ID: 949905128

View in Genome Browser
Species Human (GRCh38)
Location 3:8852670-8852692
Sequence CTCTACAGAGACTCTTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949905116_949905128 18 Left 949905116 3:8852629-8852651 CCGGTGCCTCCCTTCCTTTCTGG 0: 1
1: 0
2: 5
3: 40
4: 560
Right 949905128 3:8852670-8852692 CTCTACAGAGACTCTTGTGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134
949905120_949905128 8 Left 949905120 3:8852639-8852661 CCTTCCTTTCTGGAGCAGCTCTT 0: 1
1: 0
2: 3
3: 28
4: 309
Right 949905128 3:8852670-8852692 CTCTACAGAGACTCTTGTGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134
949905115_949905128 19 Left 949905115 3:8852628-8852650 CCCGGTGCCTCCCTTCCTTTCTG 0: 1
1: 0
2: 6
3: 68
4: 679
Right 949905128 3:8852670-8852692 CTCTACAGAGACTCTTGTGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134
949905118_949905128 12 Left 949905118 3:8852635-8852657 CCTCCCTTCCTTTCTGGAGCAGC 0: 1
1: 0
2: 0
3: 37
4: 396
Right 949905128 3:8852670-8852692 CTCTACAGAGACTCTTGTGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134
949905121_949905128 4 Left 949905121 3:8852643-8852665 CCTTTCTGGAGCAGCTCTTCCAG 0: 1
1: 0
2: 1
3: 25
4: 303
Right 949905128 3:8852670-8852692 CTCTACAGAGACTCTTGTGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134
949905119_949905128 9 Left 949905119 3:8852638-8852660 CCCTTCCTTTCTGGAGCAGCTCT 0: 1
1: 0
2: 1
3: 30
4: 334
Right 949905128 3:8852670-8852692 CTCTACAGAGACTCTTGTGGGGG 0: 1
1: 0
2: 1
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949905128 Original CRISPR CTCTACAGAGACTCTTGTGG GGG Intronic
900276578 1:1833530-1833552 CTCTACAGTGCCTGTTGTGTTGG - Intronic
904555972 1:31364535-31364557 AGCCACAGAGACTGTTGTGGAGG + Exonic
905420721 1:37841628-37841650 CTGCACAGAGACTCTGGTGTGGG - Intronic
909743024 1:79055872-79055894 CGATACAGAGAATCTTGTGCGGG - Intergenic
912752657 1:112298574-112298596 ATCTGCAAAGCCTCTTGTGGTGG - Intergenic
913966278 1:143380116-143380138 CACTGCAGAGACTCATGCGGTGG - Intergenic
914060652 1:144205723-144205745 CACTGCAGAGACTCATGCGGTGG - Intergenic
914118498 1:144760646-144760668 CACTGCAGAGACTCATGCGGTGG + Intergenic
918069953 1:181127457-181127479 CTCTCCGGAGACACTTGTGCAGG - Intergenic
918948556 1:191103926-191103948 CTCAACAGAAACTATTTTGGTGG + Intergenic
1067247393 10:44558185-44558207 CTCAGCAGAGACTCATCTGGGGG - Intergenic
1068203697 10:53818864-53818886 TTCTACAGAGATTCTTTTGTTGG - Intronic
1074604487 10:114947196-114947218 CTCTACGGAGGCTCTAGTGAAGG + Intronic
1075874148 10:125792731-125792753 CCCTACAGGGACTCCTGGGGAGG + Intronic
1076125367 10:127969929-127969951 CTCTTCAGAAACTCTGGTGCTGG + Intronic
1076584074 10:131533436-131533458 CTCCCCAGAGACTCTAGGGGAGG - Intergenic
1076701822 10:132277246-132277268 CTCTCCAGCGGCTCTCGTGGAGG - Intronic
1077791575 11:5446745-5446767 CTGGACAGAGAGTCCTGTGGGGG - Intronic
1079459579 11:20668629-20668651 CTCTCCAGAGAATGTTGTGGTGG + Intergenic
1082077905 11:47988652-47988674 CTCTACAGATAAACTTGTGAAGG - Intronic
1086048018 11:82555869-82555891 CTATACAAAGAATCTTGTGAAGG + Intergenic
1086832992 11:91588343-91588365 CTCTACAGAGAATAGTATGGAGG - Intergenic
1087467956 11:98533534-98533556 ATCTACATAGACTCATGTAGAGG + Intergenic
1088966182 11:114723704-114723726 CTTTACAAAGTCTCTGGTGGGGG + Intergenic
1089346535 11:117795200-117795222 GTCTCCAGAGAGTGTTGTGGAGG + Intronic
1090544076 11:127743422-127743444 CTCTACAGAGTCTCCTCTCGAGG + Intergenic
1091263239 11:134250482-134250504 CTCCACAGAGACACTTTTGCTGG + Intronic
1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG + Exonic
1091428444 12:411952-411974 CTCTACAAAGAAGCTTGTGAAGG + Exonic
1093199312 12:16168048-16168070 CTCAATTGAGACTTTTGTGGTGG - Intergenic
1093513427 12:19956318-19956340 CTCTTCAGAGACTCTGCAGGAGG - Intergenic
1095403191 12:41838778-41838800 CCTTACAGAGCTTCTTGTGGGGG + Intergenic
1105569257 13:21585026-21585048 CTATACAGTGACTCTTCTGGGGG - Intronic
1108075923 13:46679736-46679758 CTGTACAGAGAAGCTTGGGGAGG + Intronic
1110425794 13:75364823-75364845 CTCTGTAGAGACACTTTTGGAGG - Intronic
1116529795 14:45956026-45956048 CACTACAGATACTCATGGGGAGG + Intergenic
1117666677 14:58063057-58063079 CCCTACAGAGCCTCTAGAGGAGG + Intronic
1117803423 14:59466522-59466544 ATCTACTGAAACTCCTGTGGTGG + Intronic
1121643497 14:95501906-95501928 GTCTTCACAGACTCTTGCGGGGG + Intergenic
1121913119 14:97810430-97810452 CCCTCCAGAGGCTCTTGGGGAGG + Intergenic
1122294927 14:100700073-100700095 CTCTCCAGAGGCTCTAGGGGAGG - Intergenic
1123191821 14:106579035-106579057 CTCGGCACAGACTCCTGTGGGGG + Intergenic
1127377523 15:58398584-58398606 CTCTTCAGACAATCTTTTGGGGG - Intronic
1131354623 15:91734023-91734045 CACTACAGATACTTTTGGGGGGG - Intergenic
1141534666 16:84670755-84670777 CTATACAGAGACTCTGGTGGTGG - Intergenic
1143529341 17:7492795-7492817 CTCTGCAGTGTCTGTTGTGGAGG + Intronic
1147791953 17:43019630-43019652 CTGCACAGAGGCTCTCGTGGGGG - Intronic
1148377176 17:47159224-47159246 CTGTACGGAGACTCTAGTGTGGG + Intronic
1148617615 17:49013077-49013099 CTCAACTCAGCCTCTTGTGGTGG + Intronic
1152325426 17:79633262-79633284 CTCTCCAGGGAGTCTTCTGGCGG - Intergenic
1155611049 18:27668071-27668093 CTCTTCAGAAGCTCCTGTGGGGG + Intergenic
1157422930 18:47561055-47561077 CTTTTCAGAAACTCATGTGGTGG - Intergenic
1158464180 18:57675089-57675111 CTCTGCTGAGGCTCCTGTGGGGG + Intronic
1162674086 19:12285130-12285152 CTGCACAGAGACTCTGGTGTGGG - Intronic
1164471990 19:28543928-28543950 CTGTCCAGAGACAGTTGTGGTGG + Intergenic
1167119696 19:47509265-47509287 TTCTAGAGAGTTTCTTGTGGTGG + Intronic
1167222423 19:48209600-48209622 CTCTTCTGAGACTCTTATTGTGG - Exonic
1168049244 19:53816378-53816400 AGCTACAGAGACTGTTGGGGGGG - Intronic
1202700059 1_KI270712v1_random:157611-157633 CACTGCAGAGACTCATGCGGTGG - Intergenic
925383562 2:3445950-3445972 CCCTCCTGAGACTCTTGAGGGGG + Intronic
926027150 2:9555503-9555525 CTTTACCGAGTCTCTGGTGGGGG + Exonic
926138349 2:10353348-10353370 CTCTACAGACACTCTTTTAGAGG - Intronic
926692848 2:15749023-15749045 CACTTCAGAGACCCTTGTGAAGG - Intergenic
929194294 2:39169517-39169539 CTCTAGAAAGCCTCTTGTAGTGG + Intergenic
929624354 2:43391106-43391128 TCCTACAGAGCCTCTTCTGGAGG - Intronic
930171332 2:48254777-48254799 CTCTCCAGAGAGTCCTGAGGTGG + Intergenic
931624975 2:64249229-64249251 CTCTACACTGAATCTGGTGGTGG - Intergenic
932947464 2:76252804-76252826 CTCTACAGAGAATCCTGGTGAGG + Intergenic
933688241 2:85159869-85159891 AGCAACAGAGACGCTTGTGGAGG - Intronic
934170991 2:89541086-89541108 CACTGCAGAGACTCATGCGGTGG - Intergenic
934281296 2:91615404-91615426 CACTGCAGAGACTCATGCGGTGG - Intergenic
938962682 2:136357312-136357334 CTCTGCAGATAATCTTGTAGAGG - Intergenic
939364604 2:141216038-141216060 CACTTCAGAGGCTTTTGTGGTGG + Intronic
942703960 2:178747119-178747141 CTCTCCAGAGTCTCTCCTGGGGG + Intronic
947307632 2:228764924-228764946 CTCTGCAGAGATTTTTATGGAGG - Intergenic
948589181 2:239038569-239038591 CCCTACAGAGGCTCTAGGGGAGG + Intergenic
948710371 2:239821504-239821526 CTCCACAGACACTCCTGTGCTGG - Intergenic
1178357351 21:31920044-31920066 CCCTCCAGAGACTCTAGGGGAGG + Intronic
1181417796 22:22772740-22772762 CTCTATAGAGACTCCTGGAGGGG - Intronic
1184480341 22:44743074-44743096 CTCTACTGAGACTGGAGTGGAGG + Intronic
949151440 3:772717-772739 CACTCCAGGGACTGTTGTGGGGG - Intergenic
949784577 3:7726208-7726230 CTCTTCAGAGACTATTTTGCAGG + Intronic
949905128 3:8852670-8852692 CTCTACAGAGACTCTTGTGGGGG + Intronic
951630485 3:24714797-24714819 CTCTCCAGAGACTCTAGAGGAGG + Intergenic
954474893 3:50735171-50735193 ATCTACAGATAGTCTTATGGAGG + Intronic
955786460 3:62545563-62545585 CTCTACAGAGATTTTTGGGAGGG - Intronic
956780606 3:72600147-72600169 CTCGACAGAGACTCAGGTGCAGG + Intergenic
961410152 3:126714538-126714560 CTCTACAGAGACTGGGGTGTCGG + Intronic
962418998 3:135210875-135210897 CTCTACAGAGAATCCTTTGCTGG - Intronic
962500332 3:135984909-135984931 CTCTGCACAAACTCTCGTGGTGG - Intronic
967378535 3:188832021-188832043 TTCTACATAGATACTTGTGGAGG + Intronic
967943631 3:194785353-194785375 CCCTAGAGAGAGTCTTTTGGGGG + Intergenic
968625756 4:1625978-1626000 CTCTGCAGAGGATCCTGTGGAGG - Intronic
969028780 4:4194796-4194818 CACTGCAGAGACTCATGCGGTGG + Intronic
970558462 4:17259283-17259305 CACTCCGGAGACTGTTGTGGGGG - Intergenic
972879858 4:43410074-43410096 CTGTACGGAGACTCTGGTGTGGG + Intergenic
974247559 4:59340276-59340298 CTAGACAGAGAATTTTGTGGAGG - Intergenic
975449331 4:74505852-74505874 CTCTATAGAGGCACTTGTAGGGG + Intergenic
976353512 4:84087572-84087594 CACTCCAGAGGCTCCTGTGGAGG - Intergenic
978355390 4:107867136-107867158 CAGTACAGAGAGTCTTGGGGAGG - Intronic
981381657 4:144078988-144079010 CTCTAGAGACAATCTTCTGGTGG + Intergenic
985102101 4:186468709-186468731 CCCTGCAGAGTCTTTTGTGGGGG + Intronic
986299239 5:6465601-6465623 TTCAACAGGGACTCTTGGGGGGG + Intronic
988081975 5:26426448-26426470 CACTCCAGGGACTGTTGTGGGGG + Intergenic
991456309 5:66808054-66808076 CTCTGCAGACAGTCTTGAGGTGG + Intronic
992886839 5:81167841-81167863 CTCTGGAGAGACTCTTAGGGTGG + Intronic
997411829 5:133696612-133696634 CTCAACAGATACTTTTGTGAGGG - Intergenic
999522029 5:152360580-152360602 CTCTACAGAGATTGTTATGAGGG + Intergenic
999670562 5:153955820-153955842 CCCGCCAGAGACTCTTGTAGGGG + Intergenic
999980664 5:156954727-156954749 CACTTCAGAGACTGTTGTGACGG - Exonic
1002056884 5:176603279-176603301 CTCTACACACCCTCTTCTGGAGG + Intronic
1007669333 6:43538855-43538877 CTGCACAGAGACTCTGGTGTGGG + Intronic
1015350283 6:132210165-132210187 CTGTGCAGAGATTCTTGTGTGGG - Intergenic
1018688339 6:166321383-166321405 CTCTTCAGAGCCTCTTGTATGGG + Intronic
1019356758 7:584172-584194 CTCTACACGGACTGGTGTGGAGG + Intronic
1021519463 7:21524808-21524830 CTCTCCTGAGATTCTTGTGGTGG + Intergenic
1021984605 7:26086390-26086412 CTCTACAGAGACTCTAGATTTGG + Intergenic
1032886727 7:136148322-136148344 CTGTACAGAGACATTTTTGGAGG - Intergenic
1033447404 7:141435500-141435522 CACTCCAGAGTCTCTTGTGGTGG + Intronic
1034513568 7:151555322-151555344 CTCTGCAGACACTCATGTGTTGG + Intergenic
1035334275 7:158115584-158115606 ATCTACAGAGCCTCTTGTAGAGG - Intronic
1035556410 8:570371-570393 CCCTGCAGAGCCTTTTGTGGGGG + Intergenic
1039740629 8:40379522-40379544 CTCTGCAGAGAGTCTGGTGAGGG + Intergenic
1039983346 8:42427698-42427720 CACTCCAGATACTCTTGTGAGGG + Intronic
1041015590 8:53590449-53590471 CTCTCCAGAGGCCCCTGTGGTGG - Intergenic
1045413678 8:101945115-101945137 CTCTCCAGAGAGTCTTGCTGGGG - Intronic
1046647279 8:116799944-116799966 CTCTCTGGAGACTCTTGTGTGGG + Intronic
1049344340 8:142130441-142130463 GGCTGCAGGGACTCTTGTGGGGG - Intergenic
1049959452 9:724495-724517 CTCTACAAAGAGTGTTCTGGCGG + Intronic
1050232425 9:3541176-3541198 CTCTGGAGACCCTCTTGTGGAGG + Intergenic
1055638666 9:78301994-78302016 CAATACAGAGAATCTTGTGCGGG + Exonic
1056848644 9:90062055-90062077 CTATGCAGCCACTCTTGTGGTGG - Intergenic
1058807760 9:108608697-108608719 CTCTTCTTAGACTCTAGTGGGGG + Intergenic
1060689022 9:125639630-125639652 CTCTAAAGAGACGATTGTTGTGG + Intronic
1062365530 9:136206773-136206795 CTTTCCAGAAACCCTTGTGGAGG - Exonic
1185511276 X:666727-666749 CCCTCCAGAGGCTCTTGAGGAGG - Intergenic
1185520489 X:734803-734825 ATCTACAGAGTATCTTGGGGAGG + Intergenic
1185622756 X:1463699-1463721 CCCTCCAGAGACTCTAGGGGAGG + Exonic
1185680389 X:1884217-1884239 CCCTCCAGAGACTCTAGGGGAGG + Intergenic
1185794204 X:2950852-2950874 CTCTCCAGAGGCTCTAGGGGAGG + Intronic
1185822671 X:3220047-3220069 CCCTCCAGAGGCTCTAGTGGGGG + Intergenic
1186814703 X:13225032-13225054 CTCTACATAGCGTCTAGTGGTGG + Intergenic
1195649874 X:107273260-107273282 CTCTCTAGAGCCTCTTTTGGGGG - Intergenic