ID: 949901424

View in Genome Browser
Species Human (GRCh38)
Location 3:8817970-8817992
Sequence CAAATGCAACACATTTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949901424 Original CRISPR CAAATGCAACACATTTAGTC AGG (reversed) Intronic
900670133 1:3847474-3847496 CAAATACAACATATATAATCAGG - Exonic
902843518 1:19091143-19091165 CAAAGGCAACACAATGAGTTTGG - Intronic
903213364 1:21830527-21830549 AAAATGCAAAAAATTTAGCCAGG + Intronic
904504820 1:30943145-30943167 AAAATGCTACACTTGTAGTCTGG + Intronic
905032469 1:34896426-34896448 CAAATACAAAACAGTTAGCCAGG + Intronic
906364085 1:45190747-45190769 GAAATGCAACACACTTACTAGGG + Intronic
907463813 1:54622113-54622135 AAAATACAAAAAATTTAGTCTGG + Intronic
908076425 1:60524483-60524505 CAGATGAAACACATTTAGTCTGG + Intergenic
908842138 1:68290731-68290753 AAAATACAAAAAATTTAGTCAGG - Intergenic
909217271 1:72905734-72905756 GAAATATAACAAATTTAGTCTGG - Intergenic
909289045 1:73858968-73858990 CAAATGCAAAAAAATTAGCCAGG - Intergenic
909958920 1:81812718-81812740 CATATGCAACTCATCTAATCTGG - Intronic
911255070 1:95623796-95623818 GAAATGCATAAAATTTAGTCTGG - Intergenic
913427862 1:118754818-118754840 AAAATGCAACACTTTTTTTCAGG + Intergenic
914044720 1:144081411-144081433 CCAACACAACACCTTTAGTCTGG - Intergenic
914133390 1:144879275-144879297 CCAACACAACACCTTTAGTCTGG + Intergenic
915338858 1:155165423-155165445 AAAATGCAACAAAATTAGCCAGG + Intergenic
915744669 1:158146728-158146750 CACATGCAACAAATTTTGTGAGG + Intergenic
917962648 1:180156718-180156740 CCATTTCAACACATTTGGTCAGG + Intronic
918407661 1:184226455-184226477 CAAAGGCTACACAGTTAGTAAGG - Intergenic
920494294 1:206443533-206443555 CAAATACAAAAAAATTAGTCTGG - Intronic
921738845 1:218660346-218660368 CTAATGCAACACATTTTTTCAGG - Intergenic
922383978 1:225062138-225062160 AAAATGCAAAAAAATTAGTCAGG + Intronic
924279259 1:242419554-242419576 AAAATGCAAAAAATTTAGCCGGG - Intronic
1063116541 10:3075742-3075764 AAAATACAAAACAATTAGTCAGG + Intronic
1063343444 10:5290249-5290271 AAAATGCAAAAAATTTAGCCGGG - Intergenic
1063713857 10:8507825-8507847 AAAATACAAAACAATTAGTCAGG - Intergenic
1065528893 10:26649064-26649086 AAAATACAAAAAATTTAGTCGGG - Intergenic
1066488498 10:35872072-35872094 CAAATTTAACCCATTTAATCTGG - Intergenic
1066956844 10:42181091-42181113 CCAACACAACACCTTTAGTCTGG - Intergenic
1068215769 10:53980058-53980080 CAAATACAAAAAAATTAGTCTGG + Intronic
1068532639 10:58207161-58207183 AAAATACAAAACATTTAGCCAGG - Intronic
1070126747 10:73628491-73628513 AAAATGCAAAAAAATTAGTCGGG - Intergenic
1074541230 10:114366805-114366827 AAAATACAACAAAATTAGTCAGG + Intronic
1075339717 10:121636817-121636839 GAAATGCAACACACTTAACCAGG - Intergenic
1076430750 10:130400332-130400354 AAAATGCAAAAAAATTAGTCAGG - Intergenic
1077764345 11:5141866-5141888 TAAATGCAAAACCTTTATTCTGG + Intergenic
1078192800 11:9106171-9106193 AAAATACAACAAAATTAGTCAGG + Intronic
1078498693 11:11846829-11846851 CAATTGCAGCACATTTCCTCAGG - Intronic
1079299186 11:19262294-19262316 TAAATGTAACACATTTTATCTGG + Intergenic
1081529536 11:43948426-43948448 CCAATGCTACACAGATAGTCAGG + Intergenic
1082050669 11:47767872-47767894 AAAATACAAAAGATTTAGTCGGG + Intergenic
1082704487 11:56476935-56476957 CAAATGCAACAAAACTAGTCAGG - Intergenic
1082839797 11:57679685-57679707 CAAAGGCAACAGATTCAGACAGG + Intronic
1083002292 11:59304070-59304092 CAAATGCAATACCTTTAAGCTGG - Intergenic
1085895968 11:80639704-80639726 AAAATGCAAAAAAATTAGTCAGG + Intergenic
1089804954 11:121078361-121078383 CAAATGCAAAACCATTAGACAGG - Intronic
1089994780 11:122896133-122896155 CCAGAGCAACTCATTTAGTCTGG + Intronic
1091055320 11:132412766-132412788 TTCATGCATCACATTTAGTCAGG - Intergenic
1091599515 12:1909350-1909372 AAAATGCAAAAAATTTAGCCGGG - Intronic
1092961196 12:13598263-13598285 CAACTGCAACAGATAGAGTCAGG - Intronic
1093791974 12:23262677-23262699 CAAATGCCTCACATATAGTTAGG - Intergenic
1093865037 12:24216321-24216343 AAAATACAAAACATTTAGCCGGG + Intergenic
1098244974 12:68507495-68507517 AAAATGCAAAACAATTAGCCAGG + Intergenic
1098952372 12:76654252-76654274 CAAGTGCCACACTTTTATTCGGG + Intergenic
1099790628 12:87330002-87330024 AAAATACAAAAAATTTAGTCGGG + Intergenic
1105479169 13:20757498-20757520 CAAAAGCAACAAATTGAGCCAGG - Exonic
1106778658 13:33033491-33033513 CAAATGCAAGACCTTCAGTGTGG - Intronic
1109053164 13:57510256-57510278 CATATGCAACACATTTAAAGAGG + Intergenic
1110595537 13:77317108-77317130 CAAATACAAAACAATTAGCCGGG - Intronic
1111154727 13:84307872-84307894 AAAATGCAAAAAATTTAGCCGGG + Intergenic
1111594379 13:90392085-90392107 TAAATGCAACATGTTTAGTGAGG + Intergenic
1112589931 13:100753657-100753679 CCAATGCAACACATCTATTGAGG - Intergenic
1112784282 13:102934718-102934740 AAAATGCAACAAAATTAGCCTGG + Intergenic
1112836546 13:103521869-103521891 CAAATGCAACACAATTCTTAAGG - Intergenic
1114036181 14:18630238-18630260 AAAATACAAAAAATTTAGTCAGG - Intergenic
1114168270 14:20244367-20244389 CAAATGAAATAGATTTAGTGGGG - Intergenic
1115629256 14:35227281-35227303 AAAATACAAAAAATTTAGTCGGG + Intronic
1202936269 14_KI270725v1_random:90689-90711 CCAACACAACACCTTTAGTCTGG + Intergenic
1123709217 15:22974568-22974590 AAAATGCAAAAAAATTAGTCAGG + Intronic
1123844996 15:24291156-24291178 AAAATACAAAACAATTAGTCGGG - Intergenic
1125625338 15:41104058-41104080 AAAATACAACAAAGTTAGTCAGG + Intronic
1129833801 15:78688932-78688954 CAAAAGCAAAAAAATTAGTCGGG - Intronic
1131438562 15:92441843-92441865 CAAATGCCACACAGCTAGTGAGG + Intronic
1134360588 16:13527390-13527412 AAAATGCACAAGATTTAGTCAGG + Intergenic
1135248917 16:20883350-20883372 AAAATACAAAACATTTAGCCGGG + Intronic
1136231695 16:28889415-28889437 CAAATGCAAAAAAATTAGCCAGG - Intronic
1137891167 16:52163266-52163288 CAAATAAAAAACATTTATTCAGG - Intergenic
1138174874 16:54888005-54888027 GAAATGCAAAAAAATTAGTCAGG + Intergenic
1139560872 16:67741227-67741249 CAACTGCCACACTTTTGGTCAGG + Intronic
1139836793 16:69845458-69845480 CAAAAGCTAAATATTTAGTCTGG - Intronic
1141389190 16:83650130-83650152 CAGGTGCAACACATTGATTCTGG - Intronic
1141492362 16:84382733-84382755 AAAATGCAAAACATTTAGCCAGG + Intronic
1141578116 16:84978189-84978211 AAAATGCAAAACAGTTAGCCGGG - Intronic
1143276717 17:5717013-5717035 AAAATACAAAACAATTAGTCGGG - Intergenic
1144295649 17:13872631-13872653 AAAATACAACAAAATTAGTCTGG + Intergenic
1147867311 17:43561579-43561601 CACATGCAAAACATTTAGCCTGG - Intronic
1147870020 17:43580657-43580679 AAAATGCAAAAAAATTAGTCGGG + Intergenic
1148521610 17:48281476-48281498 CAAATGCTGCTCATTTAGGCTGG + Intronic
1149613917 17:57981744-57981766 CAAATGGGCCACATTTACTCAGG + Intronic
1151671181 17:75572502-75572524 CAAATGCAAAAAAATTAGTTAGG + Intronic
1151842921 17:76630431-76630453 TCAAAGCAACACATTTATTCAGG + Intronic
1155428289 18:25728590-25728612 AAAATACAAAACAATTAGTCAGG + Intergenic
1155609161 18:27643918-27643940 CAAATGCAAGCCATTTATTTGGG - Intergenic
1155960359 18:31989600-31989622 AAAATGCAAAAAAATTAGTCCGG - Intergenic
1156728426 18:40159190-40159212 AAAATGAACCACTTTTAGTCTGG - Intergenic
1158919879 18:62179583-62179605 AAAATGCAAAAAAATTAGTCAGG + Intronic
1162655466 19:12125756-12125778 AAAATACAAAACAATTAGTCAGG + Intronic
1163330848 19:16636578-16636600 CAAACAAAACAAATTTAGTCTGG - Intronic
1165581623 19:36869937-36869959 AAAATACAAAACAGTTAGTCAGG - Intronic
1167021300 19:46878179-46878201 AAAATACAAAACATTTAGCCAGG - Intergenic
1168323405 19:55524050-55524072 AAAATACAACAAAATTAGTCAGG + Intergenic
1202684278 1_KI270712v1_random:34816-34838 CCAACACAACACCTTTAGTCTGG - Intergenic
925218436 2:2117318-2117340 CTACTGCAACACATTTTCTCTGG - Intronic
926281759 2:11454503-11454525 AAAATGCAAAACAATTAGCCAGG - Intronic
927526785 2:23750588-23750610 TATATGCAACACATGTAGTTTGG - Exonic
927830307 2:26344670-26344692 AAAATGCAAAAAATTTAGCCGGG + Intronic
929194763 2:39173647-39173669 AAAATACAAAACAATTAGTCGGG + Intergenic
930827801 2:55711874-55711896 AAAATGCAAAAAATTTAGCCAGG - Intergenic
931495782 2:62805673-62805695 AAAATACAAAACAATTAGTCAGG - Intronic
932272552 2:70423622-70423644 TAAATGCAAGACACTTAATCAGG - Intergenic
933288476 2:80409807-80409829 CAAATGCCACAGTTTTAGTCAGG - Intronic
933889148 2:86750111-86750133 GAAATGCAAAACATTTATTAGGG + Intronic
934247440 2:90320031-90320053 CCAACACAACACCTTTAGTCTGG + Intergenic
934261885 2:91482572-91482594 CCAACACAACACCTTTAGTCTGG - Intergenic
934466711 2:94269728-94269750 CCAACACAACACCTTTAGTCTGG + Intergenic
935040478 2:99421508-99421530 CAGAGGCAGCACATTTCGTCTGG + Exonic
935817470 2:106860107-106860129 CAAATGCCACCTATTTAGTAAGG + Intronic
938015736 2:127865591-127865613 CAAATGTATCACATTTACTCTGG - Intronic
940071570 2:149694063-149694085 AAAATGCAAAAGATTTAGTTTGG - Intergenic
940433527 2:153622879-153622901 TAAATGTAACACATGTTGTCTGG + Intergenic
941425394 2:165338418-165338440 AAAATGCAACAAAATTAGCCAGG - Intronic
941828684 2:169929413-169929435 AAAATGCAAAAAAATTAGTCAGG + Intronic
942798507 2:179849419-179849441 CAAAGGCAACACATCTATTTGGG + Intronic
943935405 2:193908746-193908768 TAAATAAAACACATTTTGTCAGG - Intergenic
944686527 2:202122660-202122682 AAAATACAACAAATTTAGCCAGG - Intronic
947746540 2:232510912-232510934 AAAATACAAAACATTTAGCCAGG - Intergenic
1170025087 20:11880602-11880624 TAAAGGCAAGACATTTAGTTTGG + Intergenic
1170071577 20:12374867-12374889 CAAATGCACCACATATTCTCTGG - Intergenic
1170348572 20:15415243-15415265 CAAAAGGAACACATTTTGTAGGG + Intronic
1171200116 20:23233993-23234015 AAAATGCCACACATTTGGCCAGG + Intergenic
1172341715 20:34163070-34163092 AAAATGCAACAAAATTAGCCGGG - Intergenic
1172562039 20:35897725-35897747 AAAATACAACAAAATTAGTCGGG - Intronic
1175574163 20:60048066-60048088 CAAATGCCACTCAGGTAGTCAGG + Intergenic
1176587231 21:8598916-8598938 CCAACACAACACCTTTAGTCTGG - Intergenic
1177775976 21:25566680-25566702 ACAATGCAAAACATTTAGTTGGG - Intergenic
1179066047 21:38025722-38025744 CAAAATCAACACATTTGGCCGGG + Intronic
1180270062 22:10575913-10575935 CCAACACAACACCTTTAGTCTGG - Intergenic
1180280621 22:10690365-10690387 CCAACACAACACCTTTAGTCTGG + Intergenic
949269740 3:2200780-2200802 AAAATGCACCACATTCATTCAGG - Intronic
949901424 3:8817970-8817992 CAAATGCAACACATTTAGTCAGG - Intronic
950390477 3:12692729-12692751 AAAATGCAAAGCATTTAGGCCGG + Intergenic
951910743 3:27747978-27748000 CAAATGCAAATCATTTATTTGGG + Intergenic
952172106 3:30818401-30818423 CTAATGCATAATATTTAGTCTGG + Intronic
953318897 3:41954504-41954526 CAAATGCCACATTTTCAGTCTGG - Intronic
953696068 3:45160521-45160543 AAAATACAAAAAATTTAGTCTGG + Intergenic
958706911 3:97667324-97667346 CAAAAGTAACAGATTTAATCTGG - Intronic
963139450 3:141935550-141935572 AAAATACAAGACAATTAGTCAGG + Intergenic
964848664 3:161070446-161070468 CAGTTGCAACACAGTAAGTCAGG + Exonic
966470130 3:180279873-180279895 AAAATACAAAAAATTTAGTCAGG + Intergenic
966895573 3:184442256-184442278 GAAAAGCAACACCTTTAGCCAGG - Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968021384 3:195393566-195393588 CAAATGAGAAACTTTTAGTCAGG - Intronic
968376999 4:52064-52086 CAGATGCAACACCCTTAGTGAGG + Intergenic
969922127 4:10550332-10550354 AAAATACAACACAATTAGCCGGG + Intronic
971172523 4:24248283-24248305 AAAATGCAAAACAATTAGCCGGG - Intergenic
972096609 4:35354859-35354881 AAAATGCAAAAAATTTAGCCGGG + Intergenic
973292767 4:48485744-48485766 AAAAAGAAACACATTTAGTAAGG - Intronic
973576930 4:52298986-52299008 TAAATGCAACACAATTTGTCCGG + Intergenic
977825095 4:101521967-101521989 CAAATGATACAAATTTTGTCTGG - Intronic
978145715 4:105368954-105368976 TAAATGTAACACATTTACACAGG + Intergenic
978227968 4:106361401-106361423 CACATGCAAGACATCTTGTCTGG - Intergenic
978394188 4:108260590-108260612 CAAATGCAAAACATTGTCTCTGG + Intergenic
980639828 4:135563197-135563219 CAAATACAAAAAATTTAGCCAGG + Intergenic
982023500 4:151229344-151229366 CAAATGCTACACATTTGCTGTGG + Intronic
983775995 4:171608562-171608584 GGAATGCACCACATTTTGTCTGG + Intergenic
984499599 4:180542606-180542628 CACATGCAGTACATTTTGTCTGG - Intergenic
985112903 4:186564262-186564284 AAAATGCAAAAAATTTAGCCGGG - Intergenic
985233032 4:187842246-187842268 AAAATGCAAAAAATTTAGCCAGG + Intergenic
986214500 5:5706869-5706891 AAAATGCCACACATTGAGCCAGG + Intergenic
986520588 5:8613449-8613471 CAAATGCCAGACACTTAGGCAGG + Intergenic
987671799 5:21019290-21019312 CAGATGCAACACTCTTAGTTGGG + Intergenic
987808204 5:22797884-22797906 CAAAAGCAACACTATGAGTCAGG - Intronic
989640118 5:43576159-43576181 CAAAAGCAACAAAATTAGCCAGG + Intergenic
990086583 5:51986355-51986377 GAAATGCATCAGATATAGTCAGG - Intergenic
992730998 5:79669113-79669135 TAAATGCTACAGATTTAGTCAGG + Intronic
993183003 5:84579142-84579164 GAAATGCAGCACATTCAGACCGG + Intergenic
993213030 5:84979324-84979346 AAAATACAAAAAATTTAGTCAGG + Intergenic
993394956 5:87374575-87374597 CAAATACAAAACATTTACTAGGG + Intronic
995952798 5:117736976-117736998 CAACTGCAAGAGATGTAGTCAGG - Intergenic
997188891 5:131911173-131911195 TAAATGCCACACATTAAGTTAGG - Intronic
998324417 5:141266864-141266886 CAACAGCAAAACATTTACTCAGG + Intergenic
998486699 5:142509224-142509246 AAATTGCATCACATTTATTCAGG + Intergenic
998926575 5:147132888-147132910 CAAATGCAACAAAACTAGACTGG - Intergenic
1002275635 5:178102793-178102815 AAAATGCAAAACAATTAGCCGGG + Intergenic
1002669375 5:180853829-180853851 CAAAATCAACACATTTACTCAGG - Intronic
1005372034 6:25143597-25143619 AAAATGCAAAACAATTAGCCAGG + Intergenic
1007648250 6:43399255-43399277 AACATGCAACACATTCCGTCGGG - Intergenic
1007931712 6:45697875-45697897 CAAACAGAACACATGTAGTCAGG - Intergenic
1011394250 6:86889791-86889813 CAAAAGGAACACCTTTACTCTGG + Intergenic
1012119865 6:95353420-95353442 AAAATACAACAAAATTAGTCAGG + Intergenic
1013198004 6:107862941-107862963 CAAATGCAAAAAATTCAGGCAGG + Intergenic
1013472808 6:110479631-110479653 AAAATGCAAAACATTTGGCCAGG + Intergenic
1013529473 6:111005789-111005811 CAAATACAAAACAATTAGCCAGG - Intronic
1013809613 6:114029712-114029734 CATATAAATCACATTTAGTCTGG + Intergenic
1014755263 6:125295937-125295959 CAAAAGCAATACTTGTAGTCTGG - Intronic
1015960455 6:138643556-138643578 CTTATGCAACACATATAGTATGG - Intronic
1018255725 6:161916960-161916982 AAAATACAAAACATTTAGCCGGG - Intronic
1019025587 6:168960293-168960315 AAAATGCAAGACATTTATTAGGG + Intergenic
1019797042 7:3057972-3057994 AAAATGCAAAAAATTTAGCCAGG + Intergenic
1020976859 7:15017232-15017254 CAAAGGCAAAACAATTAGTGTGG - Intergenic
1021610283 7:22451034-22451056 CAAATGCAAAAAAATTAGCCAGG + Intronic
1023485870 7:40686102-40686124 CAACTGTACCACATTTACTCAGG - Intronic
1025608073 7:63053842-63053864 CAAAAACAACAAATTTAGTCAGG + Intergenic
1026250181 7:68663099-68663121 CAAACAAAACACATTTGGTCAGG + Intergenic
1026685522 7:72506159-72506181 AAAATGCAAAACAATTAGCCAGG + Intergenic
1026919214 7:74142746-74142768 AAAATACAAAACATTTAGCCGGG - Intergenic
1027214733 7:76176502-76176524 AAAATGCAAAACAGTTAGCCAGG - Intergenic
1027650212 7:80857146-80857168 CAAATAAAACACATTTAATTCGG - Intronic
1029447627 7:100622796-100622818 CAAATACAAAAAATTTAGCCAGG + Intronic
1029563703 7:101321160-101321182 CAAAAACAACAAATTTAGTCGGG + Intronic
1031713739 7:125081160-125081182 CAAATACAACAAAATTAGCCAGG - Intergenic
1031949919 7:127881632-127881654 CAAATGCAAAACACACAGTCTGG + Intronic
1032399602 7:131614676-131614698 AAAATACAAAACAATTAGTCGGG + Intergenic
1033116736 7:138632271-138632293 AAAATACAAAACATTTAGCCAGG + Intronic
1033400366 7:141017197-141017219 TAAATGCATCACATGTAGTAGGG + Intergenic
1037194593 8:16173194-16173216 CCAAGTCAACACATTTATTCTGG - Intronic
1037516562 8:19637622-19637644 CTAATGCAGCACATCTAGTAAGG + Intronic
1040510205 8:48086614-48086636 AAAATGCAAAACAATTAGCCAGG - Intergenic
1041536291 8:58929018-58929040 CAAATGTAACACATTTTGAGAGG + Intronic
1042965138 8:74343268-74343290 CAAGTGCAACTCATTAAGTCAGG - Intronic
1046452858 8:114416003-114416025 CAAATGGAGCACCTTAAGTCAGG - Intergenic
1046471906 8:114686422-114686444 CAAATGCAAATCATATACTCTGG - Intergenic
1048152818 8:131910430-131910452 CAAATACAAAACAATTAGCCAGG - Intronic
1048830581 8:138472921-138472943 CAAATGGAGCACATTTTATCTGG + Intronic
1050189027 9:3005821-3005843 CAAATGCAATACATATTGTTAGG - Intergenic
1051099980 9:13510085-13510107 CAAATGTAACACTTTTAATTTGG - Intergenic
1051275314 9:15392804-15392826 CAAATACAAAATAATTAGTCAGG + Intergenic
1051865894 9:21681985-21682007 CTAATGCCAGACTTTTAGTCAGG + Intergenic
1053563693 9:39224293-39224315 AAAATACAAAACAATTAGTCGGG - Intronic
1053696765 9:40646522-40646544 CCAACACAACACCTTTAGTCTGG + Intergenic
1053943159 9:43276665-43276687 CCAACACAACACCTTTAGTCTGG + Intergenic
1054133454 9:61394774-61394796 AAAATACAAAACAATTAGTCGGG + Intergenic
1054308016 9:63445753-63445775 CCAACACAACACCTTTAGTCTGG + Intergenic
1054406745 9:64769752-64769774 CCAACACAACACCTTTAGTCTGG + Intergenic
1054440372 9:65255212-65255234 CCAACACAACACCTTTAGTCTGG + Intergenic
1054490035 9:65766726-65766748 CCAACACAACACCTTTAGTCTGG - Intergenic
1054969539 9:71069335-71069357 AAAATGCAAAAAATTTAGCCAGG - Intronic
1055062566 9:72085396-72085418 AAAATACAAAACAATTAGTCAGG + Intergenic
1055163494 9:73161302-73161324 CAAATGAAAAACATTTTGTTAGG - Intronic
1055377817 9:75669222-75669244 CATGTGCAGCACATTTAGCCAGG - Intergenic
1055594526 9:77851557-77851579 CAAAAGCAAAACATTTAGAATGG - Intronic
1055730364 9:79274360-79274382 CAAATGAAAGTCATTTAGTTGGG - Intergenic
1055746841 9:79457134-79457156 CAAAGAAAACACATTTAGTTTGG - Intergenic
1056237063 9:84605169-84605191 CACATGGAACAAATTTATTCTGG + Intergenic
1057085718 9:92208033-92208055 AAAATACAAAACATTTAGCCGGG - Intergenic
1057406445 9:94775677-94775699 TAAAAACAACACATTTAGGCTGG + Intronic
1057480474 9:95441400-95441422 CAAATCCACCATATTTATTCAGG - Intergenic
1057548157 9:96033403-96033425 AAAATGCAAAAAATTTAGCCAGG - Intergenic
1059034778 9:110742293-110742315 AAAATACAAAAAATTTAGTCAGG + Intronic
1060210607 9:121707910-121707932 CAACTTCACCACATTTCGTCAGG + Intronic
1202779217 9_KI270717v1_random:20173-20195 CCAACACAACACCTTTAGTCTGG + Intergenic
1203572238 Un_KI270744v1:142182-142204 CAGATGCAACACCCTTAGTGAGG - Intergenic
1203586279 Un_KI270747v1:6570-6592 CCAACACAACACCTTTAGTCTGG + Intergenic
1203617190 Un_KI270749v1:76627-76649 CCAACACAACACCTTTAGTCTGG - Intergenic
1185979184 X:4757307-4757329 CAAATACAAAAAAATTAGTCGGG - Intergenic
1186718734 X:12280216-12280238 CAAGTGCTACATATTTAGTAAGG + Intronic
1187454850 X:19432223-19432245 TAAATGCAACATACATAGTCTGG + Intronic
1190607417 X:52159509-52159531 AAAATGCAAAAAAATTAGTCAGG + Intergenic
1193871138 X:86799894-86799916 CAAATGCAAAACACTTAGCATGG - Intronic
1194296028 X:92127679-92127701 AAAATACAAAACAGTTAGTCTGG - Intronic
1196292840 X:113964109-113964131 CAAATTTAACACATTTTGTTTGG + Intergenic
1198626603 X:138582710-138582732 AAAATACAAAAAATTTAGTCAGG + Intergenic