ID: 949907167

View in Genome Browser
Species Human (GRCh38)
Location 3:8867396-8867418
Sequence TGTTAGGCTTGGGAGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 438}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949907167_949907177 16 Left 949907167 3:8867396-8867418 CCTCTCCCCTCCCAAGCCTAACA 0: 1
1: 0
2: 1
3: 37
4: 438
Right 949907177 3:8867435-8867457 TTATTCCCCACATGCTGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 99
949907167_949907176 11 Left 949907167 3:8867396-8867418 CCTCTCCCCTCCCAAGCCTAACA 0: 1
1: 0
2: 1
3: 37
4: 438
Right 949907176 3:8867430-8867452 TTCATTTATTCCCCACATGCTGG 0: 1
1: 0
2: 1
3: 13
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949907167 Original CRISPR TGTTAGGCTTGGGAGGGGAG AGG (reversed) Intronic
900662198 1:3790357-3790379 GCTTGGCCTTGGGAGGGGAGTGG + Intronic
901587102 1:10305494-10305516 TATTTGGCTTGAGAGGGAAGAGG + Intronic
902394545 1:16125400-16125422 TGGGCGGCTGGGGAGGGGAGTGG + Intronic
902534150 1:17109444-17109466 GGTTAAGGTGGGGAGGGGAGTGG - Intronic
902630383 1:17701243-17701265 GGTGAGGGTTGGAAGGGGAGGGG + Intergenic
902705559 1:18201743-18201765 TCTTCGGCATGGGATGGGAGAGG - Intronic
902798454 1:18814766-18814788 TGGTGGGTTGGGGAGGGGAGTGG - Intergenic
904029916 1:27527691-27527713 GGCTTGGCTGGGGAGGGGAGAGG - Intergenic
904262474 1:29297601-29297623 TGATAGGCATGGGAGGAGACAGG + Intronic
904328325 1:29741937-29741959 GGTCAGGCTTTGGAGGGGTGGGG - Intergenic
904466724 1:30712457-30712479 TGTTGGGGGCGGGAGGGGAGAGG + Exonic
905618424 1:39418274-39418296 TGTTAGGCTTGGGATGCCTGTGG + Intronic
905912675 1:41664579-41664601 TATCAGTCCTGGGAGGGGAGAGG - Intronic
908255480 1:62300021-62300043 TGTTGGGCTTGGCAGGTGGGAGG - Intronic
908717511 1:67086425-67086447 TGTGAGGCTAGGGAGGTAAGAGG - Intergenic
909855217 1:80521033-80521055 GGTTGGGGATGGGAGGGGAGGGG + Intergenic
909921745 1:81389748-81389770 TGTTAGGCATTGGGTGGGAGTGG + Intronic
911521022 1:98930953-98930975 TGGTAGGCGTGGGAGAAGAGAGG - Intronic
912714910 1:111976313-111976335 TTTTAGGCTTAGGAGGGTTGGGG - Intronic
913250317 1:116908010-116908032 TGTTAGGCCTTGGAAGGTAGTGG - Intergenic
915530242 1:156499055-156499077 TGTTGGGGTTGGGAGAGGAGTGG + Intronic
915941900 1:160123539-160123561 TCTTAGGCTGGAAAGGGGAGAGG + Intronic
915943235 1:160132214-160132236 TGTAGGGGTTGGCAGGGGAGAGG + Intronic
916005248 1:160653851-160653873 TGTTAGGGTTGAGGGGAGAGTGG + Intergenic
916165553 1:161964211-161964233 AATTAGGCTTGGGAGAAGAGTGG - Intergenic
916667161 1:166976527-166976549 AGTTAGTCGTGGGTGGGGAGGGG + Intronic
916727960 1:167540238-167540260 TCTTAGACTGGGGTGGGGAGGGG - Intronic
918474556 1:184909534-184909556 TGCTAGGCTTGGGAGGGTCCAGG + Intronic
918996295 1:191764703-191764725 TGGTAGGCATGGGAGAGGAGTGG - Intergenic
919033532 1:192276429-192276451 TGTCAGGGGTGGGTGGGGAGAGG - Intergenic
919035387 1:192301143-192301165 TGTTAGTCTGAGGAGGGAAGGGG - Intergenic
919170277 1:193945223-193945245 TGAGAGACTTGGGAGGGTAGTGG + Intergenic
919938314 1:202269460-202269482 TGATAGGCTGGGGAGGGAAAGGG + Intronic
920259507 1:204679325-204679347 TCTTTGGCTTGGGAGGGCAGAGG - Intronic
920363059 1:205432545-205432567 TGTCAGACTTTGGAGAGGAGAGG + Intronic
920671872 1:208009964-208009986 TCTCAGGCTTGGTGGGGGAGGGG - Intergenic
921055726 1:211541228-211541250 AGGCAGGCTTGGGAGGGGTGGGG - Intergenic
921249225 1:213281018-213281040 TGTGTGGGTGGGGAGGGGAGGGG - Intergenic
921712526 1:218387231-218387253 TGGCAGGGGTGGGAGGGGAGTGG + Intronic
924645631 1:245874904-245874926 TGTAAAGTTTGGGAGGAGAGAGG + Intronic
924931016 1:248732562-248732584 TGGTAGGCTTCGGAGAGGATAGG - Intronic
1063897964 10:10702060-10702082 TGTTTGATTTTGGAGGGGAGCGG + Intergenic
1064304878 10:14156537-14156559 AGTTACCCCTGGGAGGGGAGAGG + Intronic
1065404646 10:25350188-25350210 AGTAAGGCATGGGATGGGAGGGG + Intronic
1067524847 10:47032031-47032053 GGTCAGACTTGGGTGGGGAGAGG + Intergenic
1067684370 10:48457949-48457971 TGTTGGGGTTGGGTGGGAAGGGG + Intronic
1067813245 10:49447739-49447761 TGAGAGGCTGGGGTGGGGAGGGG - Intergenic
1068218170 10:54010178-54010200 TCTTAGGCTTGGGAGGGACAGGG + Intronic
1068424708 10:56845127-56845149 TGTTAGAGGTGGGAGTGGAGTGG - Intergenic
1069101677 10:64330126-64330148 GGTTGGGCTAGGGAGGGGATTGG + Intergenic
1069944609 10:71977251-71977273 TGCTAGGCTTGGAAGCTGAGCGG - Intronic
1070703385 10:78619385-78619407 TTCAAGGCTTGGGTGGGGAGGGG + Intergenic
1071987606 10:91068293-91068315 TTTTCGGCAGGGGAGGGGAGAGG - Intergenic
1072305885 10:94106945-94106967 TGTTGGGGGGGGGAGGGGAGGGG - Intronic
1072497325 10:95974706-95974728 TGTTAAGATGTGGAGGGGAGAGG - Intronic
1072578018 10:96718127-96718149 TCTTAGGGCTGGGAGAGGAGAGG + Intronic
1072822936 10:98576283-98576305 CTGTAGGCTGGGGAGGGGAGGGG + Intronic
1073603221 10:104867187-104867209 GGGTGGGCTTGGGAGAGGAGAGG + Intronic
1075163164 10:120042046-120042068 TGGTGGGCTTGGGGTGGGAGGGG + Intergenic
1075311594 10:121418921-121418943 TCTTAGGCTTGAGAGGAGACAGG - Intergenic
1075659782 10:124185242-124185264 TGCTGGGATGGGGAGGGGAGGGG - Intergenic
1075802226 10:125160619-125160641 GGGTAGGGTGGGGAGGGGAGGGG - Intronic
1076136013 10:128046140-128046162 TGCCAGGCCTGGGAGGGTAGGGG + Intronic
1076391418 10:130105729-130105751 TGTTTTGTTTGGGGGGGGAGGGG - Intergenic
1076733925 10:132450493-132450515 AGTCAGGCTGGGGAGGGGACCGG - Intergenic
1077137255 11:1006935-1006957 TGTGAGGCTTCGGAGAGGAGGGG - Intronic
1077207443 11:1351846-1351868 TGGGAGGCCTAGGAGGGGAGTGG - Intergenic
1077419446 11:2443821-2443843 TCTCAGGCTTGGGGGGGGGGTGG - Intergenic
1077703345 11:4461635-4461657 TGTTGTGCTTGGGAAGGGAATGG - Intergenic
1078000389 11:7490119-7490141 AGTTAGGCTTTGGTGGGGGGGGG + Intronic
1078369145 11:10730714-10730736 TGTTAGGCTTGTGAAGAGACCGG - Intergenic
1079737450 11:24013943-24013965 TATGAGGCTTGGGAGGGGGCAGG + Intergenic
1080853153 11:36088917-36088939 TGTGAGACTGGGGAGGAGAGGGG - Intronic
1081286277 11:41274190-41274212 TATAGGGCTTGGGAGGGCAGAGG + Intronic
1081638617 11:44737727-44737749 AGTGAGGCTTGCGTGGGGAGGGG - Intronic
1081773488 11:45663663-45663685 TGATGGGGTGGGGAGGGGAGGGG - Intronic
1081910049 11:46694823-46694845 TGCTGGGCTTGGAAAGGGAGGGG - Intronic
1083742968 11:64720913-64720935 TGTGAGCCTGGGGAGGTGAGTGG + Intronic
1084210003 11:67616438-67616460 TGGCAGGCTTTGGAGGGGACTGG + Intergenic
1084482421 11:69429703-69429725 TGAGAAGCTGGGGAGGGGAGGGG + Intergenic
1085048542 11:73367636-73367658 TTTTAGGCCTGGCAGGGGCGGGG - Exonic
1085134886 11:74077624-74077646 TGTTAGGGGTGGGAGGCTAGAGG + Intronic
1085199837 11:74695207-74695229 GATCAGGCTTGGGTGGGGAGGGG + Intergenic
1085527339 11:77172066-77172088 GGCTAAGCCTGGGAGGGGAGAGG + Intronic
1086175008 11:83880604-83880626 TGTTAGGATTGGGGGAGGTGAGG + Intronic
1089619128 11:119712503-119712525 TGCAAGGCTTAGGACGGGAGAGG + Intronic
1089696330 11:120218456-120218478 CGCTGGGCTGGGGAGGGGAGAGG - Intronic
1090485184 11:127106628-127106650 TGTTAGGCTTGGGAAGTGTCAGG + Intergenic
1090534672 11:127627401-127627423 TGTGAGGGTGGGGTGGGGAGGGG + Intergenic
1090919125 11:131192856-131192878 TGTCAGGCCTGGGGAGGGAGGGG - Intergenic
1092097692 12:5857236-5857258 TTTTAGGCATAGTAGGGGAGTGG + Intronic
1092638893 12:10481964-10481986 TGTGATGCTTGAGTGGGGAGGGG + Intergenic
1093630810 12:21407133-21407155 TGATGGGCTTGGGAGTGGACTGG + Intronic
1095161475 12:38922259-38922281 TGTTGGGCGGGGGTGGGGAGGGG - Intergenic
1095838206 12:46662062-46662084 TGTGAGGGTTGGGAGGGCACAGG + Intergenic
1095954495 12:47798480-47798502 TGTGTGGCTTGTGAGGGGTGAGG - Intronic
1096064638 12:48729886-48729908 AGTTGGGGTTGGGAGGGGAAGGG - Intergenic
1096069431 12:48766746-48766768 TGCTAGGTTTGGGAGTGGAAGGG - Exonic
1096079282 12:48823105-48823127 TAATAGGCTTGGGGGAGGAGGGG + Intronic
1097065949 12:56320718-56320740 TGTAAGTCTTGAGAGTGGAGTGG - Intronic
1099027863 12:77488602-77488624 TGGTAGGCTTGAGAGGTGGGAGG - Intergenic
1100111344 12:91245381-91245403 TGTTGGGGTTTGGAGGGTAGGGG + Intergenic
1100218368 12:92477301-92477323 TCTTTGGCTTCGGAGGGGCGTGG + Intergenic
1101400615 12:104383597-104383619 TGCTAGGGCTGGGATGGGAGAGG - Intergenic
1102675672 12:114656800-114656822 TGGGAGGCATGAGAGGGGAGGGG + Intergenic
1102860693 12:116333730-116333752 TGATGGGATTGGGAGGTGAGGGG + Intergenic
1103575061 12:121871499-121871521 TGTGGGGCCTGGCAGGGGAGGGG - Intergenic
1105050430 12:133045143-133045165 TCTTAGGCTGGGGTGGGAAGAGG - Intronic
1105402256 13:20105947-20105969 TGTTAGGGATGGCAGTGGAGGGG - Intergenic
1106020110 13:25906253-25906275 TGCTAGGATTGGGCGGGGGGCGG - Intronic
1106801802 13:33263524-33263546 TTTTAATCTTGGGAAGGGAGTGG + Intronic
1106961640 13:35005395-35005417 TGTGAGACTTTGGAGGAGAGAGG + Intronic
1107956491 13:45518218-45518240 TGTTAGTCTTGAGAGGTTAGAGG - Intronic
1108046150 13:46386856-46386878 TGTTCGGCTTGGGCCGGGAAGGG - Intronic
1108430987 13:50353418-50353440 TGAAAGGCTTGGGAGAGGAGGGG + Intronic
1109789282 13:67226773-67226795 CGCTTGGCTTTGGAGGGGAGGGG + Exonic
1110367767 13:74707183-74707205 TGTTACCCTTGGGTGGCGAGTGG - Intergenic
1110749286 13:79093878-79093900 TGTTGAGCGTGGGGGGGGAGGGG + Intergenic
1112328611 13:98460331-98460353 TTTTCGGAGTGGGAGGGGAGGGG - Intronic
1113381229 13:109808072-109808094 TGGGAGGCTTGGGTGGGGGGGGG - Intergenic
1113966588 13:114156229-114156251 TGCTGGGCGTGGGGGGGGAGGGG + Intergenic
1113966632 13:114156325-114156347 TGCTGGGCGTGGGGGGGGAGGGG + Intergenic
1114366485 14:22032663-22032685 TGTTGGGGTTGGGTGGGTAGGGG - Intergenic
1115338566 14:32268115-32268137 TGTTGGGGTAGGGAAGGGAGGGG - Intergenic
1116429578 14:44830450-44830472 TGTTAGCCTTTGCAGAGGAGGGG - Intergenic
1117994443 14:61466095-61466117 TTTGAGGCTGGGGAGGGGAACGG - Intronic
1119526221 14:75324578-75324600 TATTAGGCTGGGGACGGGCGTGG - Intergenic
1119893300 14:78199304-78199326 TGTTGGGTGTGGGGGGGGAGGGG - Intergenic
1120034676 14:79682991-79683013 TGTGAGGGGTGGGAGGGGACTGG - Intronic
1121166629 14:91807800-91807822 TGTGAGACTTGGGAGGGGCCAGG + Intronic
1121182313 14:91938600-91938622 TGTTATGTCTGGAAGGGGAGAGG + Intronic
1121779913 14:96615702-96615724 TGTGAGGGTTTGGAGGAGAGGGG + Intergenic
1122079756 14:99258395-99258417 TGTAAGGGATGGGAGGGGTGGGG - Intronic
1122088599 14:99323317-99323339 TGTTAGTCCTGGGATGGGTGTGG - Intergenic
1122842500 14:104473273-104473295 TGTGAGGCTTGGGGTGGGAGGGG - Intergenic
1122854831 14:104555007-104555029 TGCTAGGCCTCGGAGGGGTGGGG + Intronic
1123493180 15:20799217-20799239 TCTTAGCCCCGGGAGGGGAGAGG - Intergenic
1123549686 15:21368319-21368341 TCTTAGCCCCGGGAGGGGAGAGG - Intergenic
1124035323 15:26048992-26049014 TGTGTGGGGTGGGAGGGGAGAGG - Intergenic
1124916705 15:33982337-33982359 GGTTTGGATTGGGATGGGAGAGG - Intronic
1125694331 15:41622418-41622440 TGTAATGATTGAGAGGGGAGTGG - Intronic
1126110952 15:45174446-45174468 TGTCAGGGTGGGGAGGGCAGAGG + Intronic
1126311883 15:47326813-47326835 TGTGTGGCTTTGGTGGGGAGGGG - Intronic
1126823590 15:52528700-52528722 TGTCAGGCTGGGGAGGGGGCGGG - Intronic
1126981619 15:54250549-54250571 TGTAAGTGGTGGGAGGGGAGCGG - Intronic
1127725391 15:61744491-61744513 TCGTAGGTTTGGGTGGGGAGTGG + Intergenic
1127889526 15:63236901-63236923 GGTTAGGCTGGGAAGGGTAGTGG - Intronic
1128183544 15:65625294-65625316 TGTGAGGCTTGGGGAGGGAGTGG - Exonic
1128709977 15:69864415-69864437 AATTAGGTTTGGGAGGGGTGAGG + Intergenic
1129029084 15:72605521-72605543 GGTCAGGCTTGGGAGGGGGCAGG - Intergenic
1129411688 15:75354002-75354024 TGGGACGCATGGGAGGGGAGGGG - Intronic
1129699635 15:77760199-77760221 GGTTGGGGTAGGGAGGGGAGGGG + Intronic
1129738202 15:77977235-77977257 TGATAGGCTTGGGGGTGGGGTGG + Intergenic
1130254037 15:82317558-82317580 TGATAGGCTTGGGGGTGGGGTGG + Intergenic
1130525747 15:84704809-84704831 TCTCAGGCTTGGGAGGGGTTTGG + Intronic
1130806121 15:87324986-87325008 TGTGAGGCAGGTGAGGGGAGGGG + Intergenic
1131786720 15:95921339-95921361 TGTTGGGCATGGGTGGGGAGGGG + Intergenic
1131904667 15:97130052-97130074 TGTTAAGCATGGGAGGGCTGAGG + Intergenic
1202958017 15_KI270727v1_random:95537-95559 TCTTAGCCCCGGGAGGGGAGAGG - Intergenic
1133126025 16:3646495-3646517 TGTAGGGGTTGGGTGGGGAGAGG + Intronic
1133996596 16:10753165-10753187 TGTGAGTCTTGGCGGGGGAGGGG + Intronic
1135192553 16:20366833-20366855 TGGGAGGATTGGGAGGGGACGGG - Intronic
1136294149 16:29292122-29292144 TGTGAGGCTCAGGAGGGCAGGGG + Intergenic
1136556732 16:31011376-31011398 TGTAAGGATGGGGAGAGGAGAGG - Intergenic
1137786337 16:51140521-51140543 TATGAGGCTTGGGAGGGTTGGGG + Exonic
1138658142 16:58502280-58502302 GGATAGGCCTGGGATGGGAGGGG + Intronic
1138903449 16:61302232-61302254 TGTTAGGCTTGTGGTGGGAGTGG - Intergenic
1139972960 16:70787575-70787597 TGTGAGATTTGGGAGGGCAGAGG - Intronic
1142100053 16:88266168-88266190 TGTGAGGCTCAGGAGGGCAGGGG + Intergenic
1143583405 17:7839207-7839229 TATGAGGGTTGGGAAGGGAGTGG + Intergenic
1143622400 17:8087995-8088017 TGGTGGGCGGGGGAGGGGAGGGG + Intergenic
1144337851 17:14287747-14287769 TGTTGAGTTTGGGAGGGAAGAGG - Intergenic
1145007932 17:19347997-19348019 TGGCAGGCTTGAGAGGGGACAGG + Intronic
1146797016 17:35788873-35788895 TGTCTGGCTTGGAATGGGAGTGG + Intronic
1146935955 17:36812899-36812921 TGTGAGGCATGGGGGTGGAGGGG - Intergenic
1147266689 17:39238551-39238573 TGCTAGGCCTGGGAGAGGGGAGG + Intergenic
1147313689 17:39608701-39608723 TGTTAGGGTGGAGTGGGGAGGGG + Intronic
1147994434 17:44353379-44353401 TGTGAGGGCTGGGAAGGGAGGGG - Exonic
1148171618 17:45525836-45525858 TGTTTGGGTGGGGAGGGGAGGGG - Intergenic
1148249692 17:46065571-46065593 TCTGAGGCTTTGGAGAGGAGTGG + Intronic
1148277752 17:46320573-46320595 TGTTTGGGTGGGGAGGGGAGGGG + Intronic
1148299959 17:46538428-46538450 TGTTTGGGTGGGGAGGGGAGGGG + Intronic
1148328901 17:46801217-46801239 TGTTGGGGTTGGGAGAGGAGCGG + Intronic
1148364404 17:47042713-47042735 TGTTTGGGTGGGGAGGGGAGGGG + Intronic
1148466693 17:47869197-47869219 TGTCCAGCTTGGCAGGGGAGGGG - Intergenic
1148654112 17:49270564-49270586 GGTAAGGCATGGGAGGGAAGAGG + Intergenic
1148830326 17:50426562-50426584 TGGTGGACTTGGGTGGGGAGGGG + Intronic
1148860890 17:50603887-50603909 TGTTTGGGTTGGGAGTGGGGAGG - Intronic
1149014469 17:51891867-51891889 TGACAGTCTTGGGAGGGGATTGG - Intronic
1149572247 17:57680744-57680766 TGTTTGGCTTGGGTGGGGGTGGG + Exonic
1150152262 17:62819784-62819806 GGTTAGGCTTGTTAAGGGAGGGG - Intergenic
1150208005 17:63423721-63423743 TTTTAGGTTTGGGGGTGGAGAGG - Exonic
1150402544 17:64870871-64870893 TGTTTGGGTGGGGAGGGGAGGGG - Intronic
1150414285 17:64975087-64975109 GATTAGGCTTGGGAGGCAAGGGG - Intergenic
1150797354 17:68248548-68248570 GATTAGGCTTGGGAGGCAAGAGG + Exonic
1150947758 17:69765806-69765828 CGTAAGGATGGGGAGGGGAGTGG - Intergenic
1151297341 17:73195022-73195044 TGTTAGCTTTGGGAGGGATGAGG - Intronic
1152344584 17:79743252-79743274 GGCTGGGCTGGGGAGGGGAGGGG + Intergenic
1152375798 17:79918395-79918417 TGCATGGCTTGGGAAGGGAGGGG - Intergenic
1152462069 17:80446746-80446768 CCTTAGGCTTGGTGGGGGAGGGG - Intergenic
1153320514 18:3769699-3769721 TGGTGGGGTTGGGAGGGAAGTGG + Intronic
1154977356 18:21472808-21472830 TGTCAGGGATGGGAGGTGAGCGG + Intronic
1156245957 18:35298357-35298379 TGTTTTGCTTGTGAGGGTAGTGG - Intergenic
1156492764 18:37506060-37506082 CGTTGGGGGTGGGAGGGGAGGGG - Intronic
1157721832 18:49931353-49931375 GGTGGGGCTTGGGAGGGCAGAGG - Intronic
1159600803 18:70426986-70427008 TTTGAGGCTTGTGAGGGGAGGGG + Intergenic
1160723828 19:608896-608918 TCCTAGGCTTGGCAGTGGAGGGG + Intronic
1160814039 19:1027153-1027175 TCTTAGCTTTGGGAGGGGAAGGG + Intronic
1161993179 19:7696991-7697013 GGTGAGGCTTGGGAGGGGATGGG - Exonic
1162031869 19:7920946-7920968 AGTAAGGCGTGGGAGGGGCGTGG + Intronic
1162908229 19:13835975-13835997 TGCCAGGCTTGGGAGAGGAGGGG + Intergenic
1163293173 19:16394072-16394094 TGAAAGGCTTGGGAGGTGGGTGG - Intronic
1163556655 19:17997221-17997243 CATTAGGCTGGGGAGGGGACAGG - Intronic
1163634303 19:18431284-18431306 GGTTTGGCTGAGGAGGGGAGGGG - Intronic
1165072146 19:33261683-33261705 TGCTCGGTTGGGGAGGGGAGTGG + Intergenic
1165285296 19:34837285-34837307 TGTTAGGTTTTGAAGGGAAGGGG + Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1166035426 19:40164791-40164813 TGGGAGGCTTTGGTGGGGAGAGG - Intergenic
1166104449 19:40590440-40590462 TGTGGGGCTTGGGACGGGATTGG - Intronic
1166699093 19:44871842-44871864 TCTTGGGCTTGGCTGGGGAGAGG - Exonic
1166813948 19:45530446-45530468 TGTAAAAATTGGGAGGGGAGAGG - Intronic
1166870549 19:45867835-45867857 AGTTGGGGTTGGGAGGGGAGTGG + Intronic
1167787831 19:51650316-51650338 TGCAATGCTTGGGAGGTGAGAGG + Intergenic
1168059775 19:53884329-53884351 TTTTATGGCTGGGAGGGGAGGGG + Intronic
1168513055 19:56988594-56988616 TGGTGGGCATGGGAGGGGAGGGG + Intergenic
925663563 2:6228568-6228590 TTTAAGGCCGGGGAGGGGAGGGG - Intergenic
925694470 2:6561020-6561042 TGTGAGGCTGGGGGTGGGAGTGG + Intergenic
927064608 2:19458841-19458863 TGTTGGGGTTGGGAGTGCAGGGG + Intergenic
927279170 2:21288528-21288550 TGTGTGGAGTGGGAGGGGAGGGG + Intergenic
929158794 2:38811383-38811405 TGTAAGGCCTGGGAAGAGAGGGG + Intronic
929597811 2:43187156-43187178 GCTGAGGCTGGGGAGGGGAGAGG - Intergenic
930910909 2:56628583-56628605 GGGTAGGCTTGGGAGGGCAGTGG + Intergenic
931825633 2:65997802-65997824 TGGTAGGGAGGGGAGGGGAGGGG - Intergenic
931838015 2:66120040-66120062 TGTTATGCACGGGAGGGCAGGGG - Intergenic
932212159 2:69941021-69941043 TTTTGGGGTTGGGAGGGGATGGG + Exonic
933092412 2:78137711-78137733 TTCTAGGCTTGTGATGGGAGGGG - Intergenic
933276924 2:80293890-80293912 TGTCAGGCTTGGGATTGGGGTGG + Intronic
933277272 2:80297228-80297250 TGTTAGGTGTAGGAGTGGAGGGG + Intronic
934817878 2:97345834-97345856 TGCTAGGCCTGTGATGGGAGTGG + Intergenic
934819818 2:97362650-97362672 TGCTAGGCCTGTGATGGGAGTGG - Intergenic
935042520 2:99446876-99446898 AGTTAGGCTTTGGAGGGAATGGG - Intronic
935445811 2:103155413-103155435 GGTTAGGGAAGGGAGGGGAGGGG + Intergenic
935940500 2:108233105-108233127 TGTGAGACTTGGGAGGGGTCAGG + Intergenic
936399506 2:112154773-112154795 TGGTGGGTTTGGGAGGGGAATGG + Intronic
936578892 2:113678495-113678517 TGTTTGGCGGGGGAGGGGTGGGG - Intergenic
937352090 2:121172404-121172426 CTTCAGGCTTGGAAGGGGAGGGG - Intergenic
938160278 2:128979342-128979364 TGTGAGGCGAGGGTGGGGAGTGG + Intergenic
940280540 2:151984531-151984553 TGATAGGCTTGGTTGGGGATAGG - Intronic
940650816 2:156438497-156438519 TGTTGGGATGGGGAGAGGAGAGG + Intronic
942247840 2:174023944-174023966 TGGGAGGCCAGGGAGGGGAGTGG + Intergenic
943330125 2:186549215-186549237 TGTTAGGGGAGGGAGGGTAGTGG - Intergenic
944451786 2:199851047-199851069 TCTGCGGTTTGGGAGGGGAGCGG + Exonic
945289191 2:208111008-208111030 GGTCAGGCTGGGGAGGGGGGAGG - Intergenic
945464033 2:210145937-210145959 TGTCAGGATTGGGAGGGTGGTGG + Intronic
946077122 2:217083533-217083555 TGTTAGGTATGGTAGGGCAGGGG + Intergenic
946324991 2:218980647-218980669 TGTTAGGATGGGGTGGGGTGAGG + Intergenic
946483582 2:220079350-220079372 TGGTAGGCATGGGGAGGGAGGGG + Intergenic
946612330 2:221472709-221472731 TGTTACTCTTGGGAGGGGCAAGG - Intronic
946730156 2:222701681-222701703 GGGTGGGCATGGGAGGGGAGGGG + Intronic
946757015 2:222957580-222957602 TGAGAGGCTGGGAAGGGGAGTGG + Intergenic
948128943 2:235586033-235586055 TGTTGGGCTTGAGTGGGAAGGGG + Intronic
948177966 2:235959139-235959161 CGTTAAGTATGGGAGGGGAGAGG - Intronic
948601955 2:239112394-239112416 TGTGAGACCAGGGAGGGGAGCGG - Intronic
1168772747 20:426332-426354 AGTGAGGCGTGGCAGGGGAGTGG - Intronic
1170285626 20:14705282-14705304 TATTATGCTTGGGAGGGGAAGGG - Intronic
1170603918 20:17861845-17861867 TTTTATGGTTGGGAGGGGAAAGG + Intergenic
1170702804 20:18718845-18718867 AGTTAGGCATGTCAGGGGAGTGG + Intronic
1171387088 20:24777932-24777954 TTTTAGGCTTGGGGAGGGGGTGG - Intergenic
1174063737 20:47850015-47850037 TGGAAGGCTTGGCAGTGGAGAGG + Intergenic
1174424727 20:50423807-50423829 AGTGAGCCCTGGGAGGGGAGGGG + Intergenic
1174818283 20:53705244-53705266 TGGAAGGCTTGGTAGGAGAGGGG - Intergenic
1174910808 20:54605598-54605620 AGTTACCCTGGGGAGGGGAGTGG - Intronic
1175216311 20:57393136-57393158 GGGGAGGCCTGGGAGGGGAGAGG + Intronic
1175417447 20:58811169-58811191 TCTCAGGCTTGGGAGGAGACAGG - Intergenic
1175686330 20:61031213-61031235 TGTAAGGTATGGGAAGGGAGGGG - Intergenic
1176445506 21:6816820-6816842 TTTTAGCCCCGGGAGGGGAGAGG + Intergenic
1176823674 21:13681853-13681875 TTTTAGCCCCGGGAGGGGAGAGG + Intergenic
1177007377 21:15690336-15690358 GGGTACACTTGGGAGGGGAGAGG + Intergenic
1178735651 21:35147532-35147554 CGTTAGGGTTGGGAGAGGAGGGG + Intronic
1178876754 21:36419936-36419958 TGTTTGCTTTGGTAGGGGAGAGG + Intergenic
1178964464 21:37103102-37103124 TGTTAGCCAAGGGTGGGGAGAGG + Intronic
1179191431 21:39125654-39125676 TGTTGGGGATGGGTGGGGAGGGG - Intergenic
1179236007 21:39546918-39546940 TGTTAGGGGTGGGAGTGGTGAGG + Intergenic
1180303522 22:11055441-11055463 TGTGAACCTGGGGAGGGGAGGGG - Intergenic
1180362616 22:11913463-11913485 CCTGAGCCTTGGGAGGGGAGGGG + Intergenic
1180825032 22:18855982-18856004 TGATGTGCTTGGGAGGGAAGGGG + Intronic
1181187698 22:21118566-21118588 TGATGTGCTTGGGAGGGAAGGGG - Intergenic
1181211500 22:21291927-21291949 TGATGTGCTTGGGAGGGAAGGGG + Intergenic
1181398006 22:22634960-22634982 TGATGTGCTTGGGAGGGAAGTGG - Intergenic
1181448533 22:23000056-23000078 CATGAGGTTTGGGAGGGGAGGGG - Intergenic
1181651401 22:24261100-24261122 TGATGTGCTTGGGAGGGAAGAGG + Intergenic
1181705977 22:24649639-24649661 TGATGTGCTTGGGAGGGAAGAGG - Intergenic
1181805738 22:25373566-25373588 TGTTCCACTTGGGAGGGCAGGGG - Intronic
1181902990 22:26170470-26170492 TGTTAGGAATGGGGGGTGAGGGG + Intronic
1182050573 22:27310019-27310041 TGTGAGGCTTAGGGGAGGAGAGG - Intergenic
1182820045 22:33207837-33207859 AGTTTGACTTGGGTGGGGAGCGG + Intronic
1182897907 22:33873918-33873940 TATCAGGGTTGGGAGGTGAGAGG - Intronic
1182923799 22:34104076-34104098 GGCTAGGCTGGGGAGGGGGGTGG - Intergenic
1183315145 22:37132933-37132955 CATTAGGCTTGGGCAGGGAGTGG + Intronic
1183817640 22:40316725-40316747 TGTGAACCTTGGGTGGGGAGGGG - Intronic
1183824277 22:40372452-40372474 TGTGTGGTCTGGGAGGGGAGAGG + Intronic
1183912755 22:41091796-41091818 TGCTAGGCTGGGGGGGAGAGAGG + Exonic
1203215449 22_KI270731v1_random:3504-3526 TGATGTGCTTGGGAGGGAAGGGG - Intergenic
1203275177 22_KI270734v1_random:81887-81909 TGATGTGCTTGGGAGGGAAGGGG + Intergenic
949756039 3:7411970-7411992 TGTTGGGAAGGGGAGGGGAGGGG - Intronic
949838978 3:8300021-8300043 TGTTAGGGCTGGGAGGAGGGGGG - Intergenic
949907167 3:8867396-8867418 TGTTAGGCTTGGGAGGGGAGAGG - Intronic
950378418 3:12590968-12590990 TGTTTTGCTGGGGAGGGGAGGGG + Exonic
950575081 3:13827490-13827512 TCTCAGGCCTGGGAGGGGACTGG + Intronic
950828540 3:15851290-15851312 TGGTAGGCTGGGGAGGGGGAGGG + Intronic
951851278 3:27143576-27143598 TGTTGGGATTGTGAGGGTAGTGG - Intronic
952044764 3:29305134-29305156 TGTTAAGATTGGGCTGGGAGAGG - Intronic
952108646 3:30097204-30097226 TATTAGGCTAGGGGGAGGAGAGG + Intergenic
952243810 3:31562936-31562958 TGTTAGTCTTGGGACCTGAGAGG + Intronic
953528257 3:43713499-43713521 TGTTTGGATTGGGAGAGCAGTGG + Intronic
953645451 3:44749595-44749617 TGTTGGGGTAGGGAAGGGAGGGG - Exonic
953935937 3:47042637-47042659 TTTTTGGTTTGGGAGGAGAGGGG + Exonic
954463275 3:50639792-50639814 GGAAAGGCTGGGGAGGGGAGAGG - Intronic
955548170 3:60054471-60054493 TGCTTGGGTTGGGATGGGAGTGG - Intronic
956452070 3:69385247-69385269 TGACAGGCTGGGGAAGGGAGGGG - Intronic
957026623 3:75189703-75189725 TGTTAGTCTTGGAGGTGGAGTGG - Intergenic
959176247 3:102915237-102915259 TGTTAGGATTGTGAGGACAGAGG - Intergenic
960878408 3:122319577-122319599 TATCAGGCTTTGGAGGGGAAAGG + Intergenic
961212068 3:125133127-125133149 TGTTTGGCTTTGAAGAGGAGAGG + Intronic
961686682 3:128637708-128637730 TGATAGGCTTGGGTGGTGTGGGG - Intronic
962429221 3:135304007-135304029 TGTAAGGCCAGGGAGGGCAGAGG - Intergenic
962920230 3:139943776-139943798 GGTTATGGTTGGGATGGGAGAGG - Intronic
963373577 3:144434462-144434484 TGTTGGGGTTGGGAGTGTAGGGG + Intergenic
963591201 3:147261762-147261784 TGGTAGGCTTGGCAGGCTAGAGG - Intergenic
963780492 3:149481500-149481522 TGCTAGGCTTGGGAAGGGAGTGG - Intronic
964990603 3:162806669-162806691 AGGTAGGATTGGGAGTGGAGGGG + Intergenic
965067879 3:163875375-163875397 TGTGAGGTTTGGGAGGGGCCAGG + Intergenic
965293177 3:166909735-166909757 GCTTGAGCTTGGGAGGGGAGGGG - Intergenic
965461870 3:168975796-168975818 TGTTTGGATAAGGAGGGGAGAGG + Intergenic
967140436 3:186553778-186553800 TGTTAGGTTGGGGATGGGAGTGG - Intronic
967988410 3:195113326-195113348 GGGAAAGCTTGGGAGGGGAGTGG + Intronic
968001239 3:195208305-195208327 TGCTAGGCACAGGAGGGGAGGGG - Intronic
969061108 4:4435902-4435924 GGGTAGGGTTGGGAGCGGAGGGG + Intronic
969262643 4:6043531-6043553 CTTGAGGCTTGGGAGTGGAGGGG - Intronic
971203815 4:24541654-24541676 TTTTAGGCGTGGGAGGGGGAGGG + Intronic
975398113 4:73901461-73901483 TAGTAGGCTTGGCAGGGGACAGG + Intergenic
975597835 4:76066907-76066929 TTTTAAGCTTGTGAGGGCAGGGG + Intronic
978431688 4:108639710-108639732 TGTGAGGCTTGGGTGGGTTGGGG + Intergenic
979703850 4:123697244-123697266 TTTTTGGCTTGGTGGGGGAGGGG - Intergenic
979786323 4:124719160-124719182 TGGTATGCTGGGGAGGGGAGGGG + Intergenic
980962695 4:139492127-139492149 GGTGAGGCTGGGGAGGAGAGGGG - Intergenic
981172101 4:141636764-141636786 TCTTTGCCTTGGGAGGGGAGTGG + Exonic
984125890 4:175809716-175809738 TTTAAAGCTTGAGAGGGGAGTGG + Intronic
984758745 4:183346421-183346443 TGGGAGGCTGGGGTGGGGAGGGG - Intergenic
985126852 4:186703051-186703073 TGTGAGGTCTGGAAGGGGAGAGG - Intronic
986150914 5:5129800-5129822 TGTTTGGCTTTGCTGGGGAGGGG - Intergenic
987297353 5:16565495-16565517 TGTGAGGATTTGGAAGGGAGGGG - Intronic
987374378 5:17219277-17219299 TCCTCGGCTCGGGAGGGGAGTGG - Intronic
991035343 5:62122670-62122692 TGATTGGCTTGGAAGGGGAAAGG + Intergenic
992474010 5:77084740-77084762 TGTGGGGCATGGGAGGGGAAGGG - Intronic
993036919 5:82769098-82769120 TTTTAGGCTTGTGATGGGAGGGG - Intergenic
993530015 5:89012787-89012809 TGTTTGGATGGGGAGTGGAGAGG - Intergenic
994576860 5:101589308-101589330 TGTTGGGGTGGGGAGGGGGGAGG + Intergenic
996345218 5:122480100-122480122 CCTTAGGCTTGGTAGGGTAGAGG + Intergenic
996348056 5:122508920-122508942 TGTTGGTCTTGGGAATGGAGTGG + Intergenic
997192798 5:131954740-131954762 TCTCAGGCATAGGAGGGGAGAGG + Intronic
997526094 5:134554200-134554222 TGTGGGGATTGGAAGGGGAGGGG + Intronic
997849019 5:137314135-137314157 TGTCAGGCTGGGGAGGGGCTGGG - Intronic
998004640 5:138648925-138648947 TGGTAGGGTTGGGAGGCTAGAGG - Intronic
998207172 5:140166154-140166176 TTCCAGGCTGGGGAGGGGAGGGG + Intergenic
998778906 5:145634287-145634309 TGTTTGCTTTGGGAGTGGAGAGG - Intronic
999504049 5:152177159-152177181 TGTTAGGCTCTGGAGAGGATAGG - Intergenic
999550382 5:152680157-152680179 TGTGGTGCTGGGGAGGGGAGGGG - Intergenic
1001052798 5:168426390-168426412 TGTTAGGGAGGGGAGAGGAGGGG - Intronic
1001249262 5:170133758-170133780 TTGGAGGCTTGGCAGGGGAGAGG + Intergenic
1001268591 5:170293489-170293511 TGTTAGCCAAGGGAGGGCAGTGG - Intronic
1001788524 5:174434849-174434871 TGCTATGCTTGGGAGGGAAAAGG - Intergenic
1002042839 5:176527429-176527451 TGTTGGGGTCGGGAAGGGAGGGG + Exonic
1002100828 5:176856768-176856790 CGTGAGGAGTGGGAGGGGAGGGG - Intronic
1002436490 5:179234872-179234894 TGCTAGGCTTGGGAAGAGGGAGG - Intronic
1002876613 6:1216108-1216130 TCTTGGGTTTGGGAGGGAAGAGG - Intergenic
1003870415 6:10398381-10398403 GGTGAGGCGTGGGAGGGGCGGGG + Exonic
1004178851 6:13364248-13364270 TGTTAGGCTGGGGTTGGGGGTGG - Exonic
1004750435 6:18556993-18557015 TGGTAGGCATGGTAGAGGAGTGG - Intergenic
1006020483 6:31114921-31114943 AGTTTGGGTGGGGAGGGGAGGGG + Intronic
1006058175 6:31400873-31400895 TGGGAGGCTTGGTGGGGGAGGGG + Intronic
1006070559 6:31495085-31495107 TGGGAGGCTTGGTGGGGGAGGGG + Intronic
1007377968 6:41469328-41469350 AGTCAGGCTGGGGAGCGGAGGGG - Intergenic
1007418984 6:41707954-41707976 TGCTAGAGTTGGGAGGGAAGTGG + Intronic
1007617884 6:43192816-43192838 AGTTAGGCTGCAGAGGGGAGGGG + Intronic
1007637474 6:43308004-43308026 TGGTGGGCCTGGGAGGGGTGGGG + Intronic
1007740804 6:44008395-44008417 TGTTAGGCAGGGCAGGTGAGTGG + Intergenic
1007789475 6:44300928-44300950 TGTGAGGCCTGGGAGGGGTTAGG + Intronic
1008777646 6:55061262-55061284 TGTTAGGCTTTGCTGGGGATGGG + Intergenic
1011061879 6:83278994-83279016 TGATAGGGTTGGGGGGGAAGGGG - Intronic
1012859513 6:104542838-104542860 TTATAGAATTGGGAGGGGAGAGG - Intergenic
1013650888 6:112193326-112193348 TGTTGGCCTTGGGAGTGGAAAGG + Intronic
1015374374 6:132492919-132492941 TGCTGGGCATGGGAGGAGAGTGG - Intronic
1016706658 6:147116706-147116728 ATTGAGGCTGGGGAGGGGAGGGG - Intergenic
1018747667 6:166774946-166774968 TTTTAGGGTTGGGAGGGCAGAGG + Intronic
1019500562 7:1362449-1362471 TGTGAGGCCTGAGAGGGGACTGG - Intergenic
1019542166 7:1556329-1556351 TGTCAGCCGTGGGAGGGGACAGG - Exonic
1021279942 7:18705406-18705428 TGTGTGGCTCGGGTGGGGAGTGG - Intronic
1021770111 7:23991264-23991286 TGGGAGACTTGGAAGGGGAGAGG + Intergenic
1021876689 7:25056104-25056126 TGTAAGGCAGGGGAGTGGAGTGG - Intergenic
1022003120 7:26244751-26244773 AGGTAGGCTTGGGAGGAGAAAGG - Intergenic
1022672929 7:32473020-32473042 TGTTTGGCCTGGGAAGGGATGGG + Intergenic
1023729170 7:43173879-43173901 TGTTAGTCTGGGGTGGGGTGGGG + Intronic
1023987117 7:45103198-45103220 TGTGTGGCATGGGAGGGCAGGGG - Intronic
1024755826 7:52529749-52529771 TCTTAGGCTGGGGTAGGGAGGGG - Intergenic
1025173032 7:56778572-56778594 AGTTAGGGATGGGAGGTGAGAGG - Intergenic
1025699078 7:63799604-63799626 AGTTAGGGATGGGAGGTGAGGGG + Intergenic
1025830786 7:65047572-65047594 AGTTAGGAATGGGAGGTGAGGGG + Intergenic
1025917949 7:65881484-65881506 AGTTAGGAATGGGAGGTGAGGGG + Intronic
1028576789 7:92361018-92361040 GGTTAGGCTTGGGCAGGGAGTGG - Intronic
1028611233 7:92714251-92714273 TGTTAGGCTGGGAATGGGAAAGG + Intronic
1029346809 7:99984456-99984478 TGTTAGCCATAGGAGAGGAGGGG + Intergenic
1030620907 7:111790308-111790330 TGTGTGGCTTGGGAGTGGATAGG + Intronic
1031680523 7:124667906-124667928 TGTTTGCTTTGGGAGGGGAGAGG - Intergenic
1032097075 7:128944577-128944599 GGAAAGGCTAGGGAGGGGAGTGG - Intronic
1034141348 7:148821074-148821096 GGTTGGGCGGGGGAGGGGAGTGG - Intronic
1034222574 7:149458070-149458092 TGATAGGGTTGGGAGAGGTGGGG + Intronic
1034407287 7:150913533-150913555 TGTGAGGCTTGGAAGTGCAGCGG - Intergenic
1034557287 7:151858231-151858253 TGTAAGGGAGGGGAGGGGAGGGG - Intronic
1035459676 7:159031165-159031187 TGTTAGCCCTGGGAGGGGGTGGG + Intronic
1037436603 8:18870084-18870106 TGATGGGTTGGGGAGGGGAGTGG + Intronic
1038808040 8:30812585-30812607 TGCTGGGCTTGGGCGGGGCGCGG - Exonic
1040545912 8:48397584-48397606 AGTTAGACCTGGGAGGTGAGTGG - Intergenic
1042424585 8:68632614-68632636 TGCCAGGCTTGCGATGGGAGGGG - Intronic
1042621846 8:70715429-70715451 TGCTAGGCTTGGAAGGAGACTGG + Intronic
1042810743 8:72822953-72822975 TGCTGGGGTTGGGTGGGGAGGGG - Intronic
1042816610 8:72884365-72884387 TGTTAGCCGGGGGAGGGGAGTGG + Intronic
1046890242 8:119414859-119414881 TGATAGGCTTTGGAGGGTGGAGG - Intergenic
1047019776 8:120762509-120762531 TGTTTGGGTTCGGAGGGTAGGGG + Intronic
1047498594 8:125426115-125426137 GGTGAGGCTTGGAAGGGAAGTGG + Intergenic
1047536719 8:125726748-125726770 AGTTAGGTTTGGGAGTGGAGGGG + Intergenic
1048010142 8:130448832-130448854 TGCTAGGCTGGGGAGGGGGCTGG + Intergenic
1048302263 8:133260342-133260364 TGTGGGGCTTGGGAGGGGTGAGG - Intronic
1048341248 8:133540205-133540227 TGTTTGGGGTGGGAGGGGAGAGG - Intronic
1048483480 8:134825356-134825378 TGTTAGTACTGGGAGGGAAGGGG - Intergenic
1048719225 8:137303819-137303841 TGGAAGGGTCGGGAGGGGAGAGG + Intergenic
1049285896 8:141775015-141775037 AGTCAGCCTGGGGAGGGGAGGGG + Intergenic
1049475978 8:142797193-142797215 TGTTAGGCTGGGCATGGGAGAGG + Intergenic
1049498360 8:142947314-142947336 TGGCAGGCTGGGGAGGGGTGAGG - Intergenic
1049674241 8:143882747-143882769 TGTCAGGCTCTGGAGGGGACTGG - Intergenic
1053105689 9:35406054-35406076 TGGCTGGCTTGGGAGAGGAGCGG - Intergenic
1053232439 9:36421898-36421920 TGTTATTCTGGGGAGGAGAGTGG - Intronic
1055671117 9:78606909-78606931 TGTTATGTGTGTGAGGGGAGAGG + Intergenic
1056422692 9:86445067-86445089 TATTTGGTTGGGGAGGGGAGCGG - Intergenic
1056731810 9:89172358-89172380 TGTTTTGGTTGGGAGGGGAGAGG + Intronic
1056835258 9:89949851-89949873 TGTTTGTTTGGGGAGGGGAGGGG - Intergenic
1057047141 9:91894678-91894700 TGTTATTCTTGAGAGTGGAGGGG + Intronic
1057789981 9:98118447-98118469 TGTGTGGCCGGGGAGGGGAGAGG + Intronic
1057999109 9:99847422-99847444 TGTTTGACCTGGGAGGTGAGAGG - Exonic
1058001074 9:99865872-99865894 TGTTAGACTTGGAAGGGGCCTGG + Exonic
1059552166 9:115240013-115240035 TGTTAGGCTTAGGAAAGGATGGG + Intronic
1060902422 9:127271742-127271764 AGCTGGGCTGGGGAGGGGAGAGG - Intronic
1061699989 9:132408769-132408791 TTATAGGCCTGGGCGGGGAGGGG - Intergenic
1061914410 9:133741885-133741907 TGTTAGGCCATGGAGTGGAGAGG - Intergenic
1062031047 9:134362134-134362156 TGTGCGGGTTGGGAGGGGATGGG + Intronic
1062278305 9:135740903-135740925 GGTGAGGGGTGGGAGGGGAGGGG - Intronic
1062445958 9:136594854-136594876 TGCCAGGCTGGGGAGGGGACGGG + Intergenic
1203523689 Un_GL000213v1:67705-67727 TTTTAGCCCCGGGAGGGGAGAGG - Intergenic
1188352770 X:29152244-29152266 TGTTATGCATGGGAGGGGCCTGG - Intronic
1189902694 X:45723469-45723491 GGTTAGGGGTTGGAGGGGAGAGG - Intergenic
1190917501 X:54821421-54821443 TGTTGGGCCTTGGAAGGGAGTGG + Intergenic
1191861833 X:65671812-65671834 TGTTAGGCTTGGAGAGGGAAAGG + Intronic
1191907293 X:66107354-66107376 TGTGATCCTTTGGAGGGGAGGGG + Intergenic
1192362038 X:70446305-70446327 TGACAGGCAAGGGAGGGGAGAGG + Intronic
1192417109 X:70991343-70991365 TCAGAGGCTTGGGAGGGTAGTGG - Intergenic
1193543150 X:82795632-82795654 TGTGAGATTTGGGAGGGGACAGG + Intergenic
1194337533 X:92666198-92666220 TGATAGGGGTGGCAGGGGAGTGG - Intergenic
1197032434 X:121833587-121833609 AGTGAGGGTTGGGAGGGAAGTGG + Intergenic
1199063572 X:143388503-143388525 TTCTAGGCTTGTGATGGGAGGGG - Intergenic
1199707998 X:150447679-150447701 TGTAAGGCCTGGAAGGTGAGTGG + Intronic
1200122547 X:153798001-153798023 TGTGGGGGTGGGGAGGGGAGGGG - Intronic
1200338352 X:155375812-155375834 TGGTTGGCAGGGGAGGGGAGTGG - Intergenic
1200348117 X:155464880-155464902 TGGTTGGCAGGGGAGGGGAGTGG + Intergenic
1200645952 Y:5782940-5782962 TGATAGGGGTGGCAGGGGAGTGG - Intergenic
1200822202 Y:7598083-7598105 AGAAAGGCTTGGGAGGGGTGTGG - Intergenic
1201291444 Y:12424098-12424120 TGTTAGGATTAGGTGGGGTGTGG - Intergenic
1202238099 Y:22735934-22735956 AGAAAGGCTTGGGAGGGGTGTGG + Intergenic