ID: 949894739

View in Genome Browser
Species Human (GRCh38)
Location 3:8760717-8760739
Sequence TGGGAATCCGTGGAAGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949894727_949894739 30 Left 949894727 3:8760664-8760686 CCCTGGAGTTGTGCCACAAAGCA 0: 1
1: 2
2: 2
3: 25
4: 195
Right 949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG 0: 1
1: 0
2: 0
3: 10
4: 149
949894729_949894739 17 Left 949894729 3:8760677-8760699 CCACAAAGCAGCCCACACAATGG 0: 1
1: 0
2: 2
3: 25
4: 196
Right 949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG 0: 1
1: 0
2: 0
3: 10
4: 149
949894734_949894739 5 Left 949894734 3:8760689-8760711 CCACACAATGGACTTGGGCTTCA 0: 1
1: 1
2: 1
3: 10
4: 150
Right 949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG 0: 1
1: 0
2: 0
3: 10
4: 149
949894728_949894739 29 Left 949894728 3:8760665-8760687 CCTGGAGTTGTGCCACAAAGCAG 0: 1
1: 1
2: 2
3: 28
4: 187
Right 949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG 0: 1
1: 0
2: 0
3: 10
4: 149
949894733_949894739 6 Left 949894733 3:8760688-8760710 CCCACACAATGGACTTGGGCTTC 0: 1
1: 0
2: 2
3: 4
4: 193
Right 949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949894739 Original CRISPR TGGGAATCCGTGGAAGAAAC TGG Intronic
902290138 1:15429839-15429861 TGGGAAGCTGTGGCAGAACCCGG - Exonic
905322652 1:37128890-37128912 TGAGAGTCCATGGAAGAGACTGG + Intergenic
906868516 1:49449745-49449767 TGGGAATGAGTAGATGAAACCGG - Intronic
911214920 1:95182292-95182314 TGGCAGTCTGTGGAAGAACCTGG + Intronic
915301337 1:154953263-154953285 TGGGAACCCCTGGAAGAGACCGG - Intronic
918040004 1:180908226-180908248 TGGGAATCCTGGAAGGAAACAGG + Intergenic
919306999 1:195855058-195855080 TGGAAATAGGTGGAAGAAAGTGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924778603 1:247128059-247128081 TGAGAGTACGAGGAAGAAACTGG - Intronic
1063641583 10:7835922-7835944 GGGGAATCCTGGGAAGAAAGTGG - Intronic
1069565014 10:69458084-69458106 TGGGGGCCCGAGGAAGAAACTGG - Intronic
1070498214 10:77044808-77044830 AGTGAATCCGTGGTACAAACAGG + Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072385635 10:94924475-94924497 TGGAAATCCAAGGAAGAAAAAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081567592 11:44269657-44269679 TAGGAATCCCTGGAGGAAAAGGG - Intronic
1082974758 11:59060483-59060505 TGGGAATCCGTGAAAGAGTAGGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083290956 11:61689875-61689897 AGAGAATCTGAGGAAGAAACTGG - Intronic
1086254866 11:84863642-84863664 TGGGCTTCCATGGAAGAAAAAGG + Intronic
1087075306 11:94122658-94122680 TGGGAAGCAGGGGCAGAAACAGG + Intergenic
1088931667 11:114357588-114357610 TGGTAATCCAAGAAAGAAACAGG - Intergenic
1089252309 11:117173724-117173746 TGGGAATCAGTTAAAGACACAGG - Intronic
1090734030 11:129595705-129595727 ATGGAATTCCTGGAAGAAACTGG + Intergenic
1091204410 11:133809916-133809938 GGGGAATTCTTGGAAGAAAATGG - Intergenic
1093525980 12:20103642-20103664 TGGGAATCAGTGCAAGACCCTGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1104962683 12:132495682-132495704 TGGGACTCTGTGGGAGGAACAGG - Intronic
1106539990 13:30681810-30681832 GTGGAATCCGTGGAATTAACAGG - Intergenic
1107076838 13:36330865-36330887 TGGCATTCTGAGGAAGAAACAGG - Intronic
1118867335 14:69713685-69713707 TGGAAACAGGTGGAAGAAACCGG + Exonic
1119238748 14:73041354-73041376 TGGGAAACAGGAGAAGAAACAGG + Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1122867994 14:104617933-104617955 TGGGCATCTGTGGGAGAAGCAGG - Intergenic
1124821055 15:33045604-33045626 TTGGAAGCCGTGACAGAAACTGG + Intronic
1126123005 15:45270081-45270103 TGGGAAACCATGGAAAAGACTGG + Intronic
1130036001 15:80362164-80362186 TGGGAATTCGGTGAATAAACTGG + Intronic
1132869461 16:2109344-2109366 GGGGAAGCTGTGGGAGAAACGGG + Exonic
1134514603 16:14876558-14876580 TGGGAGTCCTCTGAAGAAACTGG + Intronic
1134702280 16:16275211-16275233 TGGGAGTCCTCTGAAGAAACTGG + Intronic
1134717952 16:16366255-16366277 GGGGAAGCTGTGGGAGAAACGGG - Intergenic
1134956799 16:18385904-18385926 GGGGAAGCTGTGGGAGAAACGGG + Intergenic
1134969550 16:18519439-18519461 TGGGAGTCCTCTGAAGAAACTGG - Intronic
1135564327 16:23500023-23500045 TGGGAAGCAGTGGAAGGAAGAGG + Intronic
1140183033 16:72739267-72739289 TTGGAATCGGTAGAAGATACAGG - Intergenic
1140207010 16:72941342-72941364 TGGGAACCACTGGAAGAAAACGG + Intronic
1144027268 17:11288725-11288747 AGAGAATCAGTGGAAGAAAATGG - Intronic
1145966837 17:28925193-28925215 AGGGGATCCGTGGCAGAAATAGG - Intronic
1147531810 17:41286122-41286144 GGGGAATGCTTGGAAAAAACTGG - Intergenic
1148227134 17:45906850-45906872 AGGCAATGCCTGGAAGAAACTGG - Intronic
1148582368 17:48752762-48752784 CGGGAAACCGTGGGAGAACCCGG - Intergenic
1156858316 18:41808676-41808698 TGGGACTCAGTGGAGGCAACAGG + Intergenic
1158653929 18:59311499-59311521 TGGGGATCCATGGAAGGAATTGG + Intronic
1160570403 18:79813203-79813225 TGTGAATTCGTGAAAGATACTGG - Intergenic
1162705268 19:12550799-12550821 TGGGAATGCGGGGAAGGAACCGG + Intronic
1166087174 19:40484578-40484600 TGGGAGTCAGGGGAAGAAAGAGG + Intronic
1166294495 19:41882498-41882520 TGGGAATCCGGGAGAGAGACAGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166786195 19:45368813-45368835 TGGGAAGCTGGGGAAGAGACTGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926023893 2:9522070-9522092 TTGGAACCAGTCGAAGAAACAGG - Intronic
926670232 2:15570207-15570229 TGGGAATCCATGGAAGACGGGGG - Intergenic
927243117 2:20935854-20935876 AGGGAATCAATGGACGAAACAGG + Intergenic
927306654 2:21581403-21581425 TGGGATTCAGAGGAAGAAGCAGG + Intergenic
927565238 2:24105991-24106013 TGGGCATCCCTGAAAGAGACAGG + Intronic
929932519 2:46269832-46269854 TGGGAATCCGTAGCTGAATCAGG + Intergenic
935632730 2:105225095-105225117 GGGGAAAACGTGGAAAAAACTGG - Intergenic
936246961 2:110836786-110836808 AGGGAAGCCTTGGAAGAAATAGG + Intronic
937486312 2:122318269-122318291 TGGGAAGACGAGGAAGAATCTGG + Intergenic
938198962 2:129357357-129357379 TGGGAATCAGTGGAGCAAAAAGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
944457746 2:199912246-199912268 TGGGGATGGGTGGAAGAAAAGGG + Intronic
944581835 2:201138341-201138363 TGGGAATCCTTGGAGGCCACAGG + Intronic
945586752 2:211674982-211675004 TGGAAATCTATGGAAGAAAAGGG - Intronic
948500828 2:238392543-238392565 TGCTAATCCATGGAACAAACTGG - Intronic
1170029402 20:11929428-11929450 AGGGAACCCGTGGAAGAATGAGG + Intergenic
1172753513 20:37267838-37267860 TGGGAATCGGTGGAAGGGGCTGG - Intergenic
1172853660 20:37984556-37984578 TGGCAATCCCTGGAAGAATGGGG + Intronic
1174186143 20:48707651-48707673 TGTGAATCCGTAGAAGGAAATGG - Intronic
1175407633 20:58745289-58745311 TGGGAATCAGTGGAGGAGATGGG - Intergenic
1180001413 21:44997104-44997126 TGGGTATCCCTGGAGGAAAGCGG + Intergenic
1181061527 22:20284250-20284272 TGGGAAGCCCTGTAAGAAAGAGG - Intergenic
1182083871 22:27548202-27548224 TGGGGAACCGTGGCAGAAACCGG + Intergenic
949556560 3:5158338-5158360 TGGTATTCAGTGGAAGGAACAGG + Intronic
949792890 3:7812459-7812481 TGGACATACTTGGAAGAAACTGG + Intergenic
949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG + Intronic
951920323 3:27847614-27847636 TGGGTATCCATGGAGGAAAATGG + Intergenic
952640821 3:35593419-35593441 TGGGGATTGGAGGAAGAAACAGG - Intergenic
952920781 3:38282490-38282512 GGGGAATCTGTGGAAGGAGCGGG + Intronic
953277394 3:41515742-41515764 TGGGACTAGGTGGAAGTAACTGG - Intronic
953371653 3:42393646-42393668 TGGGGAAACTTGGAAGAAACCGG - Intergenic
956609998 3:71112836-71112858 TGTGGAACCGTGGATGAAACTGG - Intronic
958957919 3:100481176-100481198 TGGGAAGACGTGGATGAACCTGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961819059 3:129566011-129566033 CAGGAATCTGTGGAAGCAACTGG + Exonic
964138143 3:153368405-153368427 TGTGAATCTGTTGAAGTAACTGG + Intergenic
965051674 3:163657870-163657892 TGGAAATCAGTGGACCAAACTGG + Intergenic
970651002 4:18177808-18177830 TGAGAATTCTTGAAAGAAACTGG - Intergenic
970670680 4:18393404-18393426 TGTGAATCAATGGAAGAAAATGG + Intergenic
971185056 4:24367190-24367212 TGGGCATCCCAGGAAGAAATGGG + Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
973159671 4:47000275-47000297 TGGGTATCTGTGGCAGAAAGAGG + Intronic
973804977 4:54516819-54516841 TGGGAAGCCATGGGAGAGACTGG + Intergenic
973974312 4:56246762-56246784 TGGGAAATGGGGGAAGAAACAGG + Intronic
974017418 4:56660859-56660881 TGGGACTCCGGGAAAAAAACAGG - Intronic
974579493 4:63777305-63777327 TGGGAATGCTTAGAAGAGACAGG + Intergenic
976340137 4:83937989-83938011 AGGGATTCTGTGGAAAAAACTGG - Intergenic
977482043 4:97591549-97591571 TGGTGATCTGTGGAAGAATCAGG - Intronic
980835461 4:138186499-138186521 TGGGAATCCGGGGAAGTGTCAGG - Intronic
985055671 4:186033863-186033885 TGGGAATCCGTGCATGCATCAGG - Intergenic
999270280 5:150292896-150292918 TGGGAATCGGGAGAGGAAACAGG - Intergenic
999620832 5:153471423-153471445 TGGGTTTCCATGGAAGAAGCTGG - Intergenic
1000972040 5:167725598-167725620 TGGGAAGCTGTTGCAGAAACAGG - Intronic
1001134990 5:169095121-169095143 TAGGAATACTTGGCAGAAACGGG - Intronic
1001253991 5:170169928-170169950 TGGGAATACGTGGAAGAATAAGG - Intergenic
1003411861 6:5871974-5871996 TGAGAAGCTGTGGAAGGAACTGG - Intergenic
1004830794 6:19475048-19475070 TGCCAGCCCGTGGAAGAAACCGG - Intergenic
1005524183 6:26629803-26629825 TGGTTATCATTGGAAGAAACTGG - Intergenic
1006213475 6:32417540-32417562 TGGGAATCCATGGGAGATTCTGG + Intergenic
1007721969 6:43890541-43890563 TGGGGGTCGGTGGAAGAAATTGG + Intergenic
1010471352 6:76231840-76231862 TGGGATTCCTTTGAAGAGACAGG + Intergenic
1013795155 6:113879640-113879662 TGGGAACCCGTTGAAGAGATAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1018313830 6:162537424-162537446 AGGGAACACGAGGAAGAAACAGG - Intronic
1020415410 7:7940543-7940565 TGAGAATCCTTGGAAGACAGTGG - Intronic
1021199038 7:17706804-17706826 TGTGAACCTGTGGTAGAAACTGG + Intergenic
1025823445 7:64992545-64992567 GGGGAATCGGTGGAACAAGCAGG + Exonic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030527855 7:110674939-110674961 AGGGACTCCGTGGAAGAGTCAGG - Intronic
1030745092 7:113155704-113155726 TGGGGAAACGTGGAAGTAACTGG - Intergenic
1031553760 7:123146593-123146615 TGGGAATCTGTGGATTCAACAGG - Intronic
1033019528 7:137708783-137708805 TGGGAATAAGTGGTAGAAAATGG + Intronic
1037723440 8:21464274-21464296 TGGGAAAAGGTGGAAGAAGCAGG - Intergenic
1037907059 8:22721723-22721745 AGAGAATCCGTGGAGGAAGCAGG - Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040055967 8:43056864-43056886 TGGGAAGCCGTGGAAGAGAGCGG - Intronic
1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG + Intergenic
1041445150 8:57943180-57943202 GGGCAATCCTTGGGAGAAACTGG + Intergenic
1043985049 8:86684352-86684374 TGGCAAGCCTGGGAAGAAACTGG + Intronic
1045414398 8:101952082-101952104 TTGGAATCCCTGGAAGATGCCGG + Intronic
1046362121 8:113173632-113173654 TTAGATTCCGTAGAAGAAACAGG + Intronic
1047275329 8:123401272-123401294 TGGGAATCCTTGGAGGCCACAGG - Intronic
1051847148 9:21464745-21464767 TTGGCATCCCTGAAAGAAACAGG - Intergenic
1054712649 9:68526604-68526626 TGGGAATCTTTTGAAGAAAGAGG - Intronic
1055971355 9:81915762-81915784 TTGGAATCCAAGGGAGAAACAGG - Intergenic
1055973082 9:81930825-81930847 TTGGAATCCAAGGGAGAAACAGG - Intergenic
1055974835 9:81945917-81945939 TTGGAATCCAAGGGAGAAACAGG - Intergenic
1055979878 9:81991143-81991165 TTGGAATCCAAGGGAGAAACAGG - Exonic
1056113798 9:83422311-83422333 TGGGAATTGGTGGAAGAGTCAGG - Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1062176539 9:135166356-135166378 GAGGCATCCATGGAAGAAACAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194425252 X:93729279-93729301 TTGTAATCAGTGGAAGAAATAGG + Intergenic
1195331656 X:103807873-103807895 TGGGAATCAATGGTGGAAACAGG - Intergenic
1197587782 X:128370805-128370827 TGGGAATCCCTGGAAGAGCCTGG - Intergenic
1200096314 X:153665754-153665776 TAGGGATCCGTGGATGAAGCTGG + Intergenic