ID: 949893679

View in Genome Browser
Species Human (GRCh38)
Location 3:8753147-8753169
Sequence CTGGATCTACATGCTGTTCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949893679_949893685 2 Left 949893679 3:8753147-8753169 CCGTGAACAGCATGTAGATCCAG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 949893685 3:8753172-8753194 GTTGCAGCAGCTGTTGAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
949893679_949893686 7 Left 949893679 3:8753147-8753169 CCGTGAACAGCATGTAGATCCAG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 949893686 3:8753177-8753199 AGCAGCTGTTGAGGCTGGCCAGG 0: 1
1: 0
2: 2
3: 48
4: 442
949893679_949893684 -2 Left 949893679 3:8753147-8753169 CCGTGAACAGCATGTAGATCCAG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 949893684 3:8753168-8753190 AGGGGTTGCAGCAGCTGTTGAGG 0: 2
1: 0
2: 3
3: 51
4: 385
949893679_949893688 26 Left 949893679 3:8753147-8753169 CCGTGAACAGCATGTAGATCCAG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 949893688 3:8753196-8753218 CAGGAGCATGACGATGATGAAGG 0: 1
1: 0
2: 1
3: 30
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949893679 Original CRISPR CTGGATCTACATGCTGTTCA CGG (reversed) Exonic
900679468 1:3908746-3908768 CTGGGTCCACAGGCTGTACAGGG + Intergenic
901138644 1:7013734-7013756 CTGGTTCTACATTGTGTTCTTGG + Intronic
909324382 1:74331681-74331703 ATGGATCTACAAGCTCCTCAAGG - Intronic
909341510 1:74537040-74537062 CTGGCTCCAGATGCTGTTCTAGG - Intronic
910894069 1:92049230-92049252 CAGGATCTACTTGCTGTTCCTGG + Intronic
911758581 1:101589526-101589548 CTGAATCTAAGTGCTGCTCATGG + Intergenic
911799512 1:102118043-102118065 CTGGATTAACATGGTGTTGAAGG - Intergenic
918306116 1:183248471-183248493 CTGGATCCACATGGTCTTGAGGG - Exonic
921149327 1:212386999-212387021 CTTCATCTACCTGCTGCTCATGG - Exonic
923205159 1:231752255-231752277 ATGGTTCTACAGGCTGTACAGGG + Intronic
924423421 1:243930456-243930478 CTAGATCTAGATGGTGTTCAAGG + Intergenic
1063059166 10:2532919-2532941 CTGCATCCACAAGCAGTTCATGG + Intergenic
1065933847 10:30503063-30503085 CTCCATCTACATGCTAATCATGG + Intergenic
1066474740 10:35735619-35735641 CTGGATCTACATGTGAGTCAGGG + Intergenic
1068144007 10:53042885-53042907 CTTGTTCTACAAGTTGTTCAAGG - Intergenic
1069182304 10:65376788-65376810 CTGCATCTACTTGTTTTTCAGGG + Intergenic
1069334602 10:67333493-67333515 TTGGATTTAAATGCTCTTCAAGG + Intronic
1069391942 10:67945329-67945351 CTGGATATACATACTATTCTAGG - Intronic
1070249068 10:74757914-74757936 CTGGATCTGCCTGCTGTACAGGG + Intergenic
1070351796 10:75599616-75599638 TTGGATCTACATGCTATGGATGG - Intronic
1070950322 10:80425885-80425907 CTGGTCCAACATGCTTTTCAGGG - Exonic
1073824254 10:107302414-107302436 CTGGATTTTCATGCGGTTCTGGG + Intergenic
1075615537 10:123888541-123888563 CTTGATCTATATGCTGCTCGTGG - Intronic
1076998322 11:310262-310284 CTGGATCCAGCTGCTGCTCACGG - Intronic
1077000420 11:319496-319518 CTGGATCCAGCTGCTGCTCACGG + Intergenic
1084464283 11:69313184-69313206 CCGGATCTGGAGGCTGTTCAGGG - Intronic
1086656064 11:89356906-89356928 ATGGGTCCACTTGCTGTTCATGG - Intronic
1087130713 11:94667398-94667420 CTGGATATTTATCCTGTTCATGG - Intergenic
1089929410 11:122294915-122294937 CTGGACCCACATGGTGTTGATGG + Intergenic
1092265690 12:6978647-6978669 CTGCATGTACATGCTGATCTGGG - Exonic
1093125448 12:15322780-15322802 CTGGCTCTTTGTGCTGTTCAAGG + Exonic
1094299823 12:28950596-28950618 CTGGAGCTACATGGTGATAATGG - Intergenic
1095254280 12:40015702-40015724 GTGGATATACATGCTGATGAAGG - Intronic
1097822782 12:64144726-64144748 CTGGATCTCCACGGTGTCCAAGG - Exonic
1098183782 12:67875879-67875901 CTTGCTCTACATGCTTTTCATGG + Intergenic
1102420208 12:112797415-112797437 CTGGATTTACATTCTGTTGGGGG + Intronic
1103337996 12:120204258-120204280 CCGTATCTAAATTCTGTTCAGGG - Intergenic
1103409288 12:120699323-120699345 CTGGATCTACACTCTGTCCCAGG + Exonic
1105605754 13:21925287-21925309 CTTCAACTACATGCTGTGCAGGG + Intergenic
1106632140 13:31485858-31485880 CTGTGAATACATGCTGTTCATGG - Intergenic
1108317471 13:49250890-49250912 CTGGCTCTACATGTTATTAACGG + Intronic
1109249418 13:60001064-60001086 TTTGATCTAGATGCTCTTCAAGG + Intronic
1111439020 13:88253658-88253680 CAGGATCTTAATGCTGTTGAAGG + Intergenic
1114884604 14:26832876-26832898 CTGGAGCTACATGCTGAAGACGG - Intergenic
1116539935 14:46089548-46089570 ATGGTTCTGCAGGCTGTTCAAGG + Intergenic
1116669308 14:47821023-47821045 CTGGATGTACTTGCTCTTCTTGG + Intergenic
1128476022 15:67997431-67997453 TTGCTTCTACATGCTGGTCAGGG - Intergenic
1129269502 15:74411936-74411958 CTGGATCTCCATGATGTTGAAGG + Exonic
1130302251 15:82688988-82689010 CTTGATCCACATCCAGTTCAGGG + Intronic
1130775933 15:86982895-86982917 CCTCATCTTCATGCTGTTCAAGG + Intronic
1132306306 15:100816091-100816113 CTGAATCCACATGTTGTGCATGG + Intergenic
1138103821 16:54276023-54276045 CTTGACCTACCTGATGTTCACGG - Intergenic
1138780902 16:59784527-59784549 CTGGATCTATAAGATGTTCCAGG + Intergenic
1139848653 16:69937618-69937640 CTGGATCTGCTTGCTGTTCTTGG - Exonic
1142224493 16:88870983-88871005 CTGGGTCTGCAGGCTGTGCAGGG - Intergenic
1144776548 17:17787787-17787809 CTGGCCCCACCTGCTGTTCATGG - Intronic
1145213822 17:21036985-21037007 CTGGAACTACACGATGTTCTGGG - Intronic
1145959713 17:28880261-28880283 CTTAATCTACATGATGTGCATGG + Exonic
1151481396 17:74371949-74371971 CTGGATCGCCATCCTGCTCACGG + Exonic
1152454770 17:80407799-80407821 CTGGATGTATATGCAGGTCACGG - Intergenic
1153347520 18:4044273-4044295 CTCCATCTAAATGCTGTTTATGG + Intronic
1155116521 18:22773664-22773686 ATGGTTCTACAGGCTGTACAAGG - Intergenic
1157483343 18:48069939-48069961 CTTTATGTACATGCTGTCCATGG + Intronic
1159740954 18:72169463-72169485 CTGTATCTGCATGCTTCTCACGG + Intergenic
1162189117 19:8930897-8930919 CTGAACCCTCATGCTGTTCAAGG + Intronic
1165192126 19:34073577-34073599 ATGGTTCTACAGGCTGTACAGGG - Intergenic
1167406239 19:49310472-49310494 CTACATCTTCATGCTGTTCCTGG - Exonic
925323783 2:2999314-2999336 CTGAATCTTCATGCTTTTTAAGG - Intergenic
930281019 2:49369773-49369795 CTGGATCATAATGCTCTTCATGG - Intergenic
931284734 2:60822502-60822524 CTGGAGCTACACTCTGTTAATGG + Intergenic
941655408 2:168138508-168138530 CTGGAGCTACGTGCTCCTCAAGG - Intronic
943237104 2:185337054-185337076 CTGGATGTTCTTGATGTTCATGG + Intergenic
944140072 2:196446504-196446526 CTGGACCTACATGGTTTTCTTGG + Intronic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
946867227 2:224052988-224053010 CTGGAACTACAAGATGTTCCAGG + Intergenic
946977658 2:225171076-225171098 CTGGTACTACAAGATGTTCAAGG + Intergenic
947512599 2:230771493-230771515 CAGGAGATACATGTTGTTCATGG + Intronic
1169876590 20:10304329-10304351 CTAAATCTCCATGTTGTTCAAGG - Intronic
1171048047 20:21829545-21829567 CTGGATCTAGATGTTATTCCCGG + Intergenic
1172102114 20:32491185-32491207 CCTGATCTGCATGCTGGTCATGG + Intronic
1172229896 20:33329726-33329748 CTGGAGCTGCTTGCTGTTCAGGG + Intergenic
1183710450 22:39500361-39500383 CTAGATCCACTTGCTCTTCAGGG - Intronic
949893679 3:8753147-8753169 CTGGATCTACATGCTGTTCACGG - Exonic
950372406 3:12542255-12542277 CTAGCTCTACCTGCTGTTGAGGG + Intronic
950975678 3:17240918-17240940 CTTGATCTATATGTTTTTCATGG - Intronic
951326666 3:21310887-21310909 CTGGACATACATGCTGTTGATGG - Intergenic
954357089 3:50090908-50090930 CTGGATCATCTTGCTATTCAGGG - Intronic
955212584 3:56955667-56955689 CAGGATGTGCATGCTGTTCTAGG - Intronic
955567124 3:60259333-60259355 CTGGCTATACAATCTGTTCAGGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
958653972 3:96977663-96977685 GTCAATCTCCATGCTGTTCAAGG - Intronic
961208865 3:125109890-125109912 CTGCATTTTCATGCTGCTCAGGG + Intronic
961494945 3:127284575-127284597 CTGGGTCTACAGGGTCTTCACGG + Intergenic
961609434 3:128124768-128124790 CTGGCTCTCCAGGCTGTTCCGGG - Intronic
965121108 3:164558768-164558790 GTGGATTTTCATGCTGCTCAGGG - Intergenic
966206342 3:177410332-177410354 CTGGATCTGCATGCAGGGCAGGG - Intergenic
970769027 4:19587795-19587817 CTTGATCTACCTGCCTTTCATGG - Intergenic
974387837 4:61225877-61225899 CTGGATTTTCATGCTGACCATGG - Intronic
974501775 4:62713843-62713865 CTGAATCTACATGCTATTTATGG + Intergenic
975074201 4:70184452-70184474 CTGGCTCTATACGTTGTTCATGG + Intergenic
978685431 4:111437136-111437158 CCTAATCCACATGCTGTTCAAGG + Intergenic
979627810 4:122865762-122865784 CAGAATCTACATTCTTTTCAAGG - Intronic
980756130 4:137163953-137163975 CTGTGTCTACATGCTATTAATGG - Intergenic
982964622 4:161889332-161889354 ATGCATTTACAAGCTGTTCAAGG - Intronic
988617658 5:32791181-32791203 CAGCAACTCCATGCTGTTCAGGG - Exonic
992362260 5:76052007-76052029 CAGGCTCCACATGCTGATCATGG - Intergenic
993855669 5:93071484-93071506 CTAGACCTAAATGCTGTTTAAGG + Intergenic
995033066 5:107501127-107501149 CTTGATCTATATGCTGTAGAAGG - Intronic
996218054 5:120892567-120892589 CTGGGACTACAAGATGTTCAGGG + Intergenic
996691711 5:126347465-126347487 CTGGATCTAAATGCTGTTGTAGG - Intergenic
998769102 5:145521462-145521484 CTGGATCCCCATGTTGTACATGG - Intronic
999624229 5:153503323-153503345 CTGGATATAAAAGCTTTTCAAGG - Intronic
1003308401 6:4948320-4948342 CTGGAGCTGAATGCTGCTCAGGG + Intronic
1011008470 6:82675794-82675816 CTGGCACTACATGATGTTCCAGG - Intergenic
1011405463 6:87011150-87011172 CTGGCTCCACATGATGTTCTGGG - Intronic
1015884653 6:137904362-137904384 CTGGATGTGCATGCTGTTTTAGG + Intergenic
1016149774 6:140726076-140726098 CTATATCTACAGGCTGTTGAAGG + Intergenic
1017258543 6:152361946-152361968 ATGGATCTACATGGTTTTCCTGG + Intronic
1018359783 6:163055769-163055791 CTGGAACTAGATGGTGGTCATGG - Intronic
1019709121 7:2510343-2510365 TTGGACCTAGATGCTCTTCAAGG + Intergenic
1022729892 7:33012543-33012565 CATGATCTACATTCTGGTCATGG - Intergenic
1022770002 7:33459647-33459669 CTGGCACTACATGCTGCTCCAGG + Intronic
1024444688 7:49463231-49463253 CTGGATGTTCTTGATGTTCATGG - Intergenic
1026955547 7:74374156-74374178 CTACATCTACATACTGTTTATGG - Intronic
1031839996 7:126726385-126726407 CTGGATCCACATGCTTGTGAAGG - Intronic
1033451550 7:141466453-141466475 CTGGATATACATGATTCTCATGG - Intronic
1039180313 8:34859320-34859342 CTGAATCTACATTCAGTTCGGGG - Intergenic
1039388548 8:37158482-37158504 CAGGATCTGCCTGGTGTTCAAGG - Intergenic
1043051703 8:75393585-75393607 CTGAATGAACATGCTGTTCTGGG - Intergenic
1043178439 8:77051878-77051900 CAGCACCTAGATGCTGTTCAAGG + Intergenic
1045038106 8:98193315-98193337 CAGGATCTACATGCTGGCCATGG + Intronic
1045406857 8:101875282-101875304 CTGGCTCTTCATCCTGTTCCGGG + Intronic
1048487945 8:134866004-134866026 CTTGTTCTAGATGCTCTTCAAGG + Intergenic
1048835161 8:138512453-138512475 CTGAATGTACATGCTTGTCAGGG + Intergenic
1051323342 9:15935070-15935092 CTGGAACTACATGGTGGTGATGG + Intronic
1051589072 9:18757680-18757702 CTGAAGCCACATGGTGTTCAGGG + Intronic
1053908772 9:42873727-42873749 ATGAATCCACATGCAGTTCATGG - Intergenic
1054803270 9:69374081-69374103 CTCCATCTACATGAAGTTCAAGG - Intronic
1055160772 9:73125205-73125227 CCGAACCCACATGCTGTTCAAGG - Intergenic
1055892918 9:81142257-81142279 CTGGATCTGGCTGCTGCTCAGGG + Intergenic
1059756576 9:117299438-117299460 CTGGATCTAAAAACTCTTCATGG + Intronic
1187104171 X:16223139-16223161 CTGGAGTTACATGCTGCTGATGG + Intergenic
1189051140 X:37646935-37646957 ATGGAGATACAAGCTGTTCAAGG - Intronic
1189717027 X:43877513-43877535 CGTTATCTACATGCTGTACAAGG - Intronic