ID: 949895352

View in Genome Browser
Species Human (GRCh38)
Location 3:8764202-8764224
Sequence TAGCCAATGGCCACCCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949895352_949895363 16 Left 949895352 3:8764202-8764224 CCTTGATGGGTGGCCATTGGCTA 0: 1
1: 0
2: 0
3: 11
4: 82
Right 949895363 3:8764241-8764263 TGGGGTTTTCATGATAAAGCAGG 0: 1
1: 0
2: 0
3: 18
4: 145
949895352_949895355 -3 Left 949895352 3:8764202-8764224 CCTTGATGGGTGGCCATTGGCTA 0: 1
1: 0
2: 0
3: 11
4: 82
Right 949895355 3:8764222-8764244 CTAAGCTCCCCTACCTCCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 159
949895352_949895354 -4 Left 949895352 3:8764202-8764224 CCTTGATGGGTGGCCATTGGCTA 0: 1
1: 0
2: 0
3: 11
4: 82
Right 949895354 3:8764221-8764243 GCTAAGCTCCCCTACCTCCCTGG 0: 1
1: 0
2: 2
3: 15
4: 138
949895352_949895356 -2 Left 949895352 3:8764202-8764224 CCTTGATGGGTGGCCATTGGCTA 0: 1
1: 0
2: 0
3: 11
4: 82
Right 949895356 3:8764223-8764245 TAAGCTCCCCTACCTCCCTGGGG 0: 1
1: 0
2: 4
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949895352 Original CRISPR TAGCCAATGGCCACCCATCA AGG (reversed) Intronic
901226918 1:7618621-7618643 TAGTAAAAGGCCACACATCAGGG + Intronic
903026938 1:20436033-20436055 AAGCCAATGAGCACCCATCCTGG + Intergenic
903367734 1:22815391-22815413 TTGCCCAAGGCCACCCATCAAGG + Intronic
910430396 1:87154361-87154383 TGGCCAGTGGCCACCCAGCGTGG - Intronic
911942849 1:104069424-104069446 TAGCCAGTGCCCACCCATGGAGG - Intergenic
915457114 1:156048376-156048398 AAGCCAAGGCCCACCCCTCAGGG + Intronic
918176484 1:182050664-182050686 TCTCCAATGGCCACCCACTAAGG - Intergenic
919672400 1:200349808-200349830 TAGCCAGTGGCCACACATAAGGG + Intergenic
922717724 1:227885991-227886013 CAGCCAGTGGCCACCCAACCTGG + Intergenic
1065105294 10:22377634-22377656 TAGCCAGTGGAAACCCATGAGGG + Intronic
1065275904 10:24085503-24085525 TAGCCCACGGCCACCAATAATGG + Intronic
1067825274 10:49567538-49567560 TGGCCAATGGCCACCCCCAATGG - Intergenic
1068478884 10:57563543-57563565 CAGCTAATGGCCACCCATGGAGG - Intergenic
1071563979 10:86662244-86662266 TGGGCAATGGCCACCCTGCAGGG - Exonic
1075241489 10:120782959-120782981 TAGTCTATGGCCAGCCATGAAGG - Intergenic
1075363810 10:121864497-121864519 TAGCCAATGGTCATACATCAGGG - Intronic
1075764161 10:124879511-124879533 GGGCCAAAGGCCACCCATAAAGG + Intergenic
1076425447 10:130364262-130364284 GAGCAAGGGGCCACCCATCAAGG - Intergenic
1077739248 11:4826807-4826829 TAGGCAATAGTCACCCATAATGG - Intronic
1078011508 11:7576338-7576360 TAGCCAAAGGCCACACATTAAGG + Intronic
1078081274 11:8206360-8206382 TGGCCAATGGCAATCAATCAGGG + Intergenic
1082796033 11:57378413-57378435 TAGGCAATTGCTACACATCAGGG - Intronic
1085008294 11:73115148-73115170 TAGCCAATGACCACTCATGGAGG - Intronic
1087934476 11:104016544-104016566 AGGCCCATGTCCACCCATCAGGG + Intronic
1090249674 11:125242515-125242537 TAACCAGAGGCCACCCTTCAGGG - Intronic
1110501181 13:76230754-76230776 TAGCTGATGCCCACCCATGAAGG + Intergenic
1113791022 13:113028287-113028309 CACTCAAAGGCCACCCATCAAGG + Intronic
1114819974 14:26007024-26007046 CAGGCAACGGCCTCCCATCATGG - Intergenic
1127314473 15:57781730-57781752 CAGCCAGTGCCCATCCATCATGG - Intronic
1128093189 15:64932981-64933003 CACCCAATGGCCACCCAGCTGGG - Intronic
1135692429 16:24552250-24552272 TAGCCAATGCCCACACAGTAGGG - Intronic
1137382940 16:48015329-48015351 AAGCCAATCACCTCCCATCAGGG + Intergenic
1141294337 16:82752760-82752782 TAGGCAAAGGCCACAAATCAGGG - Intronic
1147704259 17:42415049-42415071 CAGCCAATGGCCACCAATGCTGG + Intronic
1149028018 17:52052333-52052355 AAGTCAATGGCTACTCATCAGGG - Intronic
1152164021 17:78689777-78689799 TCACCAATGTCCACCCAGCAGGG + Intronic
1152773160 17:82183056-82183078 GAGCCAATCACCTCCCATCAGGG + Intronic
1156764627 18:40637115-40637137 TATTCAATGGTCAGCCATCAGGG - Intergenic
1158680801 18:59565101-59565123 GAGGCAAGGGCCACCCTTCAGGG + Intronic
1160044250 18:75372104-75372126 TATCCAATGGCCACCTCTCAGGG + Intergenic
1162189070 19:8930557-8930579 TAGCAAATGGCCGGGCATCATGG + Intronic
1162449928 19:10748506-10748528 TAGCCATTGGTCACCCAGCAAGG - Intronic
925094708 2:1187050-1187072 TAGCACATGCTCACCCATCAAGG + Intronic
929307927 2:40386731-40386753 TAACCAATGCTCATCCATCATGG - Intronic
939540510 2:143488083-143488105 TAGATGATGGCCACCAATCATGG + Intronic
946038098 2:216760150-216760172 TAGCTAATGGCCACTCATTTAGG - Intergenic
947637642 2:231688198-231688220 CAGCCAATATCCACCCACCATGG - Intergenic
947729081 2:232418334-232418356 TAGCCTAGGGACACCCATCCTGG + Intergenic
1172535500 20:35669946-35669968 GAGCCAATGGACACCAAACATGG + Intronic
1173715386 20:45199339-45199361 CAGCCAATGGCCACCCCTGGTGG - Intergenic
1174922430 20:54718042-54718064 CAGCCAATGGCTACACACCAAGG - Intergenic
1176271075 20:64235712-64235734 CAGCCAAGGGTCACCCACCACGG - Intronic
1181556740 22:23675632-23675654 GAGCTAATGGACACCCACCAGGG - Intergenic
1181697647 22:24601953-24601975 GAGCTAATGGACACCCACCAGGG + Intronic
1183688708 22:39376252-39376274 TAGCGAAAGGCCACCCATCCAGG - Intronic
949895352 3:8764202-8764224 TAGCCAATGGCCACCCATCAAGG - Intronic
952988717 3:38812081-38812103 TAGCCTATGACCATCCACCAAGG + Intergenic
954031907 3:47825524-47825546 TAGCCCTTGGCCACTCATCCTGG - Intronic
959189951 3:103098103-103098125 TAGTCAATGCCCACCCATGGAGG - Intergenic
960144171 3:114181650-114181672 TAGCCAATGGCCCTTCATCAGGG + Intronic
961626758 3:128269445-128269467 TAGGCACTGGCCACCAATCATGG - Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
967144232 3:186592628-186592650 AAGGCAATGGCCACACATGAAGG - Intronic
969458610 4:7315399-7315421 TGGCCAATGGCCAGGCAGCATGG + Intronic
969908734 4:10423054-10423076 TAGCCAATGTCCACCCAGAGAGG + Intergenic
974875760 4:67701085-67701107 GAGCCTGTGGCCGCCCATCAGGG - Exonic
986399909 5:7370588-7370610 CAGCCAATGGTCAACCACCATGG + Intergenic
995146996 5:108797459-108797481 CAGCCAATGCCCACCCAGGAAGG - Intronic
995483271 5:112614142-112614164 TGGCCACAGGCCACCCTTCAGGG + Intergenic
996063739 5:119059049-119059071 TAGCCAATGTGTGCCCATCAGGG + Intronic
997666585 5:135634396-135634418 TGGCTAATGGCCAATCATCATGG + Intergenic
997670726 5:135669699-135669721 TAGCAAAAAGCCACCCAGCAGGG + Intergenic
1001866147 5:175107188-175107210 TGGCCAATGGCCTGCCAACATGG - Intergenic
1005947155 6:30602907-30602929 TAGCCAATGGTTTCCCACCAGGG - Exonic
1007703508 6:43777878-43777900 GAGCCCATGGGCAACCATCAGGG - Intronic
1013132493 6:107247517-107247539 TAGCCAATGACAACCCATTAAGG + Intronic
1013323737 6:109022817-109022839 TAACCCAAGGCCACACATCAAGG + Intronic
1013409461 6:109871260-109871282 CAGCCAATTGTCACCCATGATGG - Intergenic
1013604193 6:111732803-111732825 CAGACAATGGCAACCCAACAGGG + Intronic
1015209349 6:130679051-130679073 TAGCAAATGGCCAACCTCCAGGG - Intergenic
1029464113 7:100714816-100714838 TCCCCAAAGGCCACCCAACAAGG + Intergenic
1032485529 7:132284541-132284563 TAGCCAAAGGCCACGTCTCAGGG + Intronic
1034729722 7:153376648-153376670 TAACCTTTGGCAACCCATCATGG + Intergenic
1055480251 9:76702545-76702567 TAGCCAATGGGCATATATCAGGG - Intronic
1057540522 9:95964300-95964322 TGGCCAATGGGAACCCATTAGGG + Intronic
1057549387 9:96040678-96040700 TGGCCCATGGCCACACCTCATGG + Intergenic
1185679387 X:1875913-1875935 CAGCTACTGGCCAGCCATCACGG + Intergenic
1193088292 X:77467454-77467476 CAGCCGATGACCACCCATGAAGG + Intergenic
1193156596 X:78181300-78181322 TACCCAAAGGCCTACCATCATGG - Intergenic
1194546288 X:95239191-95239213 CAGCAAATGGCCACCCATGGAGG + Intergenic
1195399622 X:104447584-104447606 TGGCCATTGGTCACCCAACAAGG + Intergenic
1195416312 X:104623523-104623545 TAGGCAAAGGCTACCCATCAGGG + Intronic
1200757229 Y:7001198-7001220 TAGCCAATGGCCTCACACCTCGG - Intronic
1200934070 Y:8723026-8723048 TACACAATGGCTACCCATGAGGG + Intergenic