAGAAGAGGCAGG + Intronic
1089407041 11:118206318-118206340 CTGGAAAAGGGGAAAGAGAAAGG - Intronic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1091053400 11:132395718-132395740 CTGGAAGAGAAGAGAGATGATGG + Intergenic
1091337223 11:134781514-134781536 GTGGAAAAGAGGAAAGAAGAGGG - Intergenic
1091359133 11:134960971-134960993 CTGGATAAGAAGAAACTGATAGG + Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092078553 12:5693672-5693694 CTGGAGAAGAAGGAAGGAGAGGG - Intronic
1092414954 12:8283533-8283555 ATGGGTAATAAGAAAAAGGATGG + Intergenic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1092919794 12:13221305-13221327 CTGGAAAATAAAAAAGAGCATGG - Intergenic
1093020340 12:14197639-14197661 CTGGAATAGAAGAATAAGGAGGG + Intergenic
1093175111 12:15904768-15904790 CTGGACGTAAAGAAAGAGGAAGG - Intergenic
1093240259 12:16661643-16661665 CTGGTTCTGAAGACAGAGGAAGG - Intergenic
1093622742 12:21311923-21311945 CTCAAAAAGAAGAAAGAAGAAGG + Intronic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1094118578 12:26944230-26944252 CTGGAAAAGAAGAAATAAAACGG - Intronic
1094400040 12:30052729-30052751 CTGGACAAGTAGTAAGATGATGG + Intergenic
1095734430 12:45541181-45541203 GGGAATAAGAAGAGAGAGGAGGG - Intergenic
1095969434 12:47891731-47891753 CTGGATGAGAAGGGACAGGAAGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096628568 12:52910705-52910727 CAGGAAAAGAACAAACAGGAAGG + Intronic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1097564258 12:61248717-61248739 GTGGAGGAGAAGGAAGAGGAGGG - Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1097707909 12:62887098-62887120 CTGGATGTGGAGAAAGAGGGAGG + Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098191672 12:67955674-67955696 ATGGATATAAAGGAAGAGGAAGG - Intergenic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1098498063 12:71159994-71160016 CTGCCTAGGAAGAAAGGGGAGGG - Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1099298625 12:80863141-80863163 TTTGATAGAAAGAAAGAGGAAGG + Intronic
1099464441 12:82965772-82965794 CTGGATCAGAACAAGGGGGAGGG - Intronic
1099601266 12:84741244-84741266 CTGAGAAAGAAGAAAGATGAAGG + Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1099734907 12:86554964-86554986 CTGGCTTTGAAGACAGAGGAGGG - Intronic
1099895803 12:88645109-88645131 GTGGGTAAGTAGAAACAGGAAGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100659355 12:96679870-96679892 CTGGACAAGAGGAAAGTGAAAGG - Intronic
1101195781 12:102380702-102380724 GTGGATGTGGAGAAAGAGGATGG + Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102810274 12:115818410-115818432 CTTGAGAAGAGGAGAGAGGAAGG - Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103895321 12:124269339-124269361 CTGGCTTTGAAGACAGAGGAAGG + Intronic
1104023363 12:125008612-125008634 CTGCATTAGAAAGAAGAGGAGGG - Intronic
1104071153 12:125346704-125346726 TTGGATCAAAAGATAGAGGAGGG - Intronic
1104374321 12:128250523-128250545 CAGGACAAGAAGGCAGAGGAAGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1106242224 13:27921117-27921139 CAGGATAGGAGTAAAGAGGAAGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106721937 13:32443856-32443878 CTGGATATAAAGAAAAAAGATGG - Exonic
1106885564 13:34181203-34181225 AAGGAAAAGAAGAAAGAGAAAGG - Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107275646 13:38675926-38675948 ATGGATATAAAGGAAGAGGAAGG + Intergenic
1107323621 13:39216008-39216030 CTGGCTTTGAAGAATGAGGAAGG - Intergenic
1107788367 13:43976801-43976823 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1108380908 13:49853260-49853282 CTGGATATAAAAATAGAGGATGG - Intergenic
1108507184 13:51123044-51123066 CTGGATAAGATCAAAGAAAACGG - Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1109199438 13:59414033-59414055 ATGGATATGAAGAAAGATCACGG + Intergenic
1109384491 13:61608924-61608946 AGGGATCAGAAGAAAGTGGAAGG - Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110150629 13:72248718-72248740 CAGAATAAGAGGAAAAAGGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111427371 13:88104523-88104545 GTTGATAAGAAAAAAGAGTATGG - Intergenic
1111482426 13:88848501-88848523 TTGGCTATGAAGAAAAAGGAAGG + Intergenic
1111741833 13:92214886-92214908 CTGGTTTTGAAGACAGAGGAAGG + Intronic
1111796466 13:92927085-92927107 TTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1112752869 13:102599456-102599478 ATGGATAGAAAGAAAAAGGAAGG + Intronic
1112982914 13:105408895-105408917 ATGGATCAGAAGAAAAAAGAGGG + Intergenic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1114895935 14:26991394-26991416 CTGGTTTTGAAGAAAGAAGAAGG - Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115292566 14:31789023-31789045 CTGGATAAGAATAAATATTAGGG + Intronic
1115388050 14:32820813-32820835 CTGAATAGGAACACAGAGGAAGG + Intronic
1115522109 14:34243294-34243316 CTGGTTACAAAAAAAGAGGAGGG + Intronic
1115875095 14:37852503-37852525 CGGCATAAGGAGAAAAAGGACGG + Intronic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116430457 14:44840041-44840063 CTGGCTAATATGAATGAGGAGGG + Intergenic
1117152270 14:52901617-52901639 CTGGCTTTGAAGATAGAGGAAGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117507976 14:56421637-56421659 CTGGCTGGGAAGACAGAGGAAGG - Intergenic
1117527526 14:56624731-56624753 CTGGCTATGGAGACAGAGGAGGG + Intronic
1118500882 14:66361597-66361619 GTGGATTAGGAGAGAGAGGAAGG - Intergenic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118807677 14:69251778-69251800 CTGAGGTAGAAGAAAGAGGAAGG + Intergenic
1118979104 14:70701716-70701738 GGGGGTGAGAAGAAAGAGGAAGG + Intergenic
1119810237 14:77511829-77511851 CTGGATGGGAAGTAAGTGGAAGG + Exonic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120219816 14:81719488-81719510 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
1120511784 14:85424278-85424300 GTGGATAATAAAATAGAGGAGGG - Intergenic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1121189528 14:92013584-92013606 ATGGAATAGAAAAAAGAGGAAGG + Intronic
1121319181 14:92981200-92981222 CTGGTCAGGAAGAAATAGGATGG - Intronic
1121546688 14:94768519-94768541 CCGGAGAAGAGGGAAGAGGAAGG - Exonic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1121926837 14:97934712-97934734 CTGACTTTGAAGAAAGAGGAAGG + Intronic
1122680148 14:103454036-103454058 CAGGTTTAGTAGAAAGAGGATGG + Intronic
1125035982 15:35123835-35123857 CTTGATAGAAATAAAGAGGAAGG - Intergenic
1125311483 15:38383532-38383554 CTGAATTAGAAGAAAGAAGTTGG + Intergenic
1125812233 15:42551267-42551289 CCTGATAAGAAGAAAAAGGCTGG - Intronic
1125998455 15:44186737-44186759 CTGGAAAAGGAGAAAAAGAAGGG - Intronic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126534788 15:49749656-49749678 TTGGATAGGAAGTAAAAGGAGGG - Intergenic
1126561249 15:50046607-50046629 ATGGCTAAGAAGTAAGAAGATGG - Intronic
1127007614 15:54588071-54588093 CTAGATAAGATGATAGAGAATGG + Intronic
1128050133 15:64656795-64656817 CTGGATCTAAAGAAAGAGGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129363199 15:75037443-75037465 GAGGATAAGAAGAAATGGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131737997 15:95354885-95354907 CTGAATAAGAAGACAGGGCAGGG + Intergenic
1132058896 15:98674421-98674443 CTGGAAAAGAAGTAACTGGAAGG - Intronic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1133931775 16:10238651-10238673 CTGGAAGAGAAGCCAGAGGATGG - Intergenic
1134345563 16:13388170-13388192 GTGGAACAGAAGAAAAAGGAAGG + Intergenic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1135973761 16:27091581-27091603 GAAGAAAAGAAGAAAGAGGATGG + Intergenic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1138154065 16:54686171-54686193 CTCAATAAAAAGAAAAAGGAAGG - Intergenic
1138639631 16:58374155-58374177 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1138649906 16:58453994-58454016 CTGGATTTGAAGATAGAGAAAGG - Intergenic
1138979972 16:62256215-62256237 CTGTATGAGAAGAAACGGGAAGG + Intergenic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139133425 16:64173585-64173607 CTGGAAAAAAAAAAAGAGGTTGG - Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139935187 16:70565338-70565360 CAGAATAAGAAGCAAGAGTAAGG - Intronic
1140024101 16:71267886-71267908 CTGCATAAGGAGAAAGTGTAAGG + Intergenic
1140462632 16:75152886-75152908 CTGGAATAGAGGAAAAAGGAAGG - Intronic
1140787062 16:78352480-78352502 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1140889594 16:79273618-79273640 CTGGCTTTGAAGACAGAGGAAGG - Intergenic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1141205047 16:81927059-81927081 CTGGATAAGAAGAGAGGACATGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141355172 16:83338803-83338825 CTGGATAATAAGGAAGAAGAGGG + Intronic
1141375415 16:83525869-83525891 CTGGCTTTGAAGACAGAGGAGGG + Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141604434 16:85144862-85144884 ATGGATTTGGAGAAAGAGGAAGG - Intergenic
1141978651 16:87535492-87535514 CTGGCTTGGAAGACAGAGGAGGG - Intergenic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1142923299 17:3210141-3210163 ATGGAAAAGAAAAAAGAAGACGG - Intergenic
1143080168 17:4375764-4375786 CTGGAGTAGAAGGAAGAGAAGGG + Intergenic
1143080420 17:4377313-4377335 CTGGAGTAGAAGGAAGAGAAGGG - Intergenic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1145093102 17:20001951-20001973 CTTGAAAATAAGAAAGAGGCCGG - Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1145864465 17:28231737-28231759 ATGGGTAATAAGAAAAAGGACGG + Intergenic
1145979387 17:29002861-29002883 CTGGAGGAGAAAAGAGAGGAAGG - Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146955233 17:36933397-36933419 CTGGAACCGAAGAGAGAGGAGGG + Intergenic
1148403964 17:47395031-47395053 ATGGATTAGGAGAAAGCGGAGGG - Intronic
1148647216 17:49225922-49225944 CTGGACAGGAAGACAGAGTAGGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148972777 17:51498815-51498837 CTTAATAAGAAGGAAGAGGGAGG - Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149173950 17:53846771-53846793 CTGGCTTTGAAGAAAGAGGAAGG - Intergenic
1149367400 17:55959620-55959642 CTGGTTCAGAAGAAACAGAAAGG + Intergenic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1149749047 17:59127914-59127936 CTGGATAAGAAAATGGAGTATGG + Intronic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1150977233 17:70102184-70102206 GTGAACAAGAAGAAAGAAGAAGG - Intronic
1150988729 17:70230265-70230287 CTGGATACGAACAGAGAAGAGGG + Intergenic
1151388187 17:73768147-73768169 CTGCATAAGAGGAAAGGGCAAGG + Intergenic
1151986264 17:77545926-77545948 CTGGCTTTGAAGACAGAGGAAGG + Intergenic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1154382682 18:13866927-13866949 CTGGATAATTAGAAAGATGGTGG - Intergenic
1154495847 18:14960269-14960291 CTGGATAAGAAGAAACTGATAGG - Intergenic
1155015838 18:21838408-21838430 GTGGATGAGAAGAAAGATGATGG + Exonic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155815345 18:30300966-30300988 CTGGTTAAGAAAAGAGAGAAGGG - Intergenic
1155815815 18:30307962-30307984 CTGGAGAAAAAGGAAGAGGTGGG + Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156242732 18:35268994-35269016 CTGAATAGGAGGAAAGTGGAGGG + Intronic
1156368509 18:36451604-36451626 CCGGAGGAGAAGGAAGAGGAGGG - Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157316520 18:46594387-46594409 CTGGATGAGAAGAAAGCGGATGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158087506 18:53670042-53670064 GAGGAAAAGAAGAAAAAGGAGGG - Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158322965 18:56283333-56283355 GTGGATGAGATGGAAGAGGAAGG + Intergenic
1159902439 18:74060222-74060244 CTGGAGAAAAAGAAAGAGCTGGG - Intergenic
1159967738 18:74612278-74612300 CTGTATAAGAAGGAAGGTGATGG + Intronic
1160843840 19:1158071-1158093 CAGGCTCAGAAGAAAGAGGCGGG - Intronic
1161836504 19:6650907-6650929 CTGGCTTTGAAGACAGAGGAAGG + Intergenic
1161934545 19:7363608-7363630 ATGGATGAAAGGAAAGAGGATGG + Intronic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1162940580 19:14006552-14006574 CTGGTTAAGAATAAAGGGGTAGG + Intronic
1163049483 19:14671387-14671409 CTGGATTTAAAGAAGGAGGAAGG - Intronic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163662580 19:18587657-18587679 ATGGACAAAAAGAAAGGGGAGGG + Intronic
1164220575 19:23189570-23189592 CTTGATAAAAATAAAGAGGATGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925987927 2:9231080-9231102 TGGCATAAGAAGAAAAAGGAAGG - Intronic
926574461 2:14564705-14564727 CTCAAGAAGAAGAAACAGGAGGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
928455893 2:31421319-31421341 CTGGTTGAAAAGAAAAAGGACGG - Intergenic
928633314 2:33216329-33216351 CTGGGAAAGAAAAAAGGGGAGGG + Intronic
928635616 2:33242969-33242991 CTGGAAAAGAAGATTCAGGAAGG - Intronic
929073469 2:38057792-38057814 CTGGATCAGAAGGAAGAGGGAGG - Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929273529 2:40000394-40000416 CTGAATAAGATAAACGAGGAAGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929564509 2:42976125-42976147 CAGGAAAAGAAAAAAAAGGAAGG + Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
930597319 2:53404284-53404306 CTAGATTACAAGAAAAAGGAGGG + Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931117832 2:59183700-59183722 CTAGAAAAAAAGAAAAAGGATGG + Intergenic
931316482 2:61137441-61137463 CTGGATAGGAAGAAAAAGGGTGG - Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
931756053 2:65375565-65375587 CTGGCTAAGACGAAACAGTAGGG + Intronic
932592729 2:73076764-73076786 TTGGGTGAGAAGAAAGGGGAAGG - Intronic
932649209 2:73537397-73537419 CTGTACAAGAAGAAAAGGGAAGG + Intronic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
933005646 2:76990469-76990491 ATGGAAAACAAGAAAGAGCAGGG + Intronic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933664738 2:84955872-84955894 ATGGATAAGAAGTAACAGGCTGG + Intergenic
933843198 2:86304335-86304357 CTGGATAAGGGGAAAGACTACGG + Intronic
934537804 2:95150722-95150744 TTGGAAAAGAAGAAAGTGAAGGG - Intronic
935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG + Intergenic
935583628 2:104781805-104781827 ATTGAAAAGAAGAAAGAGGTTGG + Intergenic
936451373 2:112636217-112636239 ATGGGTAGGAAGAAAAAGGAAGG + Intergenic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937487059 2:122326272-122326294 CTGGAGGAAAAGAAAGGGGAAGG + Intergenic
938600903 2:132838066-132838088 GTGAATAAGTTGAAAGAGGAGGG - Intronic
940084683 2:149845670-149845692 CTGGATAAGTAGTAATAGGTTGG - Intergenic
940092845 2:149940818-149940840 AAGGAAGAGAAGAAAGAGGAAGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940591372 2:155732128-155732150 CTGGATCTCAAGAAAAAGGAAGG + Intergenic
940669861 2:156654081-156654103 CTGGAAGGCAAGAAAGAGGAAGG - Intergenic
940712967 2:157184540-157184562 ATGGATAAGGAGAAACAGCAAGG - Intergenic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
940964949 2:159826656-159826678 CTGGACAAGAAGAACAAAGATGG + Intronic
941012988 2:160322434-160322456 AGGGATAACAAGACAGAGGATGG + Intronic
941046519 2:160682340-160682362 CAGGAAAAGAACAAACAGGATGG - Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942149597 2:173061988-173062010 CAGGATATGAAGAGAAAGGAAGG - Intergenic
942330736 2:174821299-174821321 CTGGCTTTGAAGACAGAGGAAGG - Intronic
942421319 2:175811034-175811056 CTGGTTTTGAAGAAAGAGAAAGG - Intergenic
942469832 2:176248655-176248677 CTGGCTTAGAATAAAGAGTAAGG + Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942898421 2:181086154-181086176 TTGGATAAGAAGTATGAAGAAGG + Intergenic
943388394 2:187230628-187230650 CTAGATAAGAGGAAAGAGGAAGG + Intergenic
944157478 2:196622457-196622479 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944548861 2:200826721-200826743 CTGGATAAGATGACAAAGCAAGG - Intergenic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945221140 2:207485481-207485503 CTGGAAAGGAAGGTAGAGGAAGG + Intergenic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
946173527 2:217909148-217909170 CTGGAAAAGAAGGGAGAGGCTGG - Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
947169219 2:227294467-227294489 CTGGAAATGAAGAGAGGGGAAGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947544794 2:231003061-231003083 CTGGACAAGAGGAAATGGGAGGG + Intronic
947557578 2:231109770-231109792 CTGGATAATAAGAAAAAAGCAGG - Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948121030 2:235530584-235530606 CTGGTTTTGAAGACAGAGGAAGG - Intronic
1169892338 20:10466665-10466687 ATGGGTGGGAAGAAAGAGGAGGG - Intronic
1169921837 20:10742751-10742773 CTGAAAAAGAAAAAAGAGAATGG - Intergenic
1169958019 20:11127372-11127394 GTGGATAAGAAGTAAGAGAAGGG - Intergenic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170412914 20:16109673-16109695 TTGGAAAGAAAGAAAGAGGAGGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171341048 20:24430084-24430106 CCAGAGAACAAGAAAGAGGATGG + Intergenic
1171538830 20:25926789-25926811 CTGGATTTGAAAATAGAGGAAGG + Intergenic
1172898490 20:38316996-38317018 GGGGATAGGAAGAAAGTGGAAGG + Intronic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1174541681 20:51294647-51294669 CAGGGTTGGAAGAAAGAGGAAGG - Intergenic
1174559418 20:51419425-51419447 CTGGATGGGAAAAAAGAGGAAGG - Intronic
1174664560 20:52245844-52245866 CTGGGTAGGAAAAATGAGGATGG + Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175294484 20:57899014-57899036 CTGGATTTGGAGATAGAGGAGGG - Intergenic
1177558540 21:22721039-22721061 CTGGGTTAGAAGAATAAGGATGG + Intergenic
1177608599 21:23415971-23415993 CTGGAGAGGAAGGAATAGGAAGG + Intergenic
1178120652 21:29466851-29466873 AGGGTTAAGAAGAAAGAGAAAGG - Intronic
1178229235 21:30762050-30762072 TTGGACATGATGAAAGAGGAAGG - Intergenic
1178352833 21:31885156-31885178 GTGGTTGAGAAGAAAGAGAAAGG + Intronic
1178597081 21:33963863-33963885 CAGCATAAAATGAAAGAGGAGGG - Intergenic
1179462018 21:41542566-41542588 CTGGCTTTGAGGAAAGAGGATGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180674574 22:17578410-17578432 TTGGGTAAGAAAAGAGAGGAGGG - Intronic
1181504906 22:23346970-23346992 CCTGATAAGAAGAAAGACTACGG - Intergenic
1181709894 22:24677217-24677239 CCTGATAAGAAGAAAGACTACGG - Intergenic
1182973911 22:34604435-34604457 CAGGAAATGAAGAAAGAAGATGG + Intergenic
1182990068 22:34759182-34759204 ATGGATAGGAAGAAAGTGGAAGG + Intergenic
1183321834 22:37169695-37169717 CGGGATAAGAAGGCAAAGGAAGG - Intronic
1183670809 22:39271389-39271411 CTGGCTTTGAAGACAGAGGAAGG - Intergenic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184763081 22:46556338-46556360 CAGGAAAAAAAGAAAAAGGAAGG + Intergenic
1184932415 22:47691180-47691202 CTGCATGAGAACAAAGTGGATGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
949396108 3:3616076-3616098 CTAGATGTGGAGAAAGAGGAGGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950110599 3:10416375-10416397 TTGGCTAAAAAGAGAGAGGAAGG - Intronic
950162578 3:10771473-10771495 CTGGATAAGAAGACTGAAGCTGG - Intergenic
950419781 3:12892090-12892112 CTGGAAGAGAAGGAAGAGAAAGG - Intergenic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
951185352 3:19706206-19706228 CTAGTTAAGGAGGAAGAGGAAGG + Intergenic
951249083 3:20373174-20373196 TTGGATAGGAGGAAAGAGAAGGG + Intergenic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
952001698 3:28793452-28793474 TAAGATAAGAAGAAAGAGGTAGG + Intergenic
952355301 3:32578516-32578538 CTAGGTGAGAAGCAAGAGGAAGG - Intergenic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953373695 3:42410994-42411016 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
953746788 3:45580637-45580659 CTGGATCTCAAGAAAGAGGTAGG + Intronic
953824510 3:46239184-46239206 TTGGAGAAAAACAAAGAGGACGG - Intronic
953977179 3:47390646-47390668 CTAAAAAAGAAGAAAGAGGCTGG - Intronic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
955072090 3:55580402-55580424 CTGGAAGAAAAGACAGAGGATGG + Intronic
955513540 3:59705230-59705252 CTGTATAAGAAGAAAAAGTGTGG + Intergenic
955755413 3:62220528-62220550 CTGGAACAGAAGAATAAGGAAGG + Intronic
956030079 3:65028085-65028107 CTGAGTAAAAAGAAAGAGAAAGG + Intergenic
956524731 3:70145073-70145095 CTGGGTAAGAATGAAGAAGAAGG - Intergenic
956551485 3:70465167-70465189 CTGGAAAATATGAAAGGGGAAGG + Intergenic
957640781 3:82850403-82850425 AGGGATAAGAAGAAAGAAGAAGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
957879008 3:86185778-86185800 ATGGAAAACAAAAAAGAGGAGGG + Intergenic
958644712 3:96855082-96855104 CTGGCTCTGAAGAGAGAGGAAGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
959698416 3:109274463-109274485 CTGGATAAGAGGAGAGGGCAAGG + Intergenic
959718461 3:109459860-109459882 CTGGAAGAGAATAAAAAGGATGG - Intergenic
959848708 3:111063420-111063442 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960556827 3:119039361-119039383 CTGGATTTGAAGATAGAAGAAGG - Intronic
961493900 3:127276627-127276649 CTGGAAGAGAGGACAGAGGAGGG - Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961892503 3:130142144-130142166 ATGGGTAATAAGAAAAAGGATGG + Intergenic
962911435 3:139855121-139855143 GAGGATAGGAAGAAAGAGAAAGG - Intergenic
963314609 3:143745929-143745951 CTGGATGAAAAGAAAGAGACAGG + Intronic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
964804742 3:160596348-160596370 CAGGATAGGAACAATGAGGAAGG + Intergenic
965186155 3:165467040-165467062 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965501473 3:169460993-169461015 CTGGCTGAGAAGGAACAGGAAGG - Intronic
965809106 3:172574341-172574363 CTGGACCAGATGAGAGAGGATGG + Intergenic
966236101 3:177703499-177703521 GTGGAAAAGAAGAAAGGAGAAGG + Intergenic
966430409 3:179826245-179826267 CTGGGTAAGGAGGAAGAGAAAGG - Intronic
966921934 3:184617991-184618013 CCAAATAAGAGGAAAGAGGAAGG - Intronic
967227068 3:187302210-187302232 CTGGATAAGAATGAAGAAGAGGG - Intergenic
967644399 3:191903772-191903794 CAAGTGAAGAAGAAAGAGGAAGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968121190 3:196127335-196127357 CTGGCTAAGAGTAAACAGGATGG + Intergenic
968144815 3:196289123-196289145 GTGGCTGAGAAGAAAGAGGATGG + Intronic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968477743 4:820392-820414 CTGGGCAAGAAGAGAGAGGCAGG + Intronic
968539749 4:1159836-1159858 CGGGAAAAGACGAAAGAGAATGG - Intergenic
969067824 4:4502782-4502804 CTGCATAGGAAGACAGATGAAGG - Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969600840 4:8175398-8175420 CTGGATAAGAAAACACAGGAAGG - Intergenic
969750263 4:9104998-9105020 ATGGGTAATAAGAAAAAGGACGG - Intergenic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970120124 4:12744245-12744267 GTGGATGTGAAGAAAGAGGTGGG + Intergenic
970450177 4:16158447-16158469 ATGGATAAGAAGGGAGAGGAAGG - Intergenic
970656803 4:18240227-18240249 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
970737548 4:19192298-19192320 AAGGATAAAAAGAAAGTGGAAGG - Intergenic
970833737 4:20374583-20374605 AGGGATAAGAAGAAAGTTGAAGG - Intronic
970910138 4:21265272-21265294 TTGCATAAGAAGTGAGAGGATGG + Intronic
971285274 4:25283091-25283113 CTGGACAAGAAGAACGAAGTTGG + Intergenic
971443176 4:26712403-26712425 CTGGCTTTGAAGACAGAGGAAGG - Intronic
971984607 4:33805958-33805980 CTGGCTTTGAAGACAGAGGAAGG - Intergenic
972019275 4:34288981-34289003 TTTCATTAGAAGAAAGAGGAAGG + Intergenic
972163326 4:36252121-36252143 CTAGATGAGGAGAAAGAGTAGGG + Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973370247 4:49240206-49240228 CTGGAAAATAAGAACGGGGAGGG - Intergenic
973390782 4:49555214-49555236 CTGGAAAATAAGAACGGGGAGGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975366335 4:73533281-73533303 ATGGTTTAGAAGAAAGAAGAGGG - Intergenic
975465076 4:74699556-74699578 CTAGGCAAGAAGAAAAAGGAAGG - Intergenic
975524979 4:75339181-75339203 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
975631437 4:76407815-76407837 AGAGAAAAGAAGAAAGAGGAAGG + Intronic
975794712 4:77994964-77994986 GTGGAAGAGAAGAAAGGGGAAGG + Intergenic
976068772 4:81218307-81218329 CTGGAAAAAAAAAAAGTGGAGGG + Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976965074 4:91027984-91028006 ATGGAAAAGAAAAAAGAAGAGGG + Intronic
977071608 4:92396722-92396744 CTGGATGATAATAAAGAGTAAGG - Intronic
977116026 4:93030236-93030258 CGGGAGAAAAGGAAAGAGGAAGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
978157658 4:105508439-105508461 CTGGATAAGAGGACATATGATGG - Intergenic
978174598 4:105714440-105714462 CTAGAAAAGAAAAAAGAGGAAGG + Intronic
978911612 4:114070315-114070337 CTGGGTAATAATAAAGAAGAAGG + Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
979715457 4:123832204-123832226 TGGGAAAAGAAGAAAGAGGCAGG - Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980411724 4:132428785-132428807 ATGGAAAACAAGAAAGAGCAGGG - Intergenic
980740009 4:136938293-136938315 CTGGGTAAGTGGAAAGAGAAGGG + Intergenic
980767850 4:137331503-137331525 CAGTATAAGAAGAAACAGGCAGG - Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981320832 4:143389212-143389234 TTGGTTAAAAAGACAGAGGAAGG - Intronic
982113574 4:152078032-152078054 CTGGTAAAGAAGAAAAAGAAAGG - Intergenic
982463930 4:155706515-155706537 CTGAAAAAAAAAAAAGAGGAGGG - Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983139514 4:164132190-164132212 CGTGAAACGAAGAAAGAGGAAGG - Intronic
983975533 4:173929202-173929224 CTGCATAAGGAGAAAGAAGGTGG - Intergenic
984208006 4:176809907-176809929 CTGGAAAGGAGGAAAGTGGATGG - Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
984799402 4:183699767-183699789 CTGGTTTTGAAGACAGAGGAAGG - Intronic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985733020 5:1561470-1561492 TTGGATAATAAGAATGTGGAGGG + Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
986141839 5:5038359-5038381 CTGAGTAAGACGATAGAGGAAGG + Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986664646 5:10090193-10090215 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
986818215 5:11436006-11436028 CTGGAATAGGAGAAAGACGACGG + Intronic
986898588 5:12402874-12402896 CAGGAGGAGAAGAAAGAGAATGG - Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987169357 5:15238169-15238191 GTGGATAAGAGGAAAGAGACTGG - Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988269783 5:28999046-28999068 CTTGATAAAAAAAAAGTGGATGG - Intergenic
988468339 5:31512755-31512777 CTGGCTTCGAAGACAGAGGAAGG + Intronic
988626333 5:32879199-32879221 GAGGATAAGGAGAAATAGGAAGG + Intergenic
988839268 5:35067057-35067079 GAGGATAAGAAAAAAGAGGCCGG - Intronic
988991845 5:36679294-36679316 CTGGCTAGGAAGACAGAGGTGGG + Intronic
989126699 5:38060638-38060660 CTGGATTTGAAGAAAGAAAAGGG - Intergenic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989181008 5:38577170-38577192 CAGGATGAGAAGAAAGGAGAGGG - Intronic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989705707 5:44327813-44327835 CTGGTGATGATGAAAGAGGAAGG - Intronic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
990748894 5:58990384-58990406 ATGGATATGAAGAAAGAAGCAGG + Intronic
990853576 5:60236755-60236777 CTGGATTTGAAGACAGAGGAAGG + Intronic
990865339 5:60373821-60373843 CTGGCTTTGAAGACAGAGGAAGG - Intronic
991007955 5:61849503-61849525 CAGGCTAAGAAAAAAGAGAAAGG + Intergenic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
991272286 5:64798355-64798377 CAGGACAAGAAGAAAGATGGTGG - Intronic
991479465 5:67061704-67061726 CTTGTTAAGCAGAAAGAGGGAGG - Intronic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
992673879 5:79085912-79085934 CAAAGTAAGAAGAAAGAGGATGG + Intronic
992963645 5:81980124-81980146 CTGGATAAGAAAAAACTGGAAGG - Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG + Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
995504071 5:112840606-112840628 CTGGAGAAGGAGTTAGAGGAGGG + Exonic
995760088 5:115553480-115553502 CTAGATAAGAAGAGAAAGGTTGG + Intergenic
996255041 5:121389671-121389693 GTGGATAAGAAGTGAGAAGATGG + Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996629701 5:125612682-125612704 CTAGAGAACAGGAAAGAGGAAGG + Intergenic
996852805 5:127971521-127971543 TTTAATAAGAAGAAAGAGAAAGG - Intergenic
997362207 5:133302318-133302340 CTTGATAAGCAGGAAGAGAAAGG - Intronic
997690655 5:135825633-135825655 CTGGGTATGAAGGAACAGGAAGG - Intergenic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
997813022 5:136990547-136990569 CTGGAAAAAAAAAAAGAGGGGGG - Intronic
997897468 5:137732558-137732580 TTAGATAAGAAGCAAGATGACGG + Intronic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998982786 5:147722858-147722880 AGGGATAAAAAAAAAGAGGATGG - Intronic
999820142 5:155219322-155219344 CTGGAACAGAAGCAAGATGATGG - Intergenic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000268468 5:159660051-159660073 CTGGATGAGATGGAAGAGGAGGG + Intergenic
1000420881 5:161036640-161036662 CTAGATATGAGGAAAGAGGGCGG - Intergenic
1000440779 5:161260582-161260604 AAAGATAAGAAGTAAGAGGAAGG + Intergenic
1000686760 5:164259379-164259401 CTGGTTGAGAAGATAGAGGCTGG - Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001776150 5:174330599-174330621 AGAAATAAGAAGAAAGAGGACGG + Intergenic
1002041984 5:176521241-176521263 CTGGAGAAGACGGGAGAGGAGGG + Intergenic
1002260007 5:177986459-177986481 CTGGATAAGAGGAAACTGTAGGG + Intergenic
1002719125 5:181247148-181247170 CTGGATGAGAAGGAAGAGGCCGG - Intronic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1004989325 6:21119143-21119165 CTCAACAGGAAGAAAGAGGAAGG - Intronic
1005214084 6:23504632-23504654 CTGGAGAAGAAGTAAGTGTACGG - Intergenic
1005423881 6:25680876-25680898 CTGGATTTGGAGACAGAGGAAGG + Intronic
1005440117 6:25858290-25858312 AAGAATAAGAAGAAAGAGAATGG - Intronic
1005811199 6:29517756-29517778 CTGGATATGCAGACATAGGAAGG - Intergenic
1006361173 6:33588236-33588258 GGGGATGAGAAGAAGGAGGAGGG - Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006517642 6:34553665-34553687 CTGGAGAAGAGGAAAGAGAGAGG + Intronic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1006881373 6:37342913-37342935 CTGGAATAGAAGTAAAAGGATGG - Intergenic
1007372777 6:41437592-41437614 TTGGCTATGAAGAAAGATGATGG + Intergenic
1007487436 6:42191256-42191278 CTGGAATGGAAGAAAGGGGAGGG - Intronic
1008125082 6:47659018-47659040 TTGGACAAGAAGAAAGAGATGGG - Exonic
1008479294 6:51968383-51968405 CAGGAAAAGAAGAAAAGGGAGGG - Intronic
1010231076 6:73535936-73535958 CTAGAAAAGAAGAAAGACCAAGG - Intergenic
1010275584 6:73965192-73965214 TTGCATGAGAAGAAACAGGATGG + Intergenic
1010715277 6:79221799-79221821 ATGGAAGACAAGAAAGAGGAGGG + Intronic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1011239375 6:85255072-85255094 CTGCAAAAGAATAAAGATGAGGG - Intergenic
1011304582 6:85911861-85911883 CTGTATAATAAAAAAGAAGAGGG + Intergenic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1012279585 6:97312927-97312949 CTGGATTTGAAGACAGAGGGAGG + Intergenic
1012382636 6:98638662-98638684 CAGGAAAAGAAGAACCAGGAGGG - Intergenic
1012833828 6:104240178-104240200 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1013150279 6:107439123-107439145 CTGTACAGGAAGAAAGTGGAGGG - Intronic
1013587951 6:111596146-111596168 CTGGATAAGAAGGTAAAGCAGGG - Intronic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1013951479 6:115787628-115787650 CTGGATAAGCATACAGAGTAAGG + Intergenic
1014351355 6:120350049-120350071 CTGGATGAAGAGCAAGAGGAGGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1014883765 6:126754951-126754973 CTGAACAAGAGGAAAGAGAATGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015497180 6:133893981-133894003 CTCTGTAAGATGAAAGAGGAAGG - Exonic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1015559391 6:134498123-134498145 GGAGAGAAGAAGAAAGAGGAAGG - Intergenic
1016363557 6:143292445-143292467 CTGGCTTTGAAGACAGAGGAAGG + Intronic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018415567 6:163599624-163599646 CTTGCTAAGAAAAAAAAGGAGGG + Intergenic
1018517817 6:164606209-164606231 CTGGATTAGAAGATGAAGGAAGG + Intergenic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1018779140 6:167046293-167046315 CTAGAAAGAAAGAAAGAGGAAGG + Exonic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019034672 6:169044393-169044415 CTGTATTAGAAGAAAAAGAAAGG + Intergenic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020322714 7:6951647-6951669 ATGGGTAATAAGAAAAAGGACGG + Intergenic
1020425203 7:8057717-8057739 CAGATTAAGAAGAAAAAGGAAGG - Intronic
1021118572 7:16771580-16771602 CTGGCTTTGAAGACAGAGGAAGG + Intronic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021763261 7:23921862-23921884 GTGGATAGGGAGAAAGTGGAGGG + Intergenic
1021826766 7:24561237-24561259 CTGGATGTGAGGAATGAGGAAGG - Intergenic
1021938676 7:25656775-25656797 CTGCATAAGAGGAAACACGAGGG - Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022176044 7:27872861-27872883 CTGCATAAAAAGATAGGGGATGG + Intronic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1023035270 7:36126258-36126280 CTGGATAAGAGGAAATAGCAAGG - Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023981248 7:45071731-45071753 CTGGCTGTGAAGACAGAGGAAGG - Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024740736 7:52351617-52351639 CTAGATGGGAAGAAATAGGAAGG + Intergenic
1025273100 7:57544130-57544152 CTAGATAATAAGAAAGAAGCAGG + Intergenic
1026159053 7:67852801-67852823 CAGGAAAAGAAGGAAGAAGAGGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026886306 7:73949414-73949436 CAGGAGAAGAAGAAAGCAGAAGG - Intergenic
1026900936 7:74037133-74037155 GAGGATAAAAAGAAATAGGAAGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1028490567 7:91406874-91406896 CTGGCTGAGAAGAAAGATGCTGG - Intergenic
1028524961 7:91773787-91773809 ATGGATACTAAGAAAAAGGAAGG - Intronic
1028829361 7:95310607-95310629 CCAGATAAGAAAGAAGAGGAAGG + Intronic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1029411327 7:100413271-100413293 CTGGATAACTGGAAAGAGGGAGG - Intronic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1030529808 7:110698530-110698552 CTAGAAAGGATGAAAGAGGAAGG - Intronic
1030690025 7:112522812-112522834 ATGCATAAGAAGCAAGAGGTTGG - Intergenic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031744936 7:125483636-125483658 GTGTGTAAGAAGACAGAGGAGGG + Intergenic
1032119457 7:129145450-129145472 CTGGCAAAGAAAGAAGAGGAAGG + Intronic
1032205254 7:129858656-129858678 CTGGGTAACAAGAAAAATGAAGG + Intronic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1032696700 7:134342951-134342973 TTGATTAAGAAGAAAGAAGAAGG - Intergenic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034542654 7:151768871-151768893 CAGGATGGGAAGAAAGAGCAAGG - Intronic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035976520 8:4318338-4318360 GTGCATAAAAAGAGAGAGGAGGG - Intronic
1036273323 8:7327793-7327815 GAGGCTGAGAAGAAAGAGGAAGG + Intergenic
1036278134 8:7374528-7374550 CTGGAGAAGAAAACACAGGATGG + Intronic
1036343388 8:7937363-7937385 CTGGAGAAGAAAACACAGGATGG - Intronic
1036348026 8:7982559-7982581 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036373341 8:8179332-8179354 ATGGGTAATAAGAAAAAGGACGG - Intergenic
1036838727 8:12098125-12098147 CTGGAGAAGAAAACACAGGATGG - Intergenic
1036843321 8:12143035-12143057 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036860515 8:12344369-12344391 CTGGAGAAGAAAACACAGGATGG - Intergenic
1036864685 8:12385350-12385372 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036877567 8:12486309-12486331 ATGGGTAATAAGAAAAAGGACGG + Intergenic
1036956472 8:13193059-13193081 TTGGATAGGAACAGAGAGGAGGG - Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1038306051 8:26403348-26403370 CTGAATAAGAAGAAAGTTTAGGG + Intronic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1038679332 8:29652425-29652447 GAGGAAGAGAAGAAAGAGGAAGG + Intergenic
1038680677 8:29664236-29664258 CTGGATACGAAGACTCAGGATGG - Intergenic
1038972894 8:32657357-32657379 CTGGAGAAGAAGGAATAGGTGGG - Intronic
1039053128 8:33512769-33512791 CGGGATAAGAATAAAGAGAAAGG + Intronic
1039140933 8:34387266-34387288 GTGGAGAAGAACAAAGATGAAGG + Intergenic
1040704576 8:50110253-50110275 CTAGATATGAGGAGAGAGGAGGG - Intronic
1040776077 8:51044674-51044696 CTGGATGATGAGATAGAGGATGG - Intergenic
1041119784 8:54574449-54574471 TTGGGTAAGAAGAAAGGGGGTGG + Intergenic
1041406243 8:57502313-57502335 AAGGCTTAGAAGAAAGAGGAAGG - Intergenic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1041706163 8:60848492-60848514 CTGGAGAGGAAGACAGAGGGGGG - Intronic
1041978652 8:63829525-63829547 CTGGATATGAGCAAAGAGGAGGG - Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042711766 8:71725396-71725418 TGGGATAATAAGGAAGAGGAAGG + Intergenic
1042745182 8:72099451-72099473 CTGGGCAACAAGAAAGAGGGAGG - Intronic
1042788724 8:72579813-72579835 CAGAATAAGAAGATAGAGTAAGG - Intronic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043360275 8:79464073-79464095 TTTGAGAACAAGAAAGAGGATGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044252566 8:90021342-90021364 CTAGATGTGGAGAAAGAGGAGGG + Intronic
1044262575 8:90144425-90144447 GTGGATAACAGGAAATAGGAGGG - Intergenic
1044465121 8:92493537-92493559 CTGGAGGAGAAGAAAGACAATGG + Intergenic
1044725894 8:95193914-95193936 CTGGCTTAGAAGATAGAGAAGGG + Intergenic
1044750717 8:95412877-95412899 TTAAATGAGAAGAAAGAGGAGGG - Intergenic
1045366593 8:101482121-101482143 ATGGATAAAAAGGAAGTGGAGGG - Intergenic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046999294 8:120557500-120557522 CTGGGTAAGAAGATAGATGTTGG + Intronic
1047035462 8:120933624-120933646 TAGGATAAGAAGGAAGAAGAGGG + Intergenic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1047990130 8:130277353-130277375 CTGGATATGAAGAACTAGTATGG - Intronic
1048555808 8:135474969-135474991 CTGGCTATGAAGTCAGAGGAAGG - Intronic
1049009029 8:139875154-139875176 CGGGGGAAGAAGAGAGAGGAGGG + Intronic
1050260507 9:3836515-3836537 CTGGAAAAGAAGAAATCTGAAGG - Intronic
1050452509 9:5798153-5798175 CTGGATGAGAAGAAATAGGATGG - Intronic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1050945783 9:11515336-11515358 CTGGAGCAGAAGGAAGTGGAAGG - Intergenic
1051001983 9:12293284-12293306 CTGGAAAAGAAAAGAGTGGAGGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1053049841 9:34951511-34951533 CTGGCTTTGAAGACAGAGGAAGG + Intergenic
1053102667 9:35384140-35384162 CTGGATGAGTAGAAAGAGTCGGG - Intronic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054870839 9:70045836-70045858 CTAGTTAGGAAGAAACAGGAAGG + Intronic
1055194145 9:73566338-73566360 ATGGAAAAGAAGAGATAGGAAGG - Intergenic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055567964 9:77587981-77588003 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1055729308 9:79264316-79264338 CTGGAAAAGGAGAGAGAGAAAGG - Intergenic
1056282763 9:85058119-85058141 CTGGAAAAAAAGAAAGGGGCAGG + Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058182076 9:101810306-101810328 CTGGAGAAGAAGGAAGAGAGAGG - Intergenic
1058379981 9:104367072-104367094 AGGGATAAGGAAAAAGAGGAGGG - Intergenic
1059048800 9:110900276-110900298 TTGGCTTTGAAGAAAGAGGAAGG - Intronic
1059103838 9:111494500-111494522 TAGGATGAGAAGAAAGAGCATGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059510184 9:114837897-114837919 TTGGTGAAGAAGAAAGATGAGGG - Intergenic
1059520770 9:114939788-114939810 TTGGAGTAGAAGAAAGTGGAAGG - Intergenic
1059530924 9:115035013-115035035 CTGGTTAAAATGAAAGAGGCTGG + Intronic
1059757629 9:117308638-117308660 CTGGATAAGAAGAGAAAGTTTGG + Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061755759 9:132811421-132811443 CTGGCTTTGAAGACAGAGGAAGG + Intronic
1185433228 X:21449-21471 CTGGATCAGAACCAAGTGGAGGG - Intergenic
1185442430 X:233517-233539 CTGGATCAGAACCAAGTGGAGGG - Intergenic
1185661981 X:1735376-1735398 CAGGATAAGAAGAAAGGAGGAGG - Intergenic
1185856005 X:3535906-3535928 CTGGTTTTGAAGACAGAGGAAGG - Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186202518 X:7168737-7168759 CTGGGTAAGGACAGAGAGGAAGG - Intergenic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1186938441 X:14476896-14476918 TTGGCTGTGAAGAAAGAGGAAGG + Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1187631619 X:21179175-21179197 AAGCATAAGAAGAAATAGGAAGG - Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1189234400 X:39476415-39476437 CTGGAGAGGAAGAAAAAGAAGGG + Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1190299081 X:49045741-49045763 TTACAAAAGAAGAAAGAGGAGGG + Intergenic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1190906611 X:54735293-54735315 ATGGAAAACAAGAAAAAGGAAGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1192140651 X:68644928-68644950 CAGGACAAGACGAGAGAGGAAGG + Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1193407801 X:81123551-81123573 AAGGATAAGAAGAAAAATGAAGG + Intronic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1196758098 X:119175803-119175825 CAGGACAAGAAGGGAGAGGAGGG - Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198377341 X:136052871-136052893 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1198391806 X:136182798-136182820 ATGTATAAGAACAAAGAGGCTGG + Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198743682 X:139867685-139867707 CAGGCTAAGAAGTAAGAGGGAGG + Intronic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic
1199034964 X:143039466-143039488 CCATATAAGAAGAAAGAGAAAGG - Intergenic
1199073939 X:143509520-143509542 CTGGAGAAGATGAAAGAATAAGG - Intronic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1199902961 X:152195615-152195637 TCGGATTTGAAGAAAGAGGAAGG - Intronic
1199907737 X:152251565-152251587 ATGGAAGAGAAGCAAGAGGAAGG - Intronic
1200103674 X:153700935-153700957 ATGGACAAGAAGGAAGAGTAAGG - Exonic
1200628170 Y:5548174-5548196 ATGGATAAGAACAAAGATCACGG + Intronic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1202333511 Y:23780536-23780558 TTTGATAAGATGAAAGAAGAAGG - Intergenic
1202537258 Y:25889527-25889549 TTTGATAAGATGAAAGAAGAAGG + Intergenic