ID: 949895436

View in Genome Browser
Species Human (GRCh38)
Location 3:8764700-8764722
Sequence GACTCTGGCCACCACCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 307}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949895436_949895443 24 Left 949895436 3:8764700-8764722 CCAGGCTGGTGGTGGCCAGAGTC 0: 1
1: 0
2: 1
3: 33
4: 307
Right 949895443 3:8764747-8764769 GAGGTGCTCACATCTGGACTGGG 0: 1
1: 0
2: 1
3: 13
4: 138
949895436_949895439 5 Left 949895436 3:8764700-8764722 CCAGGCTGGTGGTGGCCAGAGTC 0: 1
1: 0
2: 1
3: 33
4: 307
Right 949895439 3:8764728-8764750 CATCACCTCTGTGTTTGATGAGG 0: 1
1: 0
2: 1
3: 14
4: 215
949895436_949895441 18 Left 949895436 3:8764700-8764722 CCAGGCTGGTGGTGGCCAGAGTC 0: 1
1: 0
2: 1
3: 33
4: 307
Right 949895441 3:8764741-8764763 TTTGATGAGGTGCTCACATCTGG 0: 1
1: 0
2: 0
3: 6
4: 103
949895436_949895442 23 Left 949895436 3:8764700-8764722 CCAGGCTGGTGGTGGCCAGAGTC 0: 1
1: 0
2: 1
3: 33
4: 307
Right 949895442 3:8764746-8764768 TGAGGTGCTCACATCTGGACTGG 0: 1
1: 0
2: 1
3: 21
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949895436 Original CRISPR GACTCTGGCCACCACCAGCC TGG (reversed) Intronic
900672893 1:3866741-3866763 GCCCCTGGCCACCACCATTCCGG + Intronic
900827225 1:4936441-4936463 GACGCTGCTGACCACCAGCCTGG - Intergenic
901555401 1:10027991-10028013 GCCTGAGGCCAGCACCAGCCTGG - Intergenic
901624094 1:10613769-10613791 CCCTCATGCCACCACCAGCCAGG - Intronic
901867363 1:12115789-12115811 GCCTCTCCCCACCAACAGCCAGG + Intronic
902372664 1:16015900-16015922 GCCTGTGGCCATCACCACCCTGG - Intronic
903044452 1:20554443-20554465 GACTCTGCCCACCGCCGGCCCGG - Exonic
903318503 1:22527268-22527290 GACTGTGACCAGCACCAGGCAGG + Exonic
903494013 1:23752278-23752300 GACTGTGGCCCCCTCCAACCTGG + Intronic
904310117 1:29623708-29623730 GCTTCTCGCCACCACCAGACTGG - Intergenic
905301808 1:36990778-36990800 AACTCTGGCCACCAACTCCCAGG - Intronic
905923571 1:41734461-41734483 GACTATGTTCAACACCAGCCTGG - Intronic
907190676 1:52645359-52645381 GTCTCTGGTCTCCACCAGGCTGG - Intronic
907267465 1:53271613-53271635 GGCTCTGTCCACCACCAAGCTGG + Intronic
909907795 1:81220951-81220973 GCCTCTCGGCACCAACAGCCTGG + Intergenic
913119729 1:115728827-115728849 GACTATCACCACCACCAGGCGGG - Intronic
915513628 1:156400587-156400609 GGCTTTGCCCACCCCCAGCCTGG - Intergenic
918109716 1:181444743-181444765 GATTCAGGCCAGCACCAGCTGGG + Intronic
918184690 1:182116341-182116363 TTCTCTGGTCACCACCACCCTGG - Intergenic
920699954 1:208210363-208210385 GACCCTGTACACCACCAGCAGGG - Exonic
920816728 1:209341308-209341330 GGCTGGGGCCACCACCACCCCGG - Intergenic
922793258 1:228322289-228322311 GACTCTAGCTACGACTAGCCTGG - Intronic
923015732 1:230125409-230125431 GACGCTGTCAAACACCAGCCAGG - Intronic
923406557 1:233666763-233666785 GACGATGGCCACCACCTGCTTGG - Exonic
1065629048 10:27659221-27659243 GATTCTGCCCACCTCCATCCTGG + Intergenic
1067806098 10:49394837-49394859 GGCCCTGCCCACCACCTGCCCGG - Intronic
1068874509 10:61981909-61981931 GACTTTGGTCCCCACCAACCTGG + Intronic
1070670843 10:78376313-78376335 CACTCTGGGCACCTCCACCCTGG - Intergenic
1071504043 10:86222285-86222307 CACTCTGCCCACCCCAAGCCTGG + Intronic
1071692789 10:87839954-87839976 GTCTCTGGCCACCACTGGCAGGG - Intronic
1072799135 10:98380680-98380702 GTCTCTGGACACCATCACCCAGG + Intergenic
1075580528 10:123614441-123614463 GACTCAGGCCACCATCGACCTGG - Intergenic
1075895295 10:125989884-125989906 GACTCCGGGCAACCCCAGCCAGG + Intronic
1076688251 10:132207887-132207909 CACTGTGGGCACCGCCAGCCAGG + Exonic
1076738248 10:132468211-132468233 GACTCTGACCACCCCCAGAGCGG - Intergenic
1077120911 11:908031-908053 GACTGTGGCTACCCCCAGGCAGG + Intronic
1077187560 11:1242196-1242218 GACTAACACCACCACCAGCCAGG + Exonic
1077467878 11:2742233-2742255 GATTCTGGCCAGCACCACCCAGG - Intronic
1078476577 11:11635302-11635324 GACTCAGCCCACACCCAGCCAGG + Intergenic
1081428329 11:42949823-42949845 GACTCTGGCCTTGGCCAGCCCGG - Intergenic
1082773133 11:57224285-57224307 GTCTCAGGCCACCCCCTGCCTGG + Intergenic
1083545648 11:63547145-63547167 CACTGTGGCCACCACCACTCTGG + Intergenic
1084434006 11:69127439-69127461 CACTCTGGCTGCCACCCGCCCGG - Intergenic
1085408978 11:76280673-76280695 GACTTCGGGGACCACCAGCCAGG + Intergenic
1086106713 11:83155800-83155822 GACTCTCGCTGTCACCAGCCTGG + Intergenic
1088089142 11:106017317-106017339 AACTCTGTCTACCACCAACCTGG + Intronic
1089126401 11:116179552-116179574 CACTAGGGCCACCACCACCCCGG - Intergenic
1089277903 11:117351772-117351794 AACTCTGCCCATCCCCAGCCAGG + Exonic
1090682696 11:129078141-129078163 GACACTCCCCAGCACCAGCCCGG + Intronic
1092060522 12:5546909-5546931 GAGTCATGCCACCACCAACCGGG + Intronic
1096195846 12:49648350-49648372 GACACTGGTCACCAAAAGCCTGG + Exonic
1096409282 12:51365467-51365489 CACGCTGGCCCCCAGCAGCCGGG + Exonic
1096691204 12:53322937-53322959 GACGCTTGCCACCACCACGCTGG - Intronic
1096980537 12:55726036-55726058 GACCCTGTCCACCTCCATCCTGG + Intronic
1097153450 12:56995863-56995885 GGCCCTGTCCACCACCATCCTGG + Exonic
1097835271 12:64266557-64266579 CACTATGTCCACCACCAGCAGGG - Exonic
1099100913 12:78439457-78439479 GGCAGTAGCCACCACCAGCCTGG - Intergenic
1099211328 12:79792702-79792724 GACTCCAGCCCCCACCAGGCTGG - Intronic
1099687402 12:85907882-85907904 GCCTCTGGCCACCTCCTGCCAGG + Intergenic
1100421234 12:94435917-94435939 GACATTCGCCAGCACCAGCCTGG + Intronic
1101107611 12:101455650-101455672 GGCTCTGGCCACCTTCAACCCGG - Intergenic
1101898022 12:108770301-108770323 GCCGCTGGCCCCCACCAGGCTGG + Intergenic
1101898072 12:108770450-108770472 GCCGCTGGCCCCCACCAGGCTGG + Intergenic
1102111738 12:110370602-110370624 CGCCCAGGCCACCACCAGCCTGG - Intergenic
1103419187 12:120766422-120766444 GACTTTGCCCAGCAGCAGCCAGG - Intronic
1104485893 12:129150936-129150958 AGGCCTGGCCACCACCAGCCAGG - Intronic
1104901521 12:132191905-132191927 GCCCCTGGTCAACACCAGCCCGG + Intergenic
1104913502 12:132251830-132251852 GCCTCTGGGCACCCACAGCCTGG + Intronic
1105957980 13:25301803-25301825 GACTCTGGGCTCCACCACCGTGG + Exonic
1106428591 13:29657874-29657896 GTCTCTGGCCAGCACCAGCCTGG - Intergenic
1108069796 13:46616771-46616793 GACTCAGCCCACCAGCACCCAGG - Intronic
1108636236 13:52337545-52337567 GTCTCTGGACTCCAGCAGCCTGG + Intergenic
1108651573 13:52485690-52485712 GTCTCTGGACTCCAGCAGCCTGG - Intergenic
1108832311 13:54495117-54495139 GACTCAGCCCACCAGCACCCAGG + Intergenic
1112153934 13:96796951-96796973 GACTCTGACTACCACTTGCCAGG + Intronic
1113133973 13:107068642-107068664 GTCTCTGGCCTCCAGAAGCCTGG + Intergenic
1113388174 13:109870349-109870371 CACTCTGACCACCAGTAGCCAGG - Intergenic
1114792396 14:25674110-25674132 CACGCTGGCCATCACCAGCCAGG - Intergenic
1115474597 14:33800740-33800762 GACCCTGGCCGCCACCAGCACGG + Exonic
1117008765 14:51449126-51449148 GACTGTGGCCACCAGCAGCTGGG - Intergenic
1117426651 14:55605510-55605532 TACTCTGGGCACCACCAGCTGGG + Intronic
1118774839 14:68967248-68967270 GACTCAGACTACCACCACCCAGG + Intronic
1121851780 14:97228005-97228027 GAGTCTGACCAGCACTAGCCTGG - Intergenic
1122695436 14:103549986-103550008 GACTCCTGCCACCACCTACCTGG - Intergenic
1123422907 15:20145891-20145913 GACTCTAGCACCCAGCAGCCAGG + Intergenic
1123532133 15:21152431-21152453 GACTCTAGCACCCAGCAGCCAGG + Intergenic
1123984230 15:25630834-25630856 GACTCTGGACAGCACCTCCCAGG - Intergenic
1124685160 15:31776377-31776399 GATTCTGGCAGCCACCATCCAGG - Intronic
1126096509 15:45094514-45094536 GACTCTGGCCTTCTCCTGCCAGG - Intronic
1127696927 15:61459285-61459307 GCCCCTGGCCATCAGCAGCCTGG - Intergenic
1128333732 15:66773039-66773061 TACACTGGCCACCACCCTCCAGG - Intronic
1129261953 15:74373664-74373686 GACTGAGGCCACCCTCAGCCAGG + Intergenic
1129788158 15:78322830-78322852 GCCTCAGGCCTCCACCAGGCCGG - Intergenic
1130987339 15:88853169-88853191 GACTCTGGCAACCACGAGTGGGG + Intronic
1132012250 15:98286336-98286358 ACCCCTGGCCACCACCAGCCTGG - Intergenic
1132353992 15:101158049-101158071 GACCCTGCTCTCCACCAGCCAGG + Intergenic
1132542870 16:519459-519481 GGCTGTGGGCACCTCCAGCCGGG - Intronic
1132544844 16:528225-528247 AGCCCTGGCCCCCACCAGCCTGG - Intronic
1132623855 16:880831-880853 CACTCTTCCCACCACCACCCTGG - Intronic
1132645707 16:998403-998425 GGCTCTGGGCGCCACCTGCCTGG - Intergenic
1132804941 16:1771067-1771089 CACCATGGCCACCACCGGCCCGG + Exonic
1132877650 16:2147581-2147603 GACTCTGGGCACTGCCAGCTGGG + Intronic
1133038520 16:3047341-3047363 CTCTCTGCCCACCACCATCCTGG - Intronic
1133271708 16:4613745-4613767 GCCTCTGGGCAGCACAAGCCAGG + Intronic
1133325103 16:4937313-4937335 GACGCCGCCCACCCCCAGCCGGG + Intronic
1133737710 16:8628553-8628575 AGCTGTGACCACCACCAGCCAGG - Intronic
1134093782 16:11405565-11405587 GACTGTGGCACCCACCAGCAGGG - Intronic
1134246311 16:12542691-12542713 GACTGGGACCAACACCAGCCTGG - Intronic
1135046449 16:19159723-19159745 GACGATGCCCACCACCAGCCAGG - Intronic
1135189535 16:20343809-20343831 GACTCTGTCCCCCACTGGCCAGG + Intronic
1135353761 16:21752365-21752387 AATTCTGGCCACTACCACCCTGG - Exonic
1135408747 16:22217450-22217472 GACTCTGTCCAAACCCAGCCAGG - Intronic
1135452250 16:22568503-22568525 AATTCTGGCCACTACCACCCTGG - Intergenic
1135598903 16:23764868-23764890 GACTCTGGCCTGCACCAGCTGGG + Intergenic
1136398715 16:30006461-30006483 CACTCTGGCCACCAAGACCCTGG - Exonic
1136560201 16:31034387-31034409 CACTCTGGCCACCACCTGCGTGG - Intronic
1138193906 16:55038373-55038395 GACTCTGGCACCCATCAGTCTGG - Intergenic
1138599894 16:58047971-58047993 GACACTGCCCTCCACCTGCCCGG - Intergenic
1141132619 16:81445775-81445797 GACTCGGCCCACCGCCAGGCTGG + Intronic
1141285226 16:82665687-82665709 GACTCTGCCCAACTCCAGACAGG + Intronic
1141664865 16:85460818-85460840 GACTCTCCCCACCCCCACCCTGG - Intergenic
1142003633 16:87678827-87678849 GAGTAAGGCCACCACGAGCCTGG + Intronic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1143027681 17:3950804-3950826 GGCTTTGGGCACCACCAGCTGGG + Intronic
1143381869 17:6501653-6501675 CACTCTGCCCACCACCTCCCTGG + Intronic
1143389138 17:6549824-6549846 GACCCTGGCCACCCCCTTCCGGG + Intronic
1143591494 17:7887985-7888007 GGCCTCGGCCACCACCAGCCAGG - Intronic
1144208182 17:12993901-12993923 GACCCTGGCCATCAACTGCCAGG + Intronic
1145306995 17:21680904-21680926 GACTCTCGCCAGCACCATCTGGG + Intergenic
1151069149 17:71188495-71188517 GCCTTTAGACACCACCAGCCTGG + Intergenic
1152034682 17:77864805-77864827 GTGTCTGTCCAACACCAGCCGGG + Intergenic
1152318787 17:79596406-79596428 GAGTGTGCCCAGCACCAGCCAGG + Intergenic
1152608653 17:81305185-81305207 GGCTGTGCCCTCCACCAGCCAGG + Intergenic
1152666989 17:81576829-81576851 GACTCTGGCAAGGACCAGGCAGG - Intronic
1154416020 18:14175608-14175630 GGCTCTAGCCTCCAGCAGCCGGG + Intergenic
1156020980 18:32598641-32598663 GACTTTCCCCAGCACCAGCCTGG + Intergenic
1156467998 18:37360223-37360245 ATCTCTGGCCACCACCACCATGG + Intronic
1156980153 18:43277257-43277279 GGCTCCGATCACCACCAGCCGGG - Exonic
1157167652 18:45373010-45373032 CAATCTGGTCACCACTAGCCAGG - Intronic
1160229281 18:77034254-77034276 GACTCCTGCCACCACTAGCAAGG + Intronic
1160238609 18:77106057-77106079 GACTCTGGTCACCTGCAGCGTGG - Intronic
1160308066 18:77759757-77759779 GACATTGGCCACCAGCAGCAAGG + Intergenic
1160475203 18:79178058-79178080 GACTCTACCCACCACCAAGCAGG - Intronic
1160538191 18:79606579-79606601 AACTCTGGCCAGGGCCAGCCCGG + Intergenic
1161652234 19:5492517-5492539 GGCTCTGGCATCCACCAGCTTGG - Intergenic
1161837993 19:6660811-6660833 GACTCTGTCCTCCAGCATCCTGG + Intergenic
1162120841 19:8466783-8466805 GCCACTGCACACCACCAGCCTGG + Intronic
1162336197 19:10061994-10062016 GACTCTGGCCCTCACCTCCCGGG - Intergenic
1163202763 19:15780293-15780315 CAGTCTGACCACCCCCAGCCTGG + Intergenic
1163296675 19:16417218-16417240 GGCTCTGCCCACGACCTGCCTGG + Intronic
1163296684 19:16417259-16417281 GGCTCTGCCCACGACCTGCCTGG + Intronic
1163449751 19:17369423-17369445 TGATCTGCCCACCACCAGCCTGG + Intronic
1163460956 19:17437186-17437208 GACTCTGGAGCCCACCAGCCTGG - Intronic
1163550928 19:17966252-17966274 AGCTCTGTCCCCCACCAGCCTGG - Intronic
1163645723 19:18487989-18488011 CACTCTGGCCACAACCAGGCTGG + Intronic
1164727538 19:30476299-30476321 GACTCTGGCCATTAGCATCCTGG + Intronic
1165102574 19:33447562-33447584 GCCTGTGCCCACCAGCAGCCTGG + Intronic
1165114945 19:33523027-33523049 GCCCCTGGCTCCCACCAGCCTGG - Intergenic
1165272459 19:34722774-34722796 GACTCTGTCCTCCAGCATCCTGG - Intergenic
1166171460 19:41030184-41030206 GACTCTCCCCACCCCCACCCTGG - Intergenic
1166705656 19:44906542-44906564 GACTCCTCCCACCCCCAGCCCGG - Intronic
1166826737 19:45614529-45614551 GACTCTGGAAACCACCAGCGGGG + Intronic
1166976759 19:46609449-46609471 GCCTCTGCCCTCCTCCAGCCCGG + Exonic
1167455257 19:49594471-49594493 GACACTGGCCTCCACCACGCGGG + Exonic
1167610729 19:50506649-50506671 GGCCCTCACCACCACCAGCCTGG - Intronic
1168615390 19:57833311-57833333 CTCTGTGGCCACCACCAGCACGG + Intronic
1168621394 19:57882136-57882158 CTCTGTGGCCACCACCAGCACGG - Intronic
1168720167 19:58550493-58550515 AACTCAGGCCAGCACCAGGCAGG - Exonic
925817648 2:7769007-7769029 CACTCTTGACACCACCAGGCCGG + Intergenic
926492628 2:13543642-13543664 ATCTCTGGCCTCCACCAGCCAGG - Intergenic
927916847 2:26942615-26942637 GCCACTGGTCACCATCAGCCGGG + Exonic
927919599 2:26961767-26961789 GCCCCTGGCCACCTCCAGGCTGG + Intergenic
929763820 2:44827802-44827824 GACTCAGGACAGCACCAGACTGG + Intergenic
930263483 2:49173228-49173250 GACTGTGCCCACCAGCAGCCAGG - Intergenic
930575561 2:53142640-53142662 TAGTCTGGCCATCCCCAGCCAGG - Intergenic
931836977 2:66109267-66109289 GCCTCTAGTAACCACCAGCCAGG - Intergenic
940962336 2:159799107-159799129 GCCTCTGGACAACACTAGCCAGG + Intronic
942116846 2:172736141-172736163 GACCCCGGCCACCCGCAGCCCGG - Intronic
946215384 2:218179524-218179546 GACTCAGCCCACCAGCACCCAGG - Intergenic
946410560 2:219513315-219513337 GATTCTTGCCACCCCCACCCTGG + Intergenic
946874156 2:224111258-224111280 GACATTCCCCACCACCAGCCTGG + Intergenic
947490907 2:230593793-230593815 GACCCTGAGGACCACCAGCCTGG + Intergenic
947961993 2:234247623-234247645 GGCTCTGGCCTCGGCCAGCCCGG - Intergenic
948050676 2:234977220-234977242 GACACTGGGCACCTCCTGCCGGG + Intronic
948795430 2:240400007-240400029 GACTCAGGGACCCACCAGCCTGG + Intergenic
948805717 2:240452836-240452858 GACTCTGGCCGCAGCCACCCCGG - Intronic
948864838 2:240770041-240770063 GACACTGCCCAACATCAGCCTGG + Intronic
1170588776 20:17755233-17755255 CAACCTGGCCACCACCAGCCAGG - Intergenic
1170606895 20:17881625-17881647 GACTCAGGCCTCCACCACCATGG - Intergenic
1172613002 20:36265742-36265764 GACTCTGTCCATCACCTGGCAGG + Intronic
1173596340 20:44260940-44260962 GACCCTGCCTACCAACAGCCAGG - Intronic
1173699215 20:45052713-45052735 GACTCTTGCCACCACCTTTCTGG + Intronic
1175744380 20:61445160-61445182 GACCCTGGCCACCTCTGGCCAGG + Intronic
1175754329 20:61519925-61519947 GACTCTGCCCACCAACTGCTGGG + Intronic
1176086157 20:63296511-63296533 GACTGTGGCCGCACCCAGCCTGG - Intronic
1176254467 20:64143724-64143746 GACTCTGGTCCCCACCCACCTGG - Intergenic
1176857325 21:13983686-13983708 GGCTCTAGCCTCCAGCAGCCTGG - Intergenic
1177703831 21:24674474-24674496 GAGTCCGGCCCTCACCAGCCTGG - Intergenic
1178323364 21:31623214-31623236 CACTCTGGACACCAACAGCCTGG - Intergenic
1178617212 21:34144750-34144772 GCCTCGGACCACCACCAGCCTGG - Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179539872 21:42077173-42077195 GACCCTGGCCAACACCAAGCTGG - Intronic
1180121087 21:45748662-45748684 GCCTCTGGCCACATCCAGCAGGG + Intronic
1180145381 21:45915755-45915777 GACTCTGTCCTCCACCACCAAGG - Intronic
1180785493 22:18544861-18544883 TACTCTGGGCACCGCCAGTCTGG - Intergenic
1180865951 22:19120004-19120026 GCCTCTTGCAAGCACCAGCCAGG + Intronic
1181019121 22:20089327-20089349 GCCTCTGGCCACAACCAGACAGG + Intronic
1181242397 22:21484214-21484236 TACTCTGGGCACCGCCAGTCTGG - Intergenic
1181638466 22:24185016-24185038 CACTCTCCCCACCCCCAGCCTGG - Intronic
1181734980 22:24874490-24874512 CCCTCTGGCCACCACCAGCATGG - Exonic
1181874788 22:25931607-25931629 GAGTCTGGCCACCACCTGTCCGG - Intronic
1181968218 22:26671343-26671365 GCCTCCCGCCCCCACCAGCCAGG - Intergenic
1183358486 22:37371664-37371686 CACTCTGGGCACCAACTGCCAGG + Exonic
1184109457 22:42386549-42386571 GACTTTAGCCAACACCAACCTGG + Intronic
1184864738 22:47195830-47195852 GACGCTGTTCACCACCAGCTGGG - Intergenic
1185013510 22:48330385-48330407 GGCTCTGTCCACCACCAGCTTGG + Intergenic
1185331360 22:50253422-50253444 GACCCTGGCCCCCAGCTGCCGGG + Exonic
949508884 3:4751393-4751415 CTCTGTGGCCACCACCAGGCCGG - Intronic
949895436 3:8764700-8764722 GACTCTGGCCACCACCAGCCTGG - Intronic
950303306 3:11900024-11900046 GATGCTGGCCACCTCCGGCCGGG - Intergenic
950506751 3:13399831-13399853 GATGCTGGCCACCTCCGGCCGGG + Exonic
950604341 3:14064943-14064965 GCCTCTGCCCCCCATCAGCCTGG + Exonic
950770595 3:15307782-15307804 GGCACTGGCCACCACCAGGGAGG - Intronic
953847112 3:46436415-46436437 GAGTCTAGCCCTCACCAGCCAGG + Intronic
956891215 3:73616012-73616034 CTCTCTGCCCACCACCACCCTGG - Intronic
957913514 3:86654996-86655018 GACTCTTTCCACCACTAGCCTGG - Intergenic
958768215 3:98396048-98396070 GACTTTCCCCAGCACCAGCCTGG + Intergenic
959063001 3:101632882-101632904 GACTCTGTCCTCCAGCATCCTGG - Intergenic
960943248 3:122948190-122948212 ACCCCTGGCCACCCCCAGCCAGG + Intronic
961315041 3:126028688-126028710 GCATCTTGCCACCATCAGCCTGG + Intronic
961387497 3:126530650-126530672 GACTCAGGCCACACCCAGCCTGG + Intronic
962122903 3:132582761-132582783 GACTCTGTTCACCTCCAGGCTGG + Intronic
963123928 3:141798027-141798049 GACTCTGTCCAGGGCCAGCCTGG + Intronic
963170268 3:142243224-142243246 CCCTCTGGTCTCCACCAGCCAGG + Intergenic
966588670 3:181654924-181654946 GACTGTGGCCACCAATAGCCGGG + Intergenic
967657626 3:192071175-192071197 GACTCAGCCCACCAGCACCCAGG - Intergenic
967945595 3:194801541-194801563 GCTTCTGGGCACCAGCAGCCAGG + Intergenic
968628937 4:1640366-1640388 GACTCTGACCACCAACGCCCGGG + Exonic
968950259 4:3687827-3687849 GGCTCACGCCACCACCTGCCTGG - Intergenic
969148350 4:5143894-5143916 CACTCCAGCCTCCACCAGCCAGG + Intronic
969571934 4:8014159-8014181 GACTCTGGCAGCCAGGAGCCAGG + Intronic
969702161 4:8773660-8773682 ACCTCTGGCCTCCACCAGGCGGG - Intergenic
969717319 4:8874027-8874049 GAGGCTGGCCACCACCAGGCGGG + Intergenic
970324459 4:14909033-14909055 TTCTCTGGGCCCCACCAGCCAGG + Intergenic
972826851 4:42768478-42768500 GACACTCCCCAGCACCAGCCTGG + Intergenic
977557394 4:98499226-98499248 GCCTCTGCCCACCGCCTGCCCGG - Intronic
981748637 4:148073282-148073304 GATGATGGCCACCCCCAGCCTGG + Intergenic
982380475 4:154743289-154743311 CAGCCTGGCCAACACCAGCCTGG + Intronic
985258998 4:188097636-188097658 AACTCTGGCCACCCCCTGCATGG - Intronic
986963547 5:13244152-13244174 GACTCCGGCCTCGGCCAGCCCGG - Intergenic
991929908 5:71744135-71744157 GGCTCCTGCCACCCCCAGCCAGG + Intergenic
992025289 5:72663749-72663771 GATGGTGGCCACCACCAGCTCGG - Intergenic
992407114 5:76470123-76470145 GACTCTGGCCAACAGCAGCAAGG - Intronic
996862695 5:128083866-128083888 GGCTGTGGCCACCGCCGGCCAGG + Exonic
997806668 5:136924658-136924680 GCCTCTGGCCCCTACCTGCCAGG + Intergenic
998140600 5:139697533-139697555 CACTCCGCCCCCCACCAGCCAGG - Intergenic
999709952 5:154309245-154309267 CACACTGGCCTCCACAAGCCAGG - Intronic
999729550 5:154466390-154466412 GACTCTGTCCTCCAGGAGCCAGG + Intergenic
1000843587 5:166252031-166252053 AACTCGGGCCTCCAGCAGCCAGG - Intergenic
1001194472 5:169659357-169659379 GAAGCTGTCTACCACCAGCCTGG + Intronic
1001821397 5:174713126-174713148 GACTCTAGTCGCCACCAGCCAGG - Intergenic
1002106355 5:176881190-176881212 CACTGTGGCCGCCACCAGGCTGG + Exonic
1005290552 6:24374917-24374939 GACACTGGTCACCACAAGCTGGG - Intergenic
1006299525 6:33186151-33186173 GTCTCTGGCCCCCACCTACCTGG - Intronic
1006394124 6:33776011-33776033 GACTCTGCCCTCCCCCACCCTGG + Intronic
1006765338 6:36500024-36500046 AACTCTGGGCACCTCCTGCCTGG - Intronic
1006928605 6:37673675-37673697 TCCTCTGTTCACCACCAGCCGGG + Intronic
1007250235 6:40490325-40490347 GCCTCAGGCCACCACCAGTGTGG + Intronic
1007351056 6:41273812-41273834 CACTCCTGCCACCACCTGCCAGG + Intronic
1007582445 6:42967526-42967548 GGTTGTGGCCACCACAAGCCGGG - Exonic
1007704283 6:43781459-43781481 CCCTCTGGCCACCAGCGGCCTGG + Intronic
1011606386 6:89110423-89110445 GACTTGGCCCACCACCAGTCTGG + Intronic
1012049078 6:94316663-94316685 CATTCTGCCCACCACCTGCCTGG - Intergenic
1014749993 6:125245028-125245050 GACATTTGCCAGCACCAGCCTGG - Intronic
1018008975 6:159650461-159650483 GGCTCTGGCCTCCAACAACCTGG - Intergenic
1018167265 6:161109930-161109952 GGCTCTGGCCCACAGCAGCCAGG - Intronic
1018501098 6:164411724-164411746 GACTCCGGCCACCAGGAGCGGGG + Intergenic
1018643674 6:165928676-165928698 GACGTCGGCCACCAGCAGCCGGG - Intronic
1018709946 6:166491170-166491192 CACTCTAGCCCCCACCATCCAGG - Intronic
1019158610 6:170054966-170054988 GACACTGACCACCACGTGCCAGG + Intergenic
1019158619 6:170055017-170055039 GACACTGACCACCACGTGCCAGG + Intergenic
1019158636 6:170055119-170055141 GACACTGACCACCACGCGCCAGG + Intergenic
1019158644 6:170055169-170055191 GACACTGACCACCACGCGCCAGG + Intergenic
1019158661 6:170055270-170055292 GACACTGGCCACCACGCGCCAGG + Intergenic
1019158684 6:170055417-170055439 GACACTGACCACCACGCGCCAGG + Intergenic
1019158708 6:170055567-170055589 GACACTGACCACCACGCGCCAGG + Intergenic
1019158719 6:170055618-170055640 GACACTGGCCACCACGCACCAGG + Intergenic
1019158735 6:170055718-170055740 GACACTGACCACCACGCGCCAGG + Intergenic
1019158762 6:170055869-170055891 GACACTGACCACCACGCGCCAGG + Intergenic
1019492238 7:1321025-1321047 GACTCTGCCCCGCAACAGCCTGG + Intergenic
1022359592 7:29645572-29645594 GACTCTGTCCTCCAGCATCCTGG + Intergenic
1022445644 7:30468549-30468571 CATTCTGCCCACCACCATCCTGG + Intronic
1022447958 7:30485194-30485216 GACTCAGCCCACCTCCACCCAGG + Intergenic
1022649215 7:32259469-32259491 GACTCTGCCTCCCACCAGCTGGG + Intronic
1023413511 7:39910606-39910628 GACACTTCCCAGCACCAGCCTGG + Intergenic
1024239960 7:47427162-47427184 GTCTCTGTCCAGAACCAGCCAGG + Intronic
1024255840 7:47539490-47539512 GACTCTGACCTCCTCCTGCCAGG + Intronic
1024953989 7:54896625-54896647 GGCTCTGGTCAGCTCCAGCCTGG + Intergenic
1029118579 7:98251625-98251647 GACTCAGGACACCTCCTGCCCGG - Intronic
1030307186 7:108030819-108030841 GAATCTGCCCAACACCAGGCTGG - Exonic
1033626048 7:143110421-143110443 GACTCAGGCCACCTGCACCCAGG + Intergenic
1034988378 7:155531882-155531904 GCCTCTGGCCACTGTCAGCCCGG + Intronic
1035281223 7:157779655-157779677 GACTCTGGCCAGGACGAGCTGGG + Intronic
1036644079 8:10601294-10601316 GCCTCTCACCACCCCCAGCCAGG - Intergenic
1036765604 8:11547719-11547741 GCCTGAGGCCACCAGCAGCCCGG + Intronic
1038437374 8:27545515-27545537 GCCCCTGCCCACCCCCAGCCCGG + Exonic
1039420268 8:37431998-37432020 GCCCATGCCCACCACCAGCCTGG + Intergenic
1040323061 8:46328173-46328195 GTCTCTAGCCCCCACCAGGCGGG + Intergenic
1040468140 8:47714125-47714147 CACTCCTGACACCACCAGCCTGG - Intronic
1043428834 8:80174978-80175000 GACTCTGTCCTGCACCAGGCTGG + Intronic
1047856892 8:128920232-128920254 GACTCAGCCCACCTGCAGCCAGG + Intergenic
1049324822 8:142016408-142016430 GACTCTGGCCATGTGCAGCCTGG - Intergenic
1049474600 8:142790841-142790863 GCCTGTGGGCACCACCAGCCAGG - Intergenic
1049543611 8:143219492-143219514 GACTGTGGCCACCAGGGGCCCGG - Intergenic
1049935308 9:496038-496060 GGCTCTGGCCTCCAGCAACCTGG + Intronic
1053410823 9:37915042-37915064 GAGTCTGGCCACCTCCCACCAGG + Intronic
1053428956 9:38029179-38029201 AACTCTGCCCAGCCCCAGCCTGG + Intronic
1055922811 9:81479376-81479398 GCCTCTGGAAACCACCAACCTGG - Intergenic
1056975577 9:91250136-91250158 GAACCTGGCCTCCACCTGCCAGG + Intronic
1057340565 9:94197812-94197834 GACACTCCCCAGCACCAGCCTGG - Intergenic
1058425305 9:104870731-104870753 GACTCAGCCCACCTGCAGCCAGG - Intronic
1059545698 9:115174718-115174740 GACTCAGGCCACCTGCACCCAGG - Intronic
1060406839 9:123377007-123377029 GACACTGTCCATCTCCAGCCGGG - Exonic
1061299686 9:129697508-129697530 CGCTCTGGCCGCCACCAGCGCGG + Intronic
1061921081 9:133782942-133782964 GCCTCTGCCCACTGCCAGCCTGG + Intronic
1061959407 9:133980351-133980373 GACTCTGGGCAGCACCAGGTGGG - Intronic
1062042786 9:134411842-134411864 GTCTCTTGCCTCCCCCAGCCTGG + Intronic
1062337314 9:136077722-136077744 GACTCTGGCCACCCCCACACCGG + Intronic
1062347634 9:136122729-136122751 GACACAGGCCACCAACAGGCGGG - Intergenic
1062521042 9:136958079-136958101 GACTTGGGCCTTCACCAGCCTGG + Intergenic
1203770044 EBV:45250-45272 GGCCCTGGCCATCACCAGACCGG - Intergenic
1189376645 X:40471792-40471814 GACTCTGACCACCCCGAGCATGG - Intergenic
1190472685 X:50798775-50798797 AACTCTGACGATCACCAGCCCGG + Intronic
1191785717 X:64915408-64915430 AACTCTGAGCACCAACAGCCAGG - Intergenic
1197462102 X:126755364-126755386 GAATCTGGCCATCCCCAGCCAGG + Intergenic
1197818671 X:130524235-130524257 TACTCTGGCCACCACGATCTTGG - Intergenic
1199245484 X:145599224-145599246 GACTCCAGCCACCCCCAACCTGG + Intergenic
1199282894 X:146022649-146022671 GACACTCCCCAGCACCAGCCTGG + Intergenic
1199975421 X:152892388-152892410 GGCTCTGACCAGCACCAGCGTGG + Intergenic
1201283597 Y:12361015-12361037 GACTCTGTCCTCCAACATCCTGG + Intergenic
1202337144 Y:23824503-23824525 GACTCTGTCCTCCAGCATCCTGG - Intergenic
1202533621 Y:25845568-25845590 GACTCTGTCCTCCAGCATCCTGG + Intergenic