ID: 949894239

View in Genome Browser
Species Human (GRCh38)
Location 3:8757589-8757611
Sequence CAGGATCTTAGGGTCTCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949894232_949894239 12 Left 949894232 3:8757554-8757576 CCAAAAGGGAAGGTTGCTGCAAC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 949894239 3:8757589-8757611 CAGGATCTTAGGGTCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70
949894227_949894239 28 Left 949894227 3:8757538-8757560 CCAGCGACCTAGAAATCCAAAAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 949894239 3:8757589-8757611 CAGGATCTTAGGGTCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70
949894231_949894239 21 Left 949894231 3:8757545-8757567 CCTAGAAATCCAAAAGGGAAGGT 0: 1
1: 0
2: 0
3: 14
4: 258
Right 949894239 3:8757589-8757611 CAGGATCTTAGGGTCTCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949894239 Original CRISPR CAGGATCTTAGGGTCTCCGC TGG Intronic
900734903 1:4293351-4293373 CTGCATCTCAGGGTCTCCACTGG + Intergenic
903000008 1:20258539-20258561 CAGTATCTTTGGATCTCCCCAGG - Intergenic
904262619 1:29298581-29298603 GAGGATCTGAGGGTTTTCGCAGG - Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
907579149 1:55556220-55556242 CAGGCACTGGGGGTCTCCGCAGG - Intergenic
909864131 1:80645001-80645023 CAGGACCTTAAAGTCTCCTCAGG - Intergenic
916011124 1:160706833-160706855 CAGGACCATAGAGTCTCCCCAGG + Intronic
917819471 1:178747791-178747813 CAGGGCCTGAGCGTCTCCGCTGG - Intronic
923411161 1:233710709-233710731 CAGGATTTTGGGGTCTGTGCTGG - Intergenic
1068543538 10:58322665-58322687 CAGGGTCTAAGGGTCACGGCAGG - Intergenic
1071451322 10:85793587-85793609 CAGGGTCTGATGGTCTCTGCAGG + Intronic
1076631244 10:131853447-131853469 CAGGATGGGAGGGTCTCCCCAGG + Intergenic
1077909617 11:6562906-6562928 CAGGATCATAGGGTCTTCTGGGG + Intronic
1078668716 11:13346614-13346636 AAGGATCTCAGGGGCTCCACAGG - Intronic
1080950515 11:37026910-37026932 CATGTTCTTAGGGTCTCCTGAGG + Intergenic
1082755375 11:57070187-57070209 GAGGATGTTAGTGTCTCCTCTGG + Intergenic
1083252972 11:61480336-61480358 CAGGATCTTATGCTCTCACCTGG - Intronic
1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG + Intergenic
1083554936 11:63618597-63618619 CATCCTCTTAGGGTCTCAGCTGG - Intergenic
1085053082 11:73389657-73389679 CAGCATCTTGGGGTCTGCCCTGG + Intronic
1097248957 12:57621873-57621895 CAGGACCGCAGGGTCTGCGCGGG - Intronic
1101391458 12:104303996-104304018 CAGGAGCTTTGGGTCTACGTCGG - Exonic
1101915571 12:108893123-108893145 CAGGCTCCTAGGGTCCCCACAGG + Intronic
1107435312 13:40376370-40376392 GAGGATCTTAGGGTCCCCATGGG + Intergenic
1109537782 13:63740253-63740275 AAGGATCTTAGGATCTGCGATGG + Intergenic
1112606623 13:100912681-100912703 AAGGCACTTAGGGTCTCCCCGGG + Intergenic
1113097612 13:106682415-106682437 CAGAATCTTTGGGTTTCCTCAGG - Intergenic
1116186313 14:41605355-41605377 CGGGACTTCAGGGTCTCCGCGGG - Intergenic
1124003435 15:25778089-25778111 CAGGAACTTAGGGTATCCAGCGG - Intronic
1127293467 15:57590776-57590798 CAGGAACTTAGCAGCTCCGCGGG - Intergenic
1128947646 15:71840375-71840397 GATGATCTTAGGCTCTCTGCAGG + Intronic
1132975119 16:2707143-2707165 CAGGGTCTTGGGGACTCAGCTGG - Intronic
1152174995 17:78781845-78781867 CAGGATCTCAGGGGCTCTGAGGG - Intronic
1152426399 17:80220721-80220743 CCGGATCCTGGGGTCTCCGGAGG - Intronic
1152854820 17:82658687-82658709 CAGGATCTTGGGGACTCCGGGGG + Exonic
1157163461 18:45336452-45336474 CAGCATCTTAGGATCTCAGTGGG - Intronic
1161531291 19:4791731-4791753 CGCCATCTTAGGGTCTCCTCGGG - Exonic
1165469945 19:35997412-35997434 CAGGGTCTCAGGATCTCAGCTGG + Intergenic
940259775 2:151767458-151767480 CAGAATCTGAGGGCCTCCACAGG + Intergenic
946287650 2:218717312-218717334 AAGGATCTTAGGGTCCCCTCAGG + Intronic
948665412 2:239531716-239531738 CAGGAACTCTGGGTCTCCTCGGG - Intergenic
1169759332 20:9074298-9074320 CAGGATCTTTGGGTGTGCCCAGG + Intronic
1181490158 22:23256497-23256519 CAGGTTCTTGGGGTGTTCGCCGG + Intronic
1182145607 22:27995033-27995055 CTGAAGCTTAGGGTCTCCTCAGG - Intronic
1185286004 22:50000151-50000173 CAGCGTCTGAGGGTCTTCGCAGG + Intronic
949884376 3:8681859-8681881 AAGGATCTTAGGATCTGCGATGG - Intronic
949894239 3:8757589-8757611 CAGGATCTTAGGGTCTCCGCTGG + Intronic
950404943 3:12798387-12798409 CAGGAGCTCAGGGTCTCCCAGGG - Intronic
950577970 3:13844448-13844470 CAGGGTCTCAGGGCCTCCCCAGG - Intronic
972565258 4:40263924-40263946 CATGCTCTTAGGGTCTCAGCTGG - Intergenic
974980663 4:68953489-68953511 CATGTTCTTAGGGTCTCTGGAGG + Intergenic
977268534 4:94885156-94885178 AAGGATCTTCAGGTCTCAGCTGG - Intronic
978329120 4:107592689-107592711 CATGATCATAGGGTATCTGCAGG - Intronic
988314006 5:29600743-29600765 CAGCTTCTTAGGGTCCCCGATGG - Intergenic
989424506 5:41280488-41280510 CAGGTTCTTATGGTCACCTCTGG + Intergenic
992203967 5:74411891-74411913 CAGGATCCAAGGGTCTCCTGAGG + Intergenic
994275853 5:97836581-97836603 CAGGGTCTCAGAGTCTCAGCAGG + Intergenic
1010644265 6:78368159-78368181 CAAGATCTTAGGAGCTCAGCTGG - Intergenic
1019135583 6:169905672-169905694 CAGGATGTGAGGGTCTGTGCTGG + Intergenic
1027801418 7:82755897-82755919 CAGGATCTTATGCTCTCTGAAGG + Exonic
1034305069 7:150040725-150040747 AAGGATCTTAGGATCCCCGATGG + Intergenic
1034305701 7:150043249-150043271 AAGGATCTTAGGATCCCCGATGG + Intergenic
1034801142 7:154057401-154057423 AAGGATCTTAGGATCCCCGATGG - Intronic
1035359813 7:158303933-158303955 CATGATCTTAGGCTCTCCTGGGG - Intronic
1036119681 8:6002291-6002313 CAGGCTTTTAGGGTCTTCTCAGG + Intergenic
1038671676 8:29588129-29588151 CAGGCTCTTGGGGTCCCTGCTGG - Intergenic
1046661293 8:116950361-116950383 CAGGATTCTAGAGTCTCCACAGG - Intronic
1048208883 8:132438414-132438436 GAGGAACTTAGGGACTCCACTGG + Intronic
1055436718 9:76298949-76298971 CAGGATCTTATTGTTTCCACTGG - Intronic
1056068165 9:82958420-82958442 CAGCATCTCAGGGACTCTGCAGG + Intergenic
1190510947 X:51173858-51173880 CAGGATCATAGGGTGACTGCAGG - Intergenic
1192212098 X:69134174-69134196 CAGGAACTTAGACTCTCCTCTGG - Intergenic
1198053074 X:132967541-132967563 CAGCATCTTAGCATCTCAGCTGG - Intergenic
1200145789 X:153926081-153926103 CACGACCTTGGGTTCTCCGCAGG + Intronic