ID: 949905266

View in Genome Browser
Species Human (GRCh38)
Location 3:8853487-8853509
Sequence GGGGCCCCATGGTGATCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949905266_949905274 17 Left 949905266 3:8853487-8853509 CCTCTAGATCACCATGGGGCCCC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 949905274 3:8853527-8853549 TGCTTTGTGAGACCCTGAACGGG 0: 1
1: 0
2: 2
3: 31
4: 164
949905266_949905273 16 Left 949905266 3:8853487-8853509 CCTCTAGATCACCATGGGGCCCC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 949905273 3:8853526-8853548 TTGCTTTGTGAGACCCTGAACGG 0: 1
1: 0
2: 2
3: 24
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949905266 Original CRISPR GGGGCCCCATGGTGATCTAG AGG (reversed) Intronic