ID: 949904668

View in Genome Browser
Species Human (GRCh38)
Location 3:8849035-8849057
Sequence GTGCAGAAGCAGAGACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 1, 2: 3, 3: 64, 4: 591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949904668_949904675 19 Left 949904668 3:8849035-8849057 CCTCCCTGTCTCTGCTTCTGCAC 0: 1
1: 1
2: 3
3: 64
4: 591
Right 949904675 3:8849077-8849099 ATGGTTCTCCACGTGACAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 97
949904668_949904671 0 Left 949904668 3:8849035-8849057 CCTCCCTGTCTCTGCTTCTGCAC 0: 1
1: 1
2: 3
3: 64
4: 591
Right 949904671 3:8849058-8849080 TAAAGCCTGTAACACCTCCATGG 0: 1
1: 0
2: 0
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949904668 Original CRISPR GTGCAGAAGCAGAGACAGGG AGG (reversed) Intronic
900209981 1:1450658-1450680 CTGCAGATGCAGGGACACGGAGG - Exonic
900518824 1:3095965-3095987 TTGGAGGAGGAGAGACAGGGAGG - Intronic
900548745 1:3243132-3243154 GGACAGAGGCCGAGACAGGGAGG - Intronic
900684077 1:3936160-3936182 GTCCAGAGGGAGAGACCGGGTGG + Intergenic
900790128 1:4674541-4674563 GTGCAGAAGCAGAAATACGGAGG + Intronic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
901154658 1:7127405-7127427 GTGCAGATGAAGAGACAGCCTGG - Intronic
901197914 1:7450518-7450540 ATGCAGAAGTAGAGACAGGTGGG + Intronic
901221007 1:7583762-7583784 GTGCACAGGAAGACACAGGGGGG + Intronic
901488110 1:9579504-9579526 ATACAGAAGAAGAGACAGGTAGG + Intronic
902311872 1:15587245-15587267 GAGCAGGATCAGAGACAGGGAGG - Intronic
903025854 1:20429491-20429513 GGGCAGATGCAAAGCCAGGGTGG - Intergenic
904203204 1:28835230-28835252 AGCCAGAAGCAGAGCCAGGGTGG + Intronic
904371491 1:30050285-30050307 GGACAGAAGCAGAGAAAGAGGGG + Intergenic
904767184 1:32859237-32859259 CTGGAGAAGCAGAGATAGGGAGG - Intergenic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
904976734 1:34462244-34462266 GGGCAGAGGCAGAGACATAGAGG + Intergenic
905006566 1:34714621-34714643 CTGCGGAAGGAGAGACAGGAAGG + Intronic
905295483 1:36951825-36951847 GGGAAGAAGCAGAGAGAAGGAGG + Intronic
905297276 1:36962169-36962191 GTTCAGAAGCAGGTACTGGGTGG - Intronic
905316899 1:37088286-37088308 GGGCAAAAGCAGAGACTAGGTGG + Intergenic
905442543 1:38004676-38004698 ATGCAGAGACAGAGAAAGGGAGG - Intronic
905645844 1:39624727-39624749 GTGCAGTAGCAAGGAGAGGGGGG - Exonic
906539384 1:46573404-46573426 GTGCAGGGGCAGACACAGGCAGG + Intronic
906835252 1:49076414-49076436 ATGCAGAACCAGAGACAGGGAGG + Intronic
907333672 1:53687171-53687193 GAGCAGAACCAGAGCCAGGCAGG + Intronic
907460866 1:54604691-54604713 CTGCAGAAGAACAGAGAGGGAGG - Intronic
908669113 1:66526193-66526215 CTACAGAAGCAGAGAAAGGTAGG - Intergenic
910168715 1:84355193-84355215 GTGCAGATGCAGAAACAGAGTGG + Intronic
910466514 1:87506017-87506039 GTGCAGAAGCCAAGCCAGAGGGG + Intergenic
911237523 1:95427294-95427316 CTGCAGAATTAGAGACAGTGTGG + Intergenic
912429578 1:109621893-109621915 GTGCAGAAGCACACACAGTGCGG - Intronic
913040944 1:115022613-115022635 GTGCTGGAGTAGAGACTGGGAGG + Intergenic
913520209 1:119638572-119638594 GTTAAGAAGAGGAGACAGGGTGG - Intronic
913764532 1:122174121-122174143 GTCCAGAGGGAGAGACCGGGTGG + Intergenic
914506362 1:148292931-148292953 GTGCAGAAGCCAAGCCAGAGGGG + Intergenic
914748720 1:150517748-150517770 GTGAAGTACCATAGACAGGGTGG - Intergenic
914827660 1:151146915-151146937 ATACAGAAGCAGAGACAGGCTGG + Intergenic
915643227 1:157246106-157246128 GTACAGGATCAGATACAGGGTGG - Intergenic
915734555 1:158076386-158076408 GCTCAGTAGCAGAGACAGAGGGG - Intronic
916178715 1:162065270-162065292 ATGCAGAAGGAGAGACAGCACGG - Intergenic
916585590 1:166147150-166147172 GTGCAGCAGTGGACACAGGGAGG + Intronic
916678247 1:167082359-167082381 GTGAAAAAGTAGAGACAGTGAGG + Intronic
916695166 1:167228021-167228043 GGGCAGGAGGAGAGACTGGGAGG - Intronic
917151126 1:171946002-171946024 GCGCAGCTGGAGAGACAGGGAGG + Intronic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917716304 1:177741309-177741331 TGGCAGAAGGAGAGGCAGGGTGG - Intergenic
920034408 1:203056558-203056580 CTGCAGAGGCAGAGGAAGGGAGG - Intronic
920089581 1:203442732-203442754 GTACAGAAGTAAAGACAGGAAGG - Intergenic
920188574 1:204177907-204177929 GAGCAGAGGGAGAGAAAGGGTGG - Intergenic
920677161 1:208046190-208046212 GCACAAAAGCAGAGAGAGGGTGG - Intronic
920759052 1:208763927-208763949 GTGAGGCAGCAGAGAGAGGGAGG - Intergenic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
922420824 1:225460269-225460291 GTGAAGAAGAGGTGACAGGGAGG + Intergenic
922746712 1:228048312-228048334 CAACAGAAGCAGAGACATGGAGG + Intronic
922793253 1:228322256-228322278 GTGCAGAGGCAGGGAGAGGCAGG + Intronic
923891451 1:238219624-238219646 GGGCAGATGCTGAGACATGGTGG + Intergenic
924011963 1:239674940-239674962 TTAGAGAAGCAGAGACAGCGAGG - Intronic
924202845 1:241678037-241678059 TTTCAGAAGGAGAAACAGGGAGG + Intronic
1063420994 10:5912472-5912494 CTGGAGAAGCAGAGACCGTGGGG + Intronic
1063975023 10:11408176-11408198 GGGCAGGAGAAGTGACAGGGTGG + Intergenic
1064304958 10:14157254-14157276 GTGCAGAGACAGAGAAAGAGAGG - Intronic
1064433627 10:15291860-15291882 GTACTGAAACAAAGACAGGGAGG - Intronic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1064865333 10:19872692-19872714 GGGCAGAGTTAGAGACAGGGTGG + Intronic
1064930229 10:20617347-20617369 GTGCAGAATCAGAGAGAAAGGGG - Intergenic
1065123872 10:22554530-22554552 GTGCAGAAACAGCCAGAGGGTGG + Intronic
1065199893 10:23302421-23302443 ATGAAGAGGCAGAGACAGGGTGG - Intronic
1065362125 10:24898589-24898611 GAGGAGAAGCAGAGACAAGAAGG - Intronic
1066617300 10:37308229-37308251 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1067084165 10:43229435-43229457 GGGCAGGAGCAGAGGCAGGCTGG + Intronic
1067277904 10:44850916-44850938 GTGCAGCAGGACAGAGAGGGTGG - Intergenic
1067342941 10:45419212-45419234 GTGAAGGCGCAGAGGCAGGGAGG + Intronic
1067692575 10:48511383-48511405 GTGCAGAATCAGGGGCAGCGTGG - Intronic
1068526279 10:58133988-58134010 GTCCTGTAGCAGAGACAGAGGGG - Intergenic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1068798260 10:61108673-61108695 GTGCACAAACAGAGATAGTGTGG + Intergenic
1069069023 10:63975197-63975219 CTGCAGAAGCAGTGATAGGCTGG - Intergenic
1070258095 10:74827198-74827220 GTGCAGAGGGAGAGTTAGGGAGG + Intronic
1070376953 10:75841923-75841945 ATGAAGAAACAGAGACAGAGGGG - Intronic
1070937808 10:80315167-80315189 ATTCAGTAGGAGAGACAGGGTGG - Intergenic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1071431231 10:85608678-85608700 GATCTGAAGCAGAGACAGGCAGG + Intronic
1072733359 10:97863120-97863142 GGGCAGGAGCAGGGGCAGGGAGG + Intronic
1073444545 10:103572693-103572715 GTGCACAAGGAGAGCCAGGTGGG - Intronic
1073463478 10:103679913-103679935 ATCCAGAAGCAGTGACAAGGGGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073920350 10:108451215-108451237 GTGCTGAAGAACAGACAGGGAGG + Intergenic
1074594747 10:114851565-114851587 CTGCAGTAACCGAGACAGGGTGG - Intronic
1074679988 10:115895790-115895812 GTGCAGAAGAGGAATCAGGGAGG + Intronic
1075257831 10:120939443-120939465 GGGGAGGCGCAGAGACAGGGTGG - Intergenic
1075618131 10:123906107-123906129 GTGCAGGAGCAGACAGGGGGAGG - Intronic
1075743186 10:124708385-124708407 GTGCAAAAGCAGGGAAGGGGAGG + Intronic
1075816075 10:125265613-125265635 GTACAGATGCAGAAACAGAGTGG + Intergenic
1076008131 10:126964444-126964466 CTGTAGGAGCACAGACAGGGAGG + Intronic
1076106369 10:127826859-127826881 CTGCAGAAACTGAGACACGGTGG - Intergenic
1076120412 10:127932579-127932601 CTGCAGCAACAGAGACAGGAGGG + Intronic
1076238479 10:128884051-128884073 GTGAAGAGGCAGAGAAAGGGGGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076402466 10:130193051-130193073 TTGGAGAAGCAGGGACAGGGTGG - Intergenic
1076602735 10:131669513-131669535 GTGGAGAAAGAGAGAGAGGGGGG + Intergenic
1077211394 11:1372380-1372402 GTGCAGTGGCTGGGACAGGGCGG - Intergenic
1077317685 11:1926672-1926694 CTGCAGAAGCAGCGTCATGGTGG - Intronic
1077465146 11:2730461-2730483 GGACAGAAGCAGAGACAAGGGGG - Intronic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG + Intronic
1078577384 11:12513658-12513680 GTGCCGAAGAAGGGACAGGAAGG + Intronic
1079268520 11:18959202-18959224 GCACAGAATCAGAGACAGTGAGG + Intergenic
1079269940 11:18974872-18974894 GCACAGAATCAGAGACAGTGCGG + Intergenic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1083183021 11:61000406-61000428 GTACAGAGCCAGAGGCAGGGTGG - Intronic
1084728122 11:70955177-70955199 ATCCAGAAGCAAAGAAAGGGTGG - Intronic
1084732260 11:71081162-71081184 GTGAAGATGCAGAGAAAAGGCGG + Intronic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1085659155 11:78346953-78346975 GTGGTGAGGCAGAGAAAGGGAGG + Intronic
1085778556 11:79388212-79388234 GTTCAGAAACAGTGACAGTGGGG + Intronic
1085837463 11:79972236-79972258 GTGCAGAAGGAGAGAGAGAATGG - Intergenic
1086177640 11:83911199-83911221 GGGCAGAGGCAGAGAGAGGAAGG + Intronic
1086841331 11:91688375-91688397 GAATAGAAGCAAAGACAGGGAGG + Intergenic
1087023067 11:93622474-93622496 GTGGAGAGGCAGATACATGGAGG + Intergenic
1087271270 11:96114470-96114492 TTGCAAAAGCAGAGATAGGTGGG - Intronic
1089397042 11:118143074-118143096 GTGCAGAAGCAGAGAGAAAAAGG - Intronic
1089562638 11:119352309-119352331 TGTCAGAAGCAGAGACAGGATGG - Intergenic
1089692498 11:120195609-120195631 GGGCAGGAGCAGGGGCAGGGAGG - Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1091003923 11:131934806-131934828 GTGCAGCAGCATAGACAATGGGG + Intronic
1091004655 11:131942178-131942200 ATGCAAAAGCAGAGAGAGAGTGG + Intronic
1091144040 11:133261715-133261737 GTGGAGAAAGAGAGACGGGGAGG + Intronic
1091795040 12:3293322-3293344 GTGCTGAAGCAGGAAAAGGGAGG + Intergenic
1092253934 12:6916129-6916151 GTGCACAGGCAGACACACGGAGG - Intronic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1092587883 12:9919512-9919534 GTGCAGAGGCAGTGGCAGAGAGG + Intronic
1093135051 12:15439856-15439878 GTGCAGAAGCAGACCCACGTCGG + Intronic
1094498127 12:31001984-31002006 AAGAACAAGCAGAGACAGGGTGG + Intergenic
1095688869 12:45065588-45065610 GTGCAGAGGGAGAGACCTGGTGG - Intergenic
1096091880 12:48907569-48907591 GTGAAGAAGTAGAGATAGTGAGG - Intronic
1096330470 12:50707881-50707903 GTGGTGAAGCAGAGACCGGGAGG - Intronic
1097472393 12:60010719-60010741 GTGCACAATCAGAGGCAGGGTGG - Intergenic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1099106391 12:78501968-78501990 ATACAGAGGCAGAGACAGGGAGG - Intergenic
1099287958 12:80738836-80738858 GTACGAAAGCAGAGACAGGAGGG + Intergenic
1099480027 12:83154396-83154418 GTGCATAAGGAAGGACAGGGAGG - Intergenic
1100618919 12:96253367-96253389 GGGCAGAACCAGGGACAAGGAGG - Intronic
1101467021 12:104958752-104958774 GTGCAGGAGCCGAGACGGGCAGG + Intergenic
1101493686 12:105234284-105234306 CTACAGAATGAGAGACAGGGAGG - Intronic
1101967519 12:109291581-109291603 GAGCAGAGAGAGAGACAGGGAGG - Intronic
1103583731 12:121935822-121935844 TTACAGAAGCAGATACAAGGAGG - Intronic
1104039374 12:125119827-125119849 GTGCAGAACCTGTGACTGGGGGG + Intronic
1104399647 12:128464958-128464980 GGACAGAAGCAGACACAGAGAGG + Intronic
1104418761 12:128617595-128617617 GGGCAGATGCAGAGTCAGGTGGG + Intronic
1104620449 12:130307996-130308018 GAGCAGGAGCAGAGACAGGTCGG + Intergenic
1104732377 12:131115028-131115050 GTGCAGCTTCAGAGAAAGGGGGG - Intronic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1106026553 13:25960708-25960730 GGGCAAAAGCAGAGGGAGGGAGG - Intronic
1106097612 13:26662014-26662036 GTGCAGAAGCACAGAGTGTGAGG + Intronic
1106364702 13:29067229-29067251 GAGCAGATTCAGAGAGAGGGGGG + Intronic
1107058369 13:36130789-36130811 GTGGAGATGGAGAGCCAGGGCGG - Intronic
1109308279 13:60663662-60663684 GTGATCAAGCAGAGGCAGGGCGG - Intergenic
1109564247 13:64090501-64090523 GTGCAAAAGCAGAGATAAGGAGG - Intergenic
1110233711 13:73194257-73194279 GCACAGATGCAGAGACAGGAAGG - Intergenic
1110568273 13:76977914-76977936 ATGCAGATGCAGATACAGGCTGG + Intergenic
1110950057 13:81474674-81474696 GTGGAGAAGGGGATACAGGGGGG + Intergenic
1111586298 13:90288383-90288405 ATGCAGAAGGTGAGACGGGGAGG + Intergenic
1113411298 13:110092633-110092655 GTGCAAAAGCAGATCCATGGAGG - Intergenic
1113580689 13:111426518-111426540 CTTCAGTAGCAGAGACAAGGTGG + Intergenic
1115368800 14:32588971-32588993 GAGCAGAGGTAGAGACAGGAAGG - Intronic
1116871193 14:50070454-50070476 CTACTGAATCAGAGACAGGGTGG + Intergenic
1117019081 14:51550632-51550654 GTGCAGAGGCAGAGGAAGGGCGG + Intronic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118994495 14:70823519-70823541 AAGCAGAAGCTGAGACAGGGAGG - Intergenic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119429359 14:74555763-74555785 GTGCAAAGGCAGAGAGTGGGTGG - Intronic
1119715481 14:76856111-76856133 GAGCAGAAGCAGAGAGAATGAGG - Intronic
1119951608 14:78751440-78751462 GAGCACAAGGAGGGACAGGGAGG - Intronic
1120410325 14:84145912-84145934 GTGCTGAGGCAGAGACAGAAAGG + Intergenic
1120417788 14:84242234-84242256 GTGCTGAAGATGAGACTGGGGGG - Intergenic
1120540245 14:85742218-85742240 TTTCAGAAGCAGAGAGAGAGAGG - Intergenic
1120693293 14:87617287-87617309 GTGCAGCAGAACAGAGAGGGAGG + Intergenic
1120934075 14:89876118-89876140 GTTCAGAAGTAGAGACTGTGGGG + Intronic
1121040156 14:90739743-90739765 GAGCAGGAGTAGAGCCAGGGTGG - Intronic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1121122273 14:91383445-91383467 GTGCCCAAGCAGAAAGAGGGAGG - Intronic
1121526065 14:94620392-94620414 GTGCAGGAGCAGAGAGAGTGAGG + Intronic
1121584096 14:95051112-95051134 GTGCAGAGACAGAGCCAGGCAGG - Intergenic
1121586567 14:95067090-95067112 GTGCAGGAGCTGAGATGGGGAGG - Intergenic
1121639419 14:95475305-95475327 AGGCAGAAGCAGAGAAGGGGTGG + Intronic
1121800805 14:96772611-96772633 GTGCAGAAGTTGAGAGAAGGAGG - Intergenic
1122036308 14:98951557-98951579 GTGCAGAAGCAAGGCCAGGATGG + Intergenic
1122236270 14:100332304-100332326 GTGGGGAAGCAGGGACAGGAAGG - Intergenic
1124242917 15:28046135-28046157 GTGTGGAAGAAGAGAGAGGGAGG - Intronic
1124902277 15:33835485-33835507 AAGGAGAGGCAGAGACAGGGAGG - Intronic
1125165918 15:36704162-36704184 GTGAAGAAGCTGGGACAGTGTGG - Intronic
1125833399 15:42731417-42731439 GAGCAGCAGGACAGACAGGGAGG + Intronic
1126176657 15:45742251-45742273 GTGAAGAGGCAGCGAGAGGGAGG + Intergenic
1126790647 15:52218290-52218312 GTGAAGGAGGAGAGACAGAGAGG - Intronic
1126961148 15:53995878-53995900 GTGGAGAAGTAGAGAGAGAGAGG + Intergenic
1127203381 15:56684033-56684055 GTGCAGAAGCTGAGGCAAGAAGG + Intronic
1127355978 15:58200601-58200623 CTGCAGAAGCACAGACATGGTGG - Intronic
1127850099 15:62904738-62904760 GTGCAGGAGGGGAGACTGGGAGG + Intergenic
1129239467 15:74242932-74242954 GTGCAGGAGTGGAGTCAGGGAGG - Intronic
1129333049 15:74837615-74837637 GGGCAGATACAGGGACAGGGAGG + Intronic
1129389760 15:75214668-75214690 GTGCAGCAGGAGAGACAGGAGGG - Intergenic
1129752687 15:78077152-78077174 GTGGAGAAGCAGGGAAAGGCAGG + Intronic
1129997116 15:80016514-80016536 GTGTGGAAGGAGAGGCAGGGGGG + Intergenic
1130691129 15:86082341-86082363 GTGCACAAGAAGAGACAGACTGG - Intergenic
1131285123 15:91050623-91050645 GATCCGCAGCAGAGACAGGGTGG + Intergenic
1131312560 15:91304207-91304229 CTGCAGGAGGAGAGAGAGGGGGG + Intergenic
1131564122 15:93470365-93470387 GTACAGAGGCAGAGGGAGGGGGG - Intergenic
1131656950 15:94470898-94470920 ATCCAGAAGCAGGGAGAGGGAGG + Intronic
1132149332 15:99448179-99448201 CTAGAGAAGCAGAGGCAGGGAGG + Intergenic
1132512995 16:353205-353227 GTGCGGAAGCGGAGCCCGGGAGG + Intergenic
1132835574 16:1951234-1951256 GTGCAGAAGCTCAGAGAAGGCGG + Intronic
1132986367 16:2769631-2769653 GTGGAGACGGGGAGACAGGGAGG - Intronic
1133616605 16:7482870-7482892 TTGCAGAAGCAAAGACTGAGAGG + Intronic
1134073183 16:11273175-11273197 GAGGGGAACCAGAGACAGGGAGG + Intronic
1134208947 16:12259928-12259950 GGGCAGAGGCAGAGGCAGCGGGG - Intronic
1136854494 16:33643366-33643388 GTGGGGGAGCAGAGCCAGGGTGG - Intergenic
1136911338 16:34146980-34147002 GTGGAGAAGCGGGGACAGGGGGG - Intergenic
1137578750 16:49621010-49621032 CTGCTGAAGGAGAGAGAGGGAGG - Intronic
1137698428 16:50478488-50478510 GTTCATGGGCAGAGACAGGGTGG + Intergenic
1139338489 16:66250788-66250810 GTGCAGTGGGAGAGGCAGGGTGG - Intergenic
1139968277 16:70757655-70757677 CTGCTGAAGCAGAAGCAGGGAGG + Intronic
1141605861 16:85152863-85152885 GGGCAGAGGCAGATTCAGGGAGG + Intergenic
1141950186 16:87334885-87334907 CTGCTGAAGCTCAGACAGGGTGG + Intronic
1142928193 17:3259575-3259597 GGGCTGAGGCAGAGAGAGGGCGG + Intergenic
1142928203 17:3259617-3259639 GGGCTGAGGCAGAGAGAGGGAGG + Intergenic
1143020586 17:3915448-3915470 GTGCAGAATCAGAGGCAGCGTGG - Intronic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143977411 17:10840141-10840163 GAGCAGGAGCAGCTACAGGGTGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1145123686 17:20282696-20282718 TTGCAGAAGCAAAGACACAGTGG + Intronic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146829659 17:36057703-36057725 GGGCAGAGGAAGAGAGAGGGAGG - Intergenic
1147606297 17:41775621-41775643 GGGCAGGGACAGAGACAGGGCGG + Intronic
1147738947 17:42659573-42659595 GGGCAGAACCAGAGACCGGCGGG - Intronic
1147833664 17:43314988-43315010 ATGCAGAAGCTGAGGCAGAGAGG - Intergenic
1147929305 17:43967669-43967691 ATTCAGCAGGAGAGACAGGGTGG - Intronic
1147945066 17:44076151-44076173 GTGCGGAAGCAGATTTAGGGAGG - Exonic
1147952825 17:44116475-44116497 GTACAGAAGCAGCATCAGGGAGG - Intronic
1148204449 17:45771141-45771163 GGGGAGGGGCAGAGACAGGGAGG + Intergenic
1148548100 17:48532069-48532091 GTGGTGAAGGAGAGACAGGTAGG - Intergenic
1149561720 17:57612168-57612190 GTGCAGAAGCAGCGAGGGGCAGG + Intronic
1151366929 17:73623590-73623612 CTGCAAAAGCAGGGATAGGGTGG + Intronic
1151366955 17:73623726-73623748 GTGAAGAAGCAGAGAGAGTCGGG - Intronic
1151427399 17:74040073-74040095 GTGCAGAAGCAGGAAGAGTGAGG + Intergenic
1152395558 17:80030761-80030783 GGGCAGAGGCAGAGGCAGGCAGG + Intronic
1152575821 17:81140627-81140649 CTGCAGAATCAGAGACCGTGGGG + Intronic
1152588200 17:81198452-81198474 GAGCAGCTGCAGAGACCGGGTGG - Intronic
1153428600 18:4991599-4991621 GTGGAGAAAGAGAGAGAGGGAGG + Intergenic
1154019198 18:10647829-10647851 TTGCTGCAGCAGTGACAGGGTGG - Intergenic
1154185018 18:12175395-12175417 TTGCTGCAGCAGTGACAGGGTGG + Intergenic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1155065422 18:22265126-22265148 GTCCTGAAGAAGAGACAGTGAGG - Intergenic
1156503641 18:37575574-37575596 GTGCAGAGACAGGGACAGGGTGG - Intergenic
1158293374 18:55967310-55967332 GTGCAGAACAAGAGATAGGATGG - Intergenic
1158958535 18:62566483-62566505 GAGAAGGAACAGAGACAGGGAGG - Intronic
1158991979 18:62878370-62878392 ATGAAGTAGCAGAGAGAGGGAGG - Intronic
1159023289 18:63160712-63160734 GTGCCCAAGTGGAGACAGGGAGG - Intronic
1159067695 18:63588338-63588360 GTGGAGAGGCAGAGACAGGCAGG + Intronic
1159134261 18:64318619-64318641 GAGGAGAAGGAGAGATAGGGAGG - Intergenic
1160371888 18:78379197-78379219 CTGCAGAGGCAGAGACATTGTGG - Intergenic
1160437345 18:78861874-78861896 ATGCAGCAGCAGAGACGGGCGGG + Intergenic
1160497472 18:79383766-79383788 GCGCAGCAGCAGTGACAAGGAGG + Intergenic
1160861612 19:1239597-1239619 GTGCACAGGCCGGGACAGGGCGG + Intergenic
1160907933 19:1460530-1460552 CTGCAGAGGCAGCAACAGGGTGG - Intronic
1160968026 19:1755072-1755094 GGGCAGAAGCGGCGACCGGGGGG - Intronic
1161021950 19:2014944-2014966 GTGCAGAGGCAGGGACAGAGGGG + Intronic
1161316410 19:3619568-3619590 GAGCTGAAGCAGAGGCAGGCTGG + Intronic
1161847012 19:6717978-6718000 GTGCAGTGGCAGAGACACAGAGG - Intronic
1162070920 19:8151615-8151637 GTGGCCCAGCAGAGACAGGGGGG + Intronic
1162147532 19:8621850-8621872 GTGAAGACGCAGAGAGAAGGTGG + Intergenic
1162339915 19:10086223-10086245 GAGCAGAGGCGGAGCCAGGGCGG + Exonic
1162992847 19:14314596-14314618 GTGCAGAAGGGGAGGCTGGGTGG + Intergenic
1164063592 19:21695429-21695451 GTGCATGAGCAGAGCCATGGAGG + Intergenic
1164495291 19:28754820-28754842 GTGCACCAGCAGTGGCAGGGTGG - Intergenic
1164663348 19:30000054-30000076 TTAGAGAAGCAGAGACAGGGAGG - Intronic
1164668211 19:30056606-30056628 GTGCAAAAGGAGAGACATGCAGG - Intergenic
1164683367 19:30150631-30150653 GGGGAGGAGCAGGGACAGGGAGG - Intergenic
1164686656 19:30170691-30170713 GTGAAGAACCACAGACTGGGGGG - Intergenic
1164737504 19:30552732-30552754 GTGCAGAAGGAGAGCCACCGAGG + Intronic
1165094612 19:33403334-33403356 GTCCAGAACCAGAGCCAGGAGGG + Intronic
1165834391 19:38745388-38745410 ATGGAGAGGAAGAGACAGGGAGG - Intronic
1166140570 19:40803093-40803115 GTGAAGATGCTGAGCCAGGGAGG - Intronic
1166329093 19:42068567-42068589 GCTCAGAGGCAGAGAGAGGGAGG + Intronic
1166536766 19:43579564-43579586 GAGGAGAAGCAGAGACAGGGAGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167110693 19:47458945-47458967 GAGCAGAGACAGAGACAGAGGGG - Intronic
1167235819 19:48314245-48314267 CGGCAGAAGCAGAGAGAGAGAGG + Intronic
1167285900 19:48598901-48598923 CTGCAGTAGCAGAGGCAGTGAGG + Intronic
1167410415 19:49340804-49340826 GTGCAGGAGCAGAGCCAGGTGGG - Exonic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
1167867133 19:52337373-52337395 GAGAGGAAGCAGAGATAGGGAGG + Intronic
925084477 2:1097229-1097251 GTGCAGGTGCAGATGCAGGGAGG - Intronic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925427050 2:3758566-3758588 GTGTAGGACCTGAGACAGGGAGG + Intronic
925442880 2:3903601-3903623 GTGCACAACTAGAGAAAGGGCGG - Intergenic
925695127 2:6568415-6568437 GGACAGCAGCAGAGGCAGGGAGG - Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
926383815 2:12316640-12316662 GTGCAGAGGGAGAGACAGTCAGG + Intergenic
926910548 2:17848833-17848855 GTGCAGAAGCAAACAGAAGGAGG + Intergenic
926933968 2:18068166-18068188 GGGCAGAAGCAGAGAGGGGTGGG - Intronic
927002208 2:18809404-18809426 GTGGAGTATCAAAGACAGGGAGG - Intergenic
927427277 2:22995452-22995474 GTGCAGAACCTGGGACAGAGGGG - Intergenic
927450585 2:23206160-23206182 GAGCAGGAGGAGAGACAAGGAGG - Intergenic
927497580 2:23561167-23561189 ATGGAGAGGCAGAGACAGAGGGG - Intronic
927502430 2:23591611-23591633 GAGCAGACGCAGTGACAGGATGG - Intronic
928395303 2:30939246-30939268 GTGCAGAATGAGGGAGAGGGTGG + Intronic
929545375 2:42852096-42852118 GTGAAGAGGCAGTGAGAGGGTGG - Intergenic
930542555 2:52725027-52725049 GTGTTGAAGCAGAGAGAAGGAGG - Intergenic
931418834 2:62106798-62106820 AAGCAGAAGCAGAGACTGTGTGG + Intronic
931821219 2:65954319-65954341 GTGCACAAGGAGAGATAGAGAGG - Intergenic
932468684 2:71940013-71940035 GGGCAGAAGCAGGGCCAGGAGGG - Intergenic
932556457 2:72829181-72829203 ATGTAGAAGCAGAGATAGAGTGG - Intergenic
933767287 2:85718885-85718907 GTACAGGAGCAGATTCAGGGAGG - Intergenic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
933942669 2:87257831-87257853 GAGCAGAAGCATTGTCAGGGTGG - Intergenic
933983421 2:87572072-87572094 GTGAAGATGCAGAGACAGGTTGG - Intergenic
934055242 2:88246070-88246092 GTGGAGAAACAGAAACATGGAGG - Intergenic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934781279 2:96971254-96971276 GGGGAGAAGGAGAGAGAGGGAGG - Intronic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
935052702 2:99536925-99536947 GTGAAGGACCAGGGACAGGGGGG + Intergenic
935237749 2:101152192-101152214 TTGTGGAAGCAGAGACAAGGTGG + Intronic
935363961 2:102270259-102270281 AGGCAGGAGCAGAGAGAGGGAGG - Intergenic
935529574 2:104216038-104216060 GTACAGAGACAGAGAGAGGGGGG - Intergenic
936310427 2:111378722-111378744 GTGAAGATGCAGAGACAGGTTGG + Intergenic
936337553 2:111603731-111603753 GAGCAGAAGCATTGTCAGGGTGG + Intergenic
936418646 2:112343534-112343556 GAGGAGAAGCAGAGACAATGAGG + Intergenic
936428364 2:112437394-112437416 CTGCAGAAGCAGAGAAATGCGGG - Intergenic
937298850 2:120826209-120826231 GGGGAGAAGCTGAGACAGAGAGG + Intronic
937521007 2:122712255-122712277 CTGCAGAGGCAGTGACAGAGAGG - Intergenic
938380842 2:130835770-130835792 GGGGAGAGGCAGAGACAGGTTGG + Intergenic
938390427 2:130901064-130901086 TGGCAGAGGCAGAGACAGAGTGG - Intronic
938393035 2:130919951-130919973 GTGCAGAAGCACATACTGGAAGG + Intronic
938718292 2:134040958-134040980 GTGAAGCAGGAGAGACAGTGAGG + Intergenic
940068140 2:149652929-149652951 GTTCAGAAGGGGAAACAGGGAGG + Intergenic
942314468 2:174684541-174684563 GTACAGAAGCAGAGAAAGCCGGG - Intergenic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942810302 2:179991577-179991599 GTGGAGAAGCAGAGACTAAGAGG + Intronic
943018445 2:182543938-182543960 GTGGGGAAGGAGAGACAGAGAGG - Intergenic
944313041 2:198256716-198256738 GAGCAGATGGAGAGTCAGGGAGG - Intronic
944438084 2:199712799-199712821 GTGAAGACACAGAGACATGGAGG - Intergenic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
945144254 2:206720196-206720218 GAGCAGAAGCAGTGTCATGGAGG - Intergenic
945644324 2:212470274-212470296 GTGAAGAAGCACAGAGAGGCTGG - Intronic
945984083 2:216340397-216340419 CTGCAGGAGGAGAGCCAGGGAGG - Intronic
947206636 2:227667066-227667088 GTCCAGAAGCAGAGCCAGGCCGG - Intergenic
947569604 2:231221948-231221970 CTGGAGAGGCAGAGACAGTGGGG + Intronic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
948155528 2:235778180-235778202 GTGCTCAAGCAGCCACAGGGAGG - Intronic
948578589 2:238969532-238969554 CTGCAGAAGAAGAGAAAGAGAGG + Intergenic
948962393 2:241350115-241350137 ATGCAGATGCAGATGCAGGGCGG + Exonic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170842222 20:19933295-19933317 GTGCAGGAGGAGAGGCAGGCAGG - Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171769839 20:29313876-29313898 GGGGAGAAGCGGAGACAAGGGGG + Intergenic
1171986464 20:31664816-31664838 GTGGAGCAGAAGAGAGAGGGAGG + Exonic
1172049978 20:32109913-32109935 GTGCAGGGGCAGGGCCAGGGAGG - Intronic
1172070270 20:32251649-32251671 CTTCAGCAGCAGAGACAGGGAGG + Intergenic
1172578726 20:36030222-36030244 GTGCAGAAGGAGAGTCTGGGAGG + Intronic
1172757572 20:37297615-37297637 GTGAAGCAGCAGAGCCAAGGTGG + Intronic
1173095005 20:40017708-40017730 TTGCAGAAACAGAGACAAGAGGG - Intergenic
1173182192 20:40813812-40813834 TGGGAGAAGCAGAGACAGAGTGG - Intergenic
1173304400 20:41834695-41834717 GTGCAATAGTAGACACAGGGAGG + Intergenic
1173849273 20:46207560-46207582 GTTCAGAGGCAGTGACAGGATGG + Intronic
1174153642 20:48503128-48503150 GTGGAGCTGCAGAGCCAGGGAGG - Intergenic
1174163829 20:48570667-48570689 GTCCAGAAGCAGAGTCAAGCGGG - Intergenic
1174592083 20:51654094-51654116 GTGCAGAAAGAGAGAGGGGGAGG - Intronic
1175903572 20:62369285-62369307 GTGCACCAGCAGACACAGGGTGG - Intergenic
1175913668 20:62415949-62415971 GAGGGGAGGCAGAGACAGGGAGG + Intronic
1176373886 21:6077817-6077839 CTGCAGAAGCAGAGAAATGCGGG + Intergenic
1177517842 21:22177784-22177806 GTGGGCAAGCAGAAACAGGGTGG + Intergenic
1178474017 21:32920577-32920599 GAGCAGACGCAGGGAGAGGGCGG + Intergenic
1179349279 21:40592503-40592525 GTGAAGTGGGAGAGACAGGGAGG - Intronic
1179461415 21:41537980-41538002 CTGCAGAAGCAGAGACAGACGGG - Intergenic
1179469100 21:41598651-41598673 CTGCAGAAGAGGAGACAGCGTGG + Intergenic
1179749591 21:43460426-43460448 CTGCAGAAGCAGAGAAATGCGGG - Intergenic
1180247498 21:46557920-46557942 GTGGAGCTGCAGAGACAGGTGGG - Intronic
1180866813 22:19124454-19124476 GTGAAGGAGCAGAGAAAAGGGGG + Intergenic
1181048572 22:20228068-20228090 ATGCAGAAGCCGAGCCAGGCTGG + Intergenic
1181084633 22:20433839-20433861 GTTCAGAAGCAGACACAAGTGGG - Intronic
1181178667 22:21052422-21052444 GAGGAGCTGCAGAGACAGGGAGG - Intronic
1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181419432 22:22787504-22787526 GTGTACAAGCAGACACTGGGTGG - Intronic
1181569524 22:23760542-23760564 GTGGAGAGACAGAGACAGAGGGG + Intergenic
1182174329 22:28268336-28268358 GTTCAACAGCAGAGACAGTGTGG + Intronic
1182252450 22:29011880-29011902 GCACACAAGCAGAGACATGGTGG - Intronic
1182453621 22:30435678-30435700 GTGCACCAGCAGGGGCAGGGAGG - Intergenic
1183032192 22:35114682-35114704 GTGAGGAATCAGAGACAGGCTGG + Intergenic
1183252094 22:36737420-36737442 GAGGAGAAGCAGAGAGAAGGAGG + Intergenic
1183708017 22:39487042-39487064 GTGCAGCCGCACAGTCAGGGTGG + Intronic
1183719727 22:39555661-39555683 GTGTACAAGCAGGGACAGGGTGG + Intergenic
1183936485 22:41265374-41265396 GAGCAGATGCACAGAAAGGGGGG + Intronic
1185380481 22:50505494-50505516 TTCCAGCAGCAGCGACAGGGTGG + Exonic
949870470 3:8583706-8583728 GTCCAGAAGCAGAGGGAGTGAGG - Intergenic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950261461 3:11545531-11545553 ATGGACAAGAAGAGACAGGGAGG - Intronic
950418154 3:12880390-12880412 GTGCAGATGCAGAGGCAGCTGGG + Intergenic
950478102 3:13226864-13226886 GTGAGGAAGCAGAGACCTGGGGG - Intergenic
952528457 3:34238716-34238738 GGGCAGAAGCAGAGACAACCAGG + Intergenic
954431923 3:50475464-50475486 GTGGAGATGCAGAGGCTGGGAGG - Intronic
954486766 3:50860288-50860310 TTGCAGAAGCAGTGCCAGAGAGG + Intronic
954596677 3:51830909-51830931 GTAGAGAAGCAGAGAAAGAGTGG - Intergenic
955167890 3:56532961-56532983 GTGTAGAAGCAGAGACATATGGG - Intergenic
955328247 3:58026172-58026194 GTGGAGATGGAGAGACAGGTGGG + Intronic
956458913 3:69451912-69451934 GTGCAGAAAGAGAGACAAGCAGG + Intronic
956545971 3:70403097-70403119 GTGCAGAAAAAGAGACTGTGTGG + Intergenic
956850954 3:73227917-73227939 GTACAGAAAGAGAGAGAGGGAGG - Intergenic
958489884 3:94758897-94758919 GTACAGAAGCAGAGAGAGATCGG - Intergenic
959262822 3:104103030-104103052 GTGCAGTGGCAGTGACAGAGGGG + Intergenic
959664640 3:108906962-108906984 GTGCAGAAACGGAGGCAAGGAGG - Intergenic
960841572 3:121963896-121963918 CTGCAGAAGCAGTGACAGAGAGG - Intergenic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961426218 3:126850586-126850608 GTGAAGCAGCAGAGACAAGGAGG - Intronic
961538594 3:127585473-127585495 GAGGAGGAACAGAGACAGGGAGG + Intronic
961787062 3:129353589-129353611 GTGGGGAAGCAGAGACCTGGGGG + Intergenic
961850239 3:129809654-129809676 GTGCAAAAGAAGAGAGAGAGAGG + Intronic
962020581 3:131496974-131496996 CTGCAGAAGCAGAGACAACATGG - Intronic
962298001 3:134211276-134211298 ATGCAGAAAAAGAGACAGGGAGG + Intronic
962411388 3:135144173-135144195 GTGCAGAACCAGAAACAGCTGGG - Intronic
962744936 3:138390039-138390061 GAGGAGAAGCAGAGAAAAGGGGG + Intronic
962744947 3:138390077-138390099 GAGGAGAAGCAGAGAAAAGGGGG + Intronic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966779235 3:183569415-183569437 GTGCAGAAACAAACACAGGAGGG + Intergenic
966918182 3:184596213-184596235 GGGCTGAAGCAGGGACAGGAGGG - Intronic
966959750 3:184923392-184923414 GGAAAGAGGCAGAGACAGGGGGG - Intronic
967090620 3:186131825-186131847 GGGTAGAAGCAGAAACATGGTGG + Intronic
967182280 3:186916449-186916471 GGGCAGTAGCAGAGACAGAATGG + Intergenic
967499689 3:190183515-190183537 GTTCATAAGCAGAGACACTGCGG - Intergenic
968049688 3:195645907-195645929 GTGCAGCAGAAGACTCAGGGAGG + Intergenic
968304447 3:197640075-197640097 GTGCAGCAGAAGACTCAGGGAGG - Intergenic
968565325 4:1309574-1309596 GAGGAGGAGCAGAGGCAGGGAGG + Intronic
968976386 4:3824355-3824377 GTCCAGCAGCCAAGACAGGGAGG - Intergenic
969220479 4:5755570-5755592 GAGCAGCAGCAGAGACCAGGAGG - Intronic
969533185 4:7740686-7740708 GTGAAGAAGCAAAGTCAGGGAGG - Exonic
969586912 4:8099212-8099234 GGGGAGAAGCAGAGACTTGGGGG + Intronic
969657308 4:8505654-8505676 ATGAGGAAGCAGAGACAGAGAGG + Intergenic
970115102 4:12686087-12686109 GTCCAGTAGGAGAGACAGGTAGG + Intergenic
971605311 4:28651224-28651246 CTGCAGAGGCAGTGACAGAGGGG + Intergenic
971639211 4:29107598-29107620 GTTAGGAAGCAGAGAAAGGGAGG - Intergenic
971735660 4:30447116-30447138 GTGAAGAAGCATACACAGGAGGG + Intergenic
972337035 4:38116308-38116330 GAGCAGATGCAGAGGCTGGGAGG - Intronic
973828930 4:54738523-54738545 GTGCACAAGCAGAGGCTGGGAGG - Exonic
974184602 4:58430231-58430253 CTGCAGAGGCAGTGACAGAGAGG + Intergenic
974249005 4:59360647-59360669 GTGTAGAGGCAGAGACCTGGTGG + Intergenic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
976621798 4:87135885-87135907 ATGCAGAAGCAGAGATGAGGAGG + Exonic
978160657 4:105543686-105543708 GTGAAGAAACTGAGTCAGGGAGG + Intergenic
978262131 4:106772922-106772944 ATGCAGAAGCTGAAACAGTGTGG + Intergenic
978608322 4:110507480-110507502 AGGCAGAAACAGATACAGGGAGG - Intronic
979065662 4:116129436-116129458 GGGCAGAGAGAGAGACAGGGAGG - Intergenic
979253007 4:118585007-118585029 GTGCTCAAGGACAGACAGGGAGG + Intergenic
979829318 4:125280942-125280964 GTGTGGAGGGAGAGACAGGGCGG + Intergenic
980595786 4:134952713-134952735 GTGCAGAAGCAGACCCATGCTGG - Intergenic
980713662 4:136603681-136603703 ATGCCTAAACAGAGACAGGGTGG + Intergenic
980984774 4:139684738-139684760 GTGCAGTAGTAAAGACAGGAAGG + Intronic
981633389 4:146847547-146847569 GCACTGAGGCAGAGACAGGGAGG + Intronic
982027255 4:151263230-151263252 GTGCAGAAGCAGAGAACTTGAGG + Intronic
982182618 4:152763889-152763911 TTGCAGTATCACAGACAGGGTGG - Intronic
982240681 4:153296492-153296514 ATGCCGATGCAGTGACAGGGAGG - Intronic
982244732 4:153340303-153340325 TTTCAGAATCAGAGAGAGGGTGG + Intergenic
982509063 4:156257814-156257836 GTGGAGTAGGAGTGACAGGGTGG + Intergenic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
983253169 4:165368009-165368031 GTGCATAAGGAGAGTCAGGCAGG - Intronic
983383212 4:167023629-167023651 GTACAGAAGCAGAGAAAAAGGGG - Intronic
984024062 4:174522268-174522290 GTGCACTGGCGGAGACAGGGAGG - Intronic
984243352 4:177244642-177244664 GTGCATAAGCAGACAGATGGTGG + Intronic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
985394841 4:189531238-189531260 GTGGAGAAGCAAAGGCAGGTGGG + Intergenic
985746726 5:1652274-1652296 GTGCACAAGCAGAGGCTGTGGGG + Intergenic
986649892 5:9952959-9952981 GGGCAGAGTCAGAGACAGAGTGG - Intergenic
986942740 5:12974992-12975014 GTGTAGTACCACAGACAGGGTGG - Intergenic
987076381 5:14386106-14386128 GAGCAGAAGAATAGGCAGGGAGG + Intronic
987397188 5:17435781-17435803 ATGCAAAAGCAGAGCCAGGTGGG + Intergenic
987890357 5:23868031-23868053 GGGGAGAAGTTGAGACAGGGTGG - Intergenic
989012525 5:36889323-36889345 GTTCAGAAGTAGAGCCAGAGTGG - Intronic
989168187 5:38450768-38450790 GTGTTGAGGCAGAGCCAGGGTGG - Intronic
992105651 5:73447643-73447665 GCGCAGCAGCAGAGACTCGGCGG + Exonic
992520489 5:77545704-77545726 GTGCAGAAGCAGACCCACGCTGG + Intronic
993316068 5:86407922-86407944 GTGTACATGCAGAGACAGGAAGG + Intergenic
993723140 5:91341458-91341480 AGGCAGAAGTAGAAACAGGGAGG + Intergenic
994835136 5:104842110-104842132 GTGTAGAAAGAGAGAGAGGGAGG + Intergenic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
996097955 5:119419048-119419070 GACTGGAAGCAGAGACAGGGAGG - Intergenic
996185918 5:120475160-120475182 ATGAAGAAGCACAGACAGAGAGG + Intronic
996501350 5:124219743-124219765 CTGCAGAAAGAGAGACAGAGAGG + Intergenic
997291433 5:132738534-132738556 GTGCAGAAGAAGCAAGAGGGAGG - Intergenic
997837383 5:137206568-137206590 GTGAAGAAACAGACACACGGTGG - Intronic
998043758 5:138970135-138970157 TTGCAGAAGCAGAGGCAGAGAGG + Intronic
998383626 5:141743367-141743389 GTGCATAAGCACTGACAGTGGGG - Intergenic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
999453623 5:151696930-151696952 GTGGAGAAGAAGAGACGGGTGGG - Intergenic
1000031683 5:157407129-157407151 CTGCAGAGGCAGTGACAGAGAGG - Intronic
1000147720 5:158469456-158469478 GCACAGAAGCAGAGACCGGAAGG - Intergenic
1000293097 5:159889561-159889583 ATGAAGAAGTAGAGACAGAGAGG + Intergenic
1001125142 5:169012592-169012614 GGTCAGAAGGAGAGACAGCGTGG - Intronic
1001257411 5:170194527-170194549 GAGCAGAGGCAGAGTCTGGGAGG + Intergenic
1001505536 5:172276689-172276711 GTGCAGAGACAAAGAAAGGGAGG + Intronic
1001552893 5:172617332-172617354 GTGCAGCTGGAGATACAGGGAGG - Intergenic
1002272793 5:178083733-178083755 CTGCAGGTGCCGAGACAGGGAGG + Intergenic
1002320775 5:178374384-178374406 GGGCAGCAGCAGAGATAGGCAGG - Intronic
1002376432 5:178792264-178792286 GTGCAGAACCTGTGACTGGGGGG - Intergenic
1002401053 5:178991782-178991804 GGGCAGAAGCAGAAAGATGGGGG - Intronic
1003114744 6:3276399-3276421 GTGCAGAAGATGCGCCAGGGAGG - Intronic
1003153168 6:3570010-3570032 GTGCAGGAGAGGAGAGAGGGAGG - Intergenic
1004176029 6:13340991-13341013 GGGAAGAAACAGAGACAGAGAGG + Intergenic
1004498679 6:16189334-16189356 GTGCTGAGGCTGAGACAGGCAGG - Intergenic
1005306432 6:24518372-24518394 CTGGAGAAGCAGAGACTGAGTGG + Intronic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006125874 6:31837731-31837753 GAGCAGCAGCAAAGGCAGGGAGG + Intronic
1006845675 6:37059793-37059815 GAGGAGGAGGAGAGACAGGGCGG + Intergenic
1007281269 6:40714005-40714027 GTGGAGTAGCAGGGACAGGGGGG + Intergenic
1007590565 6:43018318-43018340 GGGCAGAGGCAGAGAGATGGTGG - Intronic
1008558336 6:52697551-52697573 GTGCAGAAGAAGGTGCAGGGAGG - Intergenic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1008973897 6:57401943-57401965 CTGCAGAGGCAGTGGCAGGGAGG + Intronic
1009162787 6:60303448-60303470 CTGCAGAGGCAGTGGCAGGGAGG + Intergenic
1010019240 6:71139926-71139948 CTGCAGAGGCAGTGGCAGGGAGG - Intergenic
1010451894 6:76013032-76013054 GTGCAGGAGTAGGGATAGGGAGG - Intronic
1010638017 6:78283947-78283969 GTGCAGAAACAGAGTTGGGGAGG - Intergenic
1013729754 6:113151189-113151211 GGGCAGAAGGAGAGAGAAGGTGG + Intergenic
1016512834 6:144862939-144862961 GGGCAGCAGGAGAGACAGGGAGG - Intergenic
1016688901 6:146912977-146912999 GGGCTGGAGCAGAGACAGGGTGG - Intergenic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1018065594 6:160123265-160123287 GGGCAGGACCAGAGGCAGGGAGG - Intronic
1019156100 6:170039823-170039845 GTGCACCAGCAGGGACATGGTGG - Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019865858 7:3709407-3709429 GTGCTGAACCTGATACAGGGAGG - Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1019963834 7:4483234-4483256 TTTTAGAAACAGAGACAGGGAGG - Intergenic
1020927837 7:14355152-14355174 GTGGAGAAAGAGAGAGAGGGAGG - Intronic
1022489664 7:30806898-30806920 AGGCAGAAGCAGGGACATGGAGG - Intronic
1022516719 7:30979376-30979398 AGTCAGATGCAGAGACAGGGAGG - Exonic
1022613332 7:31899616-31899638 GGGAAGAATAAGAGACAGGGTGG + Intronic
1022622263 7:31996689-31996711 GTGCAGCAGCAGAGAGATGTTGG - Intronic
1022943482 7:35260495-35260517 ATGCAGATGCACAGACAGTGGGG + Intergenic
1023090361 7:36611679-36611701 GGCCAGAAGCAGGAACAGGGAGG + Intronic
1023973038 7:45005851-45005873 GTTCAGAAGCAGAGATGAGGTGG + Intronic
1024082015 7:45863925-45863947 GTCCTGGAGCAGAGACAGAGTGG + Intergenic
1024475198 7:49801907-49801929 GTGAAGGAGGAGAAACAGGGTGG - Intronic
1024934891 7:54702074-54702096 CTGTAGAGGCAGAGACAGGCGGG + Intergenic
1026183023 7:68059050-68059072 AGGTAGAAGGAGAGACAGGGAGG - Intergenic
1026195164 7:68166730-68166752 ATGCATAAGCAGAGTCTGGGAGG - Intergenic
1027257743 7:76442032-76442054 ATTCGGAAGCAGACACAGGGTGG - Exonic
1027281105 7:76610003-76610025 ATTCGGAAGCAGACACAGGGTGG + Exonic
1027358610 7:77384895-77384917 CTCCAGAGGCAGAGACATGGGGG + Intronic
1027917281 7:84341613-84341635 GGGCAGAAGTAGAGACAGAGGGG - Intronic
1029117498 7:98244812-98244834 GGACAGAAGCAGGGACAGGCGGG + Intronic
1029176003 7:98664855-98664877 GGGCAGGAGGTGAGACAGGGAGG - Intergenic
1029618096 7:101672527-101672549 GTCCAGAAGAAGAGGCAGTGAGG + Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030161411 7:106512175-106512197 GAGCAGAAGCTGAGACAGTCTGG - Intergenic
1031733410 7:125326268-125326290 ATACAGAAGCATAGGCAGGGCGG - Intergenic
1032491958 7:132330440-132330462 GGACAGAAACAGAGAAAGGGCGG + Intronic
1032725544 7:134587129-134587151 GGGAAGAAGCAGAGAGAGAGGGG + Intergenic
1033387503 7:140892761-140892783 GTGGGGAAGTAAAGACAGGGAGG - Intronic
1034010427 7:147523617-147523639 CTGCAGAAGCAGAGAGGAGGAGG - Intronic
1034354713 7:150443330-150443352 GTGCTGAAGGAGACACAGGGTGG + Intergenic
1034543810 7:151776910-151776932 GCTCAGAAGCAGAGACTGTGAGG - Intronic
1034961012 7:155364448-155364470 GTGCAGGAGCAGACACACCGTGG + Intronic
1035054716 7:156026898-156026920 GAGAAGCAGCAGAGACAGGCTGG + Intergenic
1035158781 7:156935642-156935664 GTGCACAGCCGGAGACAGGGAGG + Intergenic
1035259229 7:157650924-157650946 GTGCACAGGCAGAGACACGACGG + Intronic
1035403852 7:158586462-158586484 GTGCAGAAGCAAACGCAGGCGGG - Intronic
1035437663 7:158871261-158871283 TGCCAGGAGCAGAGACAGGGTGG + Exonic
1037475124 8:19249534-19249556 GTGAAGAAGCGGAGACAGCCGGG + Intergenic
1037501140 8:19486503-19486525 GTGCAGGGGCAGAGCCAGTGAGG - Intronic
1037771658 8:21804601-21804623 GGACAGAAGAAGAGGCAGGGTGG - Intronic
1038443896 8:27589702-27589724 GTGCAGAAGAGGAGACAGGGAGG - Intergenic
1039566126 8:38553809-38553831 GGGGAGGAGCAGAGCCAGGGAGG + Intergenic
1039635145 8:39156739-39156761 GTGCAGATACAGGGAGAGGGTGG - Intronic
1039826186 8:41175877-41175899 GTGCTGCGGCTGAGACAGGGTGG - Intergenic
1040003018 8:42595247-42595269 GTGGAGAAGGAGAGACCGTGGGG - Intergenic
1041463055 8:58132572-58132594 ATGGGGAAGCAGAGACATGGAGG - Intronic
1041600450 8:59711438-59711460 GTGAAGAAGCAGAGAGAAGGTGG + Intergenic
1042653121 8:71065332-71065354 GTGCATAATCAGAGAAAGAGAGG - Intergenic
1043729188 8:83652692-83652714 GGGAAGAAACAGAGACAGAGAGG - Intergenic
1043924968 8:86026470-86026492 GTGCAGAAGGAGAGTGAGTGGGG - Intronic
1044644232 8:94421072-94421094 TTGAAGAAGCAGAGGCAGTGTGG - Intronic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1045253620 8:100501471-100501493 AGGGAGAAGCGGAGACAGGGAGG + Intergenic
1045391393 8:101718536-101718558 ATGCAGACGCTGAGGCAGGGAGG - Intronic
1046615320 8:116471160-116471182 GTGCATTAGCTGAGGCAGGGAGG + Intergenic
1048057921 8:130886367-130886389 GGGCTGGAGCAGAGACAAGGAGG + Intronic
1048319387 8:133386591-133386613 GACCAGAAGCAGAGAAAGGCTGG + Intergenic
1048637425 8:136312380-136312402 CTGCAGAAGCAGACACCAGGAGG - Intergenic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049196887 8:141320646-141320668 GTGCAGGTGCAGGGACTGGGTGG + Intergenic
1049268380 8:141681496-141681518 GAGGGGAAGCAGAGACGGGGAGG + Intergenic
1049274526 8:141713135-141713157 CTGCAGAAGCTCAGAAAGGGAGG + Intergenic
1049414256 8:142488156-142488178 GTCCAGGAGCAGAGACAGCAAGG - Intronic
1049847735 8:144811361-144811383 GTGCAGCGCCTGAGACAGGGTGG + Intergenic
1049934989 9:493078-493100 GTGAATATTCAGAGACAGGGAGG - Intronic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050463274 9:5894983-5895005 GTGCATAAGCAGGGTCAGGTGGG + Intronic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1053143571 9:35697275-35697297 GGGCAGTAGGAGAGACAGTGGGG - Exonic
1055407978 9:75994725-75994747 GTGCAGAAGTAAAAACTGGGAGG - Intronic
1055647487 9:78374886-78374908 CAGCAGAAGCAGAGACGGTGTGG + Intergenic
1056463057 9:86826647-86826669 GGGCAGAAGAAGAGAGAGGAAGG - Intergenic
1056697884 9:88875449-88875471 GCCCAGAAGCAGAGGGAGGGAGG - Intergenic
1056796098 9:89659902-89659924 GAGCAGAAGCAGAAACCTGGAGG - Intergenic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1056980022 9:91301178-91301200 GAGCAGAAGCAGAGAAAGAGTGG + Intronic
1057188616 9:93073187-93073209 GTGCAGAGGCAGAGACTGACCGG - Intronic
1058637321 9:107049276-107049298 GTGCAGGAGGAGGGAGAGGGAGG - Intergenic
1059088341 9:111329112-111329134 AGGCTGAAGCTGAGACAGGGAGG + Intergenic
1059358272 9:113718297-113718319 CTGCAGAAGCGAAGGCAGGGAGG + Intergenic
1059422250 9:114199508-114199530 CAGCAGAAGCAAACACAGGGAGG - Intronic
1059454369 9:114390236-114390258 GTGCATGAGCAAAGGCAGGGAGG - Intronic
1059889370 9:118784441-118784463 GGACAGAAGTAGAGTCAGGGAGG + Intergenic
1060422436 9:123478913-123478935 CTGCTGATGCAGTGACAGGGAGG + Intronic
1060442676 9:123656183-123656205 AGGCAGAGGCAAAGACAGGGTGG + Intronic
1060581632 9:124752905-124752927 GAGGAGAGGCAGGGACAGGGAGG + Intronic
1061123236 9:128657030-128657052 GCGCAGAAGCGAAGAGAGGGCGG + Intergenic
1061729597 9:132603527-132603549 GTGCAGAAGGGGAGACCTGGGGG + Intronic
1061873575 9:133533212-133533234 GTGCTGAATCACAGACATGGTGG - Intronic
1062013511 9:134279905-134279927 GTGAAGGAGCAGGGCCAGGGAGG - Intergenic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062264774 9:135681943-135681965 AGGCTGCAGCAGAGACAGGGTGG - Intergenic
1062332380 9:136050504-136050526 GTGCAGCATCTGAGACATGGCGG + Exonic
1062606522 9:137351066-137351088 GTGGAGAAGCAGATTCTGGGCGG - Exonic
1203779564 EBV:93591-93613 GTGCAGAAGCTGGGAGATGGTGG - Intergenic
1185490914 X:516372-516394 GGGCAGAAACACAGACAGAGAGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186204107 X:7183313-7183335 GTCCAGCAGCAGACAGAGGGAGG - Intergenic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187760888 X:22583152-22583174 GTGCAGATGGAGTGACAGGAAGG - Intergenic
1188538080 X:31219404-31219426 GTGGAGAATAAGAGAGAGGGCGG - Intronic
1189248554 X:39582025-39582047 GAGCAGGAGCAGCAACAGGGTGG + Intergenic
1189280496 X:39817465-39817487 GAGCAGAGGCAGAGACAATGGGG - Intergenic
1189327840 X:40123739-40123761 GTGCAAGAGCACAGACTGGGAGG + Intronic
1191082514 X:56528780-56528802 GTGCAGAGGTGGAGACAGGTTGG + Intergenic
1192034063 X:67544937-67544959 GTGCAGAAGAAGACACACGGTGG - Exonic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192191886 X:68996078-68996100 GTGGAGAAGCTGGGGCAGGGCGG + Intergenic
1192218912 X:69183449-69183471 GTGAAGAAGAAGAGAGAGGCAGG - Intergenic
1192275302 X:69623769-69623791 GTGGAGAAGCAGACCCAGAGGGG + Intronic
1192450895 X:71244256-71244278 GTGGGGAGGCAGGGACAGGGAGG - Intronic
1193005960 X:76618284-76618306 TTGCAGAGGCAGTGACAGAGAGG - Intergenic
1193833558 X:86316205-86316227 ATCTAGAAGCAGACACAGGGGGG - Intronic
1194519553 X:94901820-94901842 GTGCACAAGCAGGGAAGGGGTGG + Intergenic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1196601297 X:117604452-117604474 GAGCAGAAAGAGAGAGAGGGGGG - Intergenic
1197076952 X:122364211-122364233 CTGCAGAGGCAGTGACAGAGAGG + Intergenic
1198176116 X:134156637-134156659 GTGCAGGAGCAGAGAAAAGGGGG + Intergenic
1199495793 X:148451020-148451042 GTGAAGATGCAGAGAGAAGGTGG - Intergenic
1199665835 X:150095719-150095741 ATGAGGAAACAGAGACAGGGAGG - Intergenic
1200211100 X:154346873-154346895 GTGATGGAGCAGACACAGGGAGG + Intergenic
1200219752 X:154385219-154385241 GTGATGGAGCAGACACAGGGAGG - Intergenic
1201642888 Y:16198342-16198364 GAGAAGAAGAAGAGACAGAGAGG - Intergenic
1201659927 Y:16386979-16387001 GAGAAGAAGAAGAGACAGAGAGG + Intergenic