ID: 949908775

View in Genome Browser
Species Human (GRCh38)
Location 3:8882550-8882572
Sequence GCTGATGGTGGGAAACAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949908775_949908785 18 Left 949908775 3:8882550-8882572 CCCGGCTGTTTCCCACCATCAGC 0: 1
1: 0
2: 2
3: 20
4: 267
Right 949908785 3:8882591-8882613 CAGGAGCAGGAAATGGCTGAGGG 0: 1
1: 0
2: 3
3: 36
4: 395
949908775_949908782 5 Left 949908775 3:8882550-8882572 CCCGGCTGTTTCCCACCATCAGC 0: 1
1: 0
2: 2
3: 20
4: 267
Right 949908782 3:8882578-8882600 AACAAGCAATAAGCAGGAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 255
949908775_949908781 -1 Left 949908775 3:8882550-8882572 CCCGGCTGTTTCCCACCATCAGC 0: 1
1: 0
2: 2
3: 20
4: 267
Right 949908781 3:8882572-8882594 CCTAGCAACAAGCAATAAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 110
949908775_949908784 17 Left 949908775 3:8882550-8882572 CCCGGCTGTTTCCCACCATCAGC 0: 1
1: 0
2: 2
3: 20
4: 267
Right 949908784 3:8882590-8882612 GCAGGAGCAGGAAATGGCTGAGG 0: 1
1: 0
2: 4
3: 60
4: 605
949908775_949908783 11 Left 949908775 3:8882550-8882572 CCCGGCTGTTTCCCACCATCAGC 0: 1
1: 0
2: 2
3: 20
4: 267
Right 949908783 3:8882584-8882606 CAATAAGCAGGAGCAGGAAATGG 0: 1
1: 0
2: 3
3: 45
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949908775 Original CRISPR GCTGATGGTGGGAAACAGCC GGG (reversed) Intronic
900092856 1:927954-927976 GCTGAGGCTGGTATACAGCCTGG + Intronic
900156353 1:1204768-1204790 GCTGAGGGTGGGCAGAAGCCAGG + Intronic
900393962 1:2445547-2445569 GCTGTGGGTGGGGAACAGCTGGG + Intronic
900843833 1:5080130-5080152 TGTGAGTGTGGGAAACAGCCTGG - Intergenic
901262868 1:7886199-7886221 GCTGATAGCAGGAGACAGCCGGG - Intergenic
901436504 1:9250190-9250212 GGTGAGGGCGGGAAACAGGCAGG + Intronic
901791596 1:11656094-11656116 GCTGAAGGTGGGGTACAGGCCGG + Exonic
902089687 1:13893246-13893268 GCTGGTGCTGGAACACAGCCGGG + Intergenic
902263509 1:15245053-15245075 GCTGATTGTTAGAAAGAGCCTGG - Intergenic
902657601 1:17880134-17880156 GCTTATGGTGGGGAATAGGCAGG - Intergenic
903279701 1:22243633-22243655 GCTGATGGTCGGGGACACCCTGG - Intergenic
903694497 1:25197091-25197113 GCTGGTGGTGGGGACGAGCCAGG + Intergenic
904004024 1:27353970-27353992 GGTGATTGTAGGAAAGAGCCAGG + Intergenic
904292876 1:29498957-29498979 GCTCATGTCGGGAAACAGCAAGG + Intergenic
904333999 1:29785272-29785294 GCTCATGTCGGGAAACAGCAAGG + Intergenic
904412388 1:30332304-30332326 GCTCATGTTGAGAAACAGCAAGG - Intergenic
904555257 1:31358160-31358182 GCTGATGTTGGGAAAGAGTGTGG + Intronic
906190717 1:43898034-43898056 GGTGATGGCAGGAAACAGACAGG - Intronic
907443829 1:54494915-54494937 GCTGAAGGTGGGGGGCAGCCAGG + Intergenic
909686344 1:78353606-78353628 GCTGATTGTTGAAAAGAGCCTGG - Intronic
910449608 1:87331884-87331906 GCTGCTGGAAGGAAACAGCAGGG - Intronic
910711773 1:90189403-90189425 GTTGATGTTGACAAACAGCCAGG + Intergenic
912093743 1:106114123-106114145 GTTGATGGTGGGAGGCAGACAGG + Intergenic
913494045 1:119411040-119411062 GCTGTTGGCGTGAAACAGTCTGG - Intergenic
913499775 1:119461570-119461592 GCTGTTGGTGTGAAACAGTCTGG - Intergenic
915165329 1:153945196-153945218 GCAGAAGCTGGGAAAAAGCCTGG + Intronic
915249326 1:154577247-154577269 GCAGATGGTGGGTTACAGACGGG + Exonic
915701695 1:157802593-157802615 GGTGATGGAGGGAGACAGGCTGG - Exonic
918182189 1:182093966-182093988 GATGATGGTTGGAACCAGGCTGG + Intergenic
918240318 1:182615057-182615079 GCTGATGGTGCCACAGAGCCCGG - Intergenic
919263984 1:195237746-195237768 GTTGATGGTGGGAGGCAGACAGG + Intergenic
919265076 1:195252331-195252353 GCTGATGGGGGGATGCAGCAGGG - Intergenic
919350900 1:196452761-196452783 GCTGATGGTGTGAGAGACCCAGG + Intronic
921648381 1:217647207-217647229 GGTGATGATGGGAAAAAGACAGG - Intronic
922605395 1:226887015-226887037 GCAGATGGTGGGAAGCAGGGTGG + Intronic
922862267 1:228829689-228829711 GCTGGTTGTTGGAAATAGCCTGG - Intergenic
923237089 1:232044939-232044961 GCGGATGATGTGAAACAGGCAGG - Intergenic
1062817433 10:510877-510899 GCTGGTGGTGTGGGACAGCCAGG + Intronic
1064974580 10:21100244-21100266 GCTGATGGTGGGGAATGGTCGGG - Intronic
1065382101 10:25101151-25101173 GCTAATGGGGAGAAACACCCAGG + Intergenic
1066610999 10:37248474-37248496 GCTGATGGGGGGAAGCAGGAAGG - Intronic
1067220877 10:44343441-44343463 GCTGATGGGGGGAGGAAGCCTGG + Intergenic
1068753038 10:60618606-60618628 GGAGATGGTGGTAAACAGCAAGG + Intronic
1070935227 10:80288891-80288913 GCTGGTGGTGGGCCACAGCACGG + Intronic
1071329005 10:84542311-84542333 GGTGATGCTGGGTAGCAGCCTGG - Intergenic
1074693169 10:116025382-116025404 GCAGGTGGTGGGAACCAGCCAGG + Intergenic
1076189016 10:128469885-128469907 GCTGATTGTGGAAAAGAACCTGG + Intergenic
1076981562 11:207506-207528 GCCGAGGGTGGGGAACTGCCGGG + Intronic
1077032619 11:476373-476395 GGTGATGGTGAGAAACTTCCCGG + Intronic
1077347652 11:2071406-2071428 CCAGATGGTGGGATACACCCAGG - Intergenic
1078559064 11:12354984-12355006 GCTGCTGGTGGGAGGCAGGCTGG - Intronic
1083396601 11:62396745-62396767 GCTGATAGGGGAAACCAGCCTGG + Intergenic
1084620817 11:70269400-70269422 GCTGTTGGTGTGAGGCAGCCAGG - Intergenic
1085681183 11:78576622-78576644 GCTGATTGTTGAAAAGAGCCTGG + Intergenic
1085793551 11:79516754-79516776 GCTGATGGGTGGAAACAGATGGG + Intergenic
1087044355 11:93831687-93831709 CCTGATGAAGGGGAACAGCCTGG - Intronic
1088906407 11:114158470-114158492 GCTGGAGGTGGGGAACAGCTGGG - Intronic
1089539168 11:119179713-119179735 GCGCATGGTGGGTAAAAGCCGGG + Exonic
1090236030 11:125147768-125147790 TCTGATGGTGGTGAACACCCAGG + Intergenic
1090697971 11:129267893-129267915 GCTGGTTGTGGAAAAGAGCCTGG - Intronic
1091287814 11:134418000-134418022 GCTGATTGTGGGAAGCTGGCGGG + Intergenic
1091807832 12:3368197-3368219 GGTGATGGTGGGAGACAGGCAGG + Intergenic
1097981667 12:65742308-65742330 CCTGATCGTGGGAACCAGGCGGG + Intergenic
1102954994 12:117053367-117053389 GCTGTTCATGGAAAACAGCCTGG + Intronic
1104647661 12:130508746-130508768 GCTGATGATGGGAAATTGCAAGG - Intronic
1106575994 13:30976257-30976279 GCTGCTGGTGGGAAACCTACAGG - Intergenic
1112668787 13:101611065-101611087 GAAAATGGTGGGAGACAGCCTGG + Intronic
1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG + Intergenic
1116261632 14:42635807-42635829 GATGATTGTGGAAAACAACCTGG - Intergenic
1116261645 14:42635900-42635922 GATGATTGTGGAAAACAACCTGG - Intergenic
1117116898 14:52523193-52523215 GTTGATGGGGTAAAACAGCCTGG + Intronic
1117286361 14:54289533-54289555 GCTGAAAGAGGGAAAGAGCCAGG + Intergenic
1118392457 14:65306801-65306823 GCTGATGGTTAGAAAGAGCCTGG + Intergenic
1119872425 14:78028964-78028986 TCTGATGGTGGGAAACTGGAGGG + Intergenic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1125828693 15:42695889-42695911 GCAGATGTTGGGAATGAGCCAGG + Intronic
1128673281 15:69590595-69590617 GCTGACGGTGGGAAAAGTCCTGG + Intergenic
1129713458 15:77833341-77833363 GCTGAGAGTGGGAAACAGAGAGG + Intergenic
1130825972 15:87546686-87546708 TCTGACGGTGGCAAACAGCATGG + Intergenic
1131010932 15:89017828-89017850 GCTGAGCGTGGGAATCACCCGGG + Intergenic
1131139375 15:89964598-89964620 TCTGATGGTGGGACAGGGCCTGG + Intergenic
1131793732 15:95991874-95991896 GCTGATGGTGCAAAATATCCTGG + Intergenic
1131866454 15:96716315-96716337 GCAGATGGTGGGACAATGCCGGG - Intergenic
1132651686 16:1024074-1024096 GCTGCTGGTGGGGGCCAGCCCGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1134331192 16:13252479-13252501 GCTGAGGGTGAGAAACCCCCAGG + Intergenic
1137570499 16:49563257-49563279 GCTGATTGTTAAAAACAGCCTGG + Intronic
1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG + Intergenic
1138205238 16:55119816-55119838 GCAGATGGTGGGATAGATCCTGG - Intergenic
1138473826 16:57259024-57259046 CCTGTTGGTGGGAAAGACCCAGG - Intronic
1140950898 16:79816389-79816411 GCTGAAGGTGGGACACAGCCTGG - Intergenic
1141913166 16:87074890-87074912 CCTGATGGTGGGAGGCAGTCAGG - Intergenic
1143171452 17:4932895-4932917 GCTGATTGTGGGATAGATCCAGG - Exonic
1143699959 17:8651148-8651170 TCTGAGGGTAGGAAACAGCAGGG - Intergenic
1145289648 17:21533166-21533188 ACTGAAACTGGGAAACAGCCAGG + Exonic
1146226577 17:31071808-31071830 TCTCATGGTGGTAAAAAGCCAGG + Intergenic
1146416334 17:32636698-32636720 GGAGATGGTGTGAGACAGCCTGG + Intronic
1147497666 17:40933203-40933225 GTTCATGGTGGGACATAGCCAGG + Intronic
1148344885 17:46896701-46896723 GCAGATGGAGGGAAATAGGCAGG - Intergenic
1148515557 17:48213670-48213692 GCTGGGGGTGGGAAACACCAAGG - Intronic
1151734591 17:75931201-75931223 GGAGGTGGAGGGAAACAGCCAGG + Intronic
1152665407 17:81565851-81565873 GCTGACGGTGCTCAACAGCCCGG + Intronic
1153656393 18:7286580-7286602 GCTGATGGTGTGATTCAGTCAGG + Intergenic
1156210125 18:34930471-34930493 GCTGAGGTTGGGAAACAAGCTGG - Intergenic
1156887472 18:42152085-42152107 GCAGTTGGAGGGAAACGGCCAGG + Intergenic
1157589255 18:48826455-48826477 CCTGAAGGTGGGCAAGAGCCAGG - Intronic
1157589790 18:48829484-48829506 CCTTAAGGTGGGAAACAGGCAGG - Intronic
1157835319 18:50896733-50896755 CCTGATAGTGGGAAACAAACGGG - Intronic
1158672864 18:59492471-59492493 ACTGATGGTGGGCAACTTCCAGG + Intronic
1160586943 18:79918258-79918280 GTTATTTGTGGGAAACAGCCTGG - Intronic
1161138860 19:2636434-2636456 CCTGATGGTGGGGACAAGCCAGG + Intronic
1161378933 19:3954326-3954348 GCTGAGGGCTGGAAACTGCCAGG + Intergenic
1161621733 19:5301266-5301288 GCTCAAGGTGGGAGACGGCCTGG - Intronic
1161725782 19:5927770-5927792 GCTGCTGGTGGGGAAGTGCCAGG + Intronic
1162826761 19:13257361-13257383 GATGATGGAGGAATACAGCCTGG - Exonic
1163222370 19:15930804-15930826 GCCGCTGGTGGGGACCAGCCAGG - Intronic
1163747482 19:19056939-19056961 GCTGGTGGTGGGAGCCACCCTGG + Intronic
1164770145 19:30802061-30802083 CATGATGCTGGGAAACAGCAAGG - Intergenic
1165286265 19:34844845-34844867 GCTGATTGTTAAAAACAGCCTGG + Intergenic
1165725269 19:38108304-38108326 AGTGATGGAGGGAAAGAGCCTGG - Intronic
1166441527 19:42819481-42819503 GCTGATTGTTAGAAAGAGCCTGG + Intronic
1166449658 19:42887470-42887492 GCTGATTGTTAGAAAGAGCCTGG + Intronic
1166460959 19:42987767-42987789 GCTGATTGTTAGAAAGAGCCTGG + Intronic
1166478247 19:43147755-43147777 GCTGATTGTTAGAAAGAGCCTGG + Intronic
1167494055 19:49807720-49807742 GCGGGTGGAGGGAAACAGGCAGG + Intronic
925526433 2:4808158-4808180 GTTCATTGCGGGAAACAGCCAGG - Intergenic
925944285 2:8846404-8846426 GCTGATGGAGGGAAACAGGAAGG + Intergenic
926092763 2:10061326-10061348 GAGGATGGTGGGAAACAGGAAGG - Intronic
926631243 2:15138157-15138179 GCAGAGGATGGGAAACAGTCGGG + Intergenic
926951507 2:18248526-18248548 GCTGATGGTTTAAAAGAGCCGGG - Intronic
929362220 2:41105716-41105738 GCTCATGATTGGAAACAGGCAGG + Intergenic
930572273 2:53102145-53102167 GCAGAGGGTGGGAAAGAGGCAGG + Intergenic
931223676 2:60310686-60310708 GCGGCTGGTGGGAAATTGCCAGG - Intergenic
934489235 2:94747855-94747877 TCTGATTGTTAGAAACAGCCTGG - Intergenic
935084194 2:99828428-99828450 GCTGCTGGAGAGAAGCAGCCTGG + Intronic
937122677 2:119451764-119451786 GCTGCTTGTGGGAAAGAACCAGG + Intronic
941893294 2:170604857-170604879 GCTGATGGTAGAAAACAATCTGG + Intronic
946526324 2:220524634-220524656 GCTGATTGTTTGAAAGAGCCTGG - Intergenic
947425658 2:229980852-229980874 GCTGCTGGCGGGAAACCACCTGG - Intronic
948032111 2:234827407-234827429 GATGATGGTGGGATGCAGCGTGG - Intergenic
948110237 2:235449013-235449035 GTTGAAGGTGAGAGACAGCCAGG + Intergenic
948212433 2:236204616-236204638 GTTGAGTGTGGGATACAGCCAGG - Intronic
948567443 2:238895960-238895982 GCTGAGGGAGAGAGACAGCCTGG + Intronic
948678163 2:239611276-239611298 CCTGATGGTGGGGAACAGTGCGG + Intergenic
1168956835 20:1840467-1840489 GCTGCTGGCAGGAAACTGCCTGG + Intergenic
1169499727 20:6147853-6147875 GGCGATGGTGTGAAACAGCCTGG + Intergenic
1170643281 20:18175154-18175176 GCTGATTGTGGGAAAAAGAGAGG - Intronic
1171285981 20:23938346-23938368 GTTGATGGTGGGAGGCAGACAGG + Intergenic
1172092485 20:32443839-32443861 GCTGCTGGTGGGTAACTGCATGG - Exonic
1174190744 20:48738698-48738720 GCTGCTGGCTGGAAACAGCCAGG + Intronic
1174343159 20:49910575-49910597 GCTGAGTGTGGGAGACAGCAAGG + Intronic
1175448389 20:59042426-59042448 CCTCATGGTGGGGGACAGCCCGG + Intronic
1175615516 20:60394767-60394789 GTTGAAGGTGTGAAGCAGCCTGG + Intergenic
1179090368 21:38259728-38259750 GCTGATGGTGGGATAAGGCCGGG + Intronic
1179924989 21:44529398-44529420 GATGATGGTGGGACAGAGGCGGG + Intronic
1180051445 21:45333334-45333356 GCTGTTGGTGGGAATGTGCCCGG - Intergenic
1181603045 22:23963683-23963705 GATGATGGTGGGAACCAGGATGG + Intergenic
1181605469 22:23977624-23977646 GATGATGGTGGGAACCAGGATGG - Intronic
1181674737 22:24444322-24444344 GCTGACGGTGGGAACCAACATGG - Intergenic
1181949021 22:26541072-26541094 GCTGATGGTGCGGGACGGCCGGG - Exonic
1182375674 22:29845887-29845909 GCTGATGGTGGGGAAGGTCCTGG + Intergenic
1182426542 22:30276266-30276288 GAAGATGGTGGGAAGCGGCCAGG + Intergenic
1182919889 22:34069521-34069543 GAATATGGTGAGAAACAGCCAGG - Intergenic
1183172662 22:36199261-36199283 GCTGTGGGTAGGAACCAGCCAGG + Intronic
1183412859 22:37665679-37665701 GCTTATGGTGGGTGACCGCCTGG + Exonic
1184250796 22:43259048-43259070 GCTGATGTTGTGAAACATCCTGG - Intronic
1184527767 22:45035642-45035664 GCTGATGGTGGGACCGGGCCTGG + Intergenic
1184635135 22:45821996-45822018 GCTGATGATGGGGAAGAGCAGGG - Intronic
949226312 3:1699810-1699832 GCTGATGGTGGGAGGCAGACAGG + Intergenic
949908775 3:8882550-8882572 GCTGATGGTGGGAAACAGCCGGG - Intronic
950113209 3:10433705-10433727 GCTGAAGGTGGGTAACAGTGGGG - Intronic
953516853 3:43601949-43601971 GCTGATGGCTGGAAGCAGCTGGG - Intronic
953568104 3:44050595-44050617 AATGAAGGTGGGAATCAGCCAGG - Intergenic
954684843 3:52364918-52364940 CTTGATGGTGGGAAACAGGTCGG - Exonic
959610840 3:108293105-108293127 GATCATTCTGGGAAACAGCCAGG - Intergenic
960992317 3:123319915-123319937 GCTGATGGTGGACAGCTGCCAGG - Intronic
961326713 3:126113332-126113354 GCAGAGGGTGGGACACAGGCAGG + Intronic
961545702 3:127631313-127631335 GCTGATGGTGGAAATCAGAAAGG + Intronic
962007122 3:131360764-131360786 GCATATGGTGGGAAAGAGTCCGG - Intergenic
962009486 3:131380480-131380502 GCATATGGTGGGAAAGAGTCCGG - Intergenic
962319040 3:134375813-134375835 GCTGATGGGAGGACCCAGCCAGG - Intergenic
962436902 3:135375222-135375244 CCTGAAGGTGGGAAATAGCTTGG - Intergenic
962653508 3:137519189-137519211 GATGAGGGTGGGAAATAGCATGG + Intergenic
963580394 3:147119390-147119412 GATGATGGCGGGAAACAGAATGG - Intergenic
964324964 3:155535442-155535464 GCTGGTGGTGGGAATGAGACTGG + Intronic
966805026 3:183800331-183800353 GCTGTTGTGGGGACACAGCCAGG - Intronic
967551858 3:190805097-190805119 GCTTATGGTGGGAAGAAGGCAGG + Intergenic
968046794 3:195628626-195628648 GCAGATGCTGCGGAACAGCCTGG - Intergenic
968307859 3:197661418-197661440 GCAGATGCTGTGGAACAGCCTGG + Intergenic
968975831 4:3821653-3821675 GCTGATGGAGCGACACAGACTGG + Intergenic
969301284 4:6298912-6298934 GCTGATGGGGGGCTCCAGCCTGG + Intronic
970546049 4:17131544-17131566 GATGATGGTGGGATAGAGCAGGG - Intergenic
971867355 4:32189974-32189996 GTTGATGGTGGGAGGCAGACAGG + Intergenic
972827791 4:42781104-42781126 GCTGATGGTGTGAAACAGCATGG + Intergenic
972978146 4:44662780-44662802 ACTGATTGTGAAAAACAGCCTGG + Intronic
974075658 4:57166049-57166071 GATGAGGGTGGGAAGGAGCCAGG + Intergenic
974644271 4:64671934-64671956 GCTGAAGGTGGGAAGAGGCCAGG + Intergenic
975992045 4:80267298-80267320 GCTGATACTCAGAAACAGCCGGG + Intronic
976142387 4:82005914-82005936 TCAGATGGTGGAAAATAGCCTGG + Intronic
976481880 4:85555865-85555887 GCTCATGGGGGGAAACTGACTGG + Intronic
978587863 4:110292828-110292850 GCTGATGGTGGGATACTTCAAGG - Intergenic
981099757 4:140817037-140817059 CCTGCTGGTGATAAACAGCCTGG + Intergenic
983904335 4:173168871-173168893 GCTGGTGGTGGGAAGCTTCCTGG + Exonic
983975658 4:173930798-173930820 GCTGATGGAGGAAAAGAGCATGG + Intergenic
985022093 4:185702359-185702381 GCTGATTGTTGAAAAGAGCCTGG - Intronic
985043309 4:185914918-185914940 CCTGCTGGTGGGAGAAAGCCTGG + Intronic
985384929 4:189435168-189435190 GCTGGTTGTTGGAAAGAGCCTGG - Intergenic
985744814 5:1640518-1640540 GCAGATGCTGCGGAACAGCCTGG + Intergenic
988202237 5:28083249-28083271 GATGGGGGTGGGAAACAGACAGG + Intergenic
989105786 5:37861902-37861924 GCTGTTTGTGGGATACAGCTTGG - Intergenic
990068375 5:51747407-51747429 GCTGGTTGTGGGAAAGAGCCTGG - Intergenic
990844966 5:60127179-60127201 GCTGAGGGAGTGAAACAGGCAGG + Intronic
991669712 5:69035867-69035889 GCAGAGAGTGGGTAACAGCCTGG - Intergenic
992910140 5:81388632-81388654 GCTGGCAATGGGAAACAGCCAGG + Intronic
993983963 5:94574640-94574662 GCTGAGGTTGTGAAACAGCAGGG - Intronic
997263178 5:132479084-132479106 GGTGGGGCTGGGAAACAGCCAGG - Intergenic
997579641 5:135009171-135009193 GCTGATGGTGGTCAACAGGACGG + Intronic
1001890934 5:175337913-175337935 GCTAATGGTTGAAAAGAGCCTGG + Intergenic
1002212179 5:177605607-177605629 GGGGATGGTGGGAGTCAGCCCGG - Intronic
1006912025 6:37569788-37569810 GCTGATGGAGGGGCAGAGCCAGG + Intergenic
1007566959 6:42858901-42858923 GGTGGTGGTGGGAAAGAGCATGG - Intronic
1007784102 6:44270551-44270573 GCTGAGGGTGGGAGGCAGGCTGG - Exonic
1007932983 6:45708970-45708992 GCTGAAGGTGGGGGGCAGCCTGG + Intergenic
1008136683 6:47785420-47785442 GCTGATGGTATGAAACCACCAGG - Intronic
1008182789 6:48353886-48353908 GCTGATTGTTAAAAACAGCCTGG - Intergenic
1008240727 6:49107821-49107843 ATTGATTATGGGAAACAGCCAGG - Intergenic
1008386524 6:50897521-50897543 TCTGATTGTGGGACACAGTCTGG + Intergenic
1008744276 6:54649930-54649952 GCTGAGGGTGAGAAAGAGCGAGG - Intergenic
1009530232 6:64803576-64803598 GATGATGGTGGGAGGCAGACAGG - Intronic
1010846858 6:80720153-80720175 GTTGATGGTGGGAGGCAGACAGG + Intergenic
1013090769 6:106898618-106898640 GCTGATGTTGAGAAAAATCCAGG - Intergenic
1014307349 6:119758637-119758659 GCTGAGGGTGGGGCACAGCCTGG + Intergenic
1015211950 6:130708646-130708668 GCTGATTGTGAGTAACAGCCTGG - Intergenic
1015990004 6:138930080-138930102 GCAGATGTTGGGGATCAGCCAGG - Exonic
1016460131 6:144273338-144273360 AAAGATGGGGGGAAACAGCCAGG + Intergenic
1017449621 6:154542273-154542295 GCTGCTTTTGGGAAACAGCCTGG - Intergenic
1018683039 6:166280708-166280730 TCTGGTGGAGGGAGACAGCCAGG - Intergenic
1019022074 6:168927716-168927738 GCTGATGGTGGTAAGCACCTAGG - Intergenic
1019210043 6:170397615-170397637 GCTGATGATGGCACACAGCTTGG + Intronic
1020778957 7:12494242-12494264 GCTGATGGTGGGATCCACACTGG + Intergenic
1021521189 7:21540696-21540718 GCTAATGCAGGGAACCAGCCTGG - Intergenic
1022520061 7:31000462-31000484 GGTGAGGCTGGGAAAGAGCCAGG - Intergenic
1022792447 7:33702510-33702532 CCTGATATTTGGAAACAGCCAGG - Intergenic
1023984398 7:45086490-45086512 GCTGGTGGTGGGAATCTGCCAGG + Intronic
1024278360 7:47697557-47697579 GCTGATGGTTTAAAAGAGCCTGG - Intronic
1024324647 7:48099558-48099580 GCTCATGGTGGGAGAAAGACAGG - Intronic
1025108703 7:56194521-56194543 GCTGAAGGTAGAAAACAGCAGGG - Intergenic
1026291881 7:69014501-69014523 GCTGATTGTTGAAAAGAGCCTGG + Intergenic
1028343270 7:89748379-89748401 GCTGTTGGGGGTAAACAGCATGG + Intergenic
1028450816 7:90981032-90981054 GCTTATGGTGGGAAAAAGGAAGG + Intronic
1028910441 7:96201889-96201911 ACTGATGGTGAGAAAAAGCCAGG + Intronic
1028924221 7:96340055-96340077 CCTGATGGTGGGAAATAGATTGG - Intergenic
1030206886 7:106959887-106959909 GCTGTGGGTGGGACACTGCCAGG - Intergenic
1032098781 7:128955323-128955345 TCTGATTGTGGGACACAGTCTGG + Exonic
1032696981 7:134345602-134345624 GCTGGTGGTGGGTAAAAGCCCGG + Intergenic
1034982470 7:155487837-155487859 GCTGATGGCTGGACTCAGCCGGG - Intronic
1035744632 8:1952751-1952773 GCTGATGGTCGGCACCAGCCTGG + Exonic
1037893370 8:22635986-22636008 GCAGGTGCTGGGAAACAGCCAGG - Intronic
1040586125 8:48743519-48743541 CCTGAAGGTGGGAACAAGCCAGG - Intergenic
1042874111 8:73425015-73425037 GCTCATGCTGGACAACAGCCAGG + Intronic
1043358469 8:79441450-79441472 GCTGCTGATGGGAAACAGATCGG + Intergenic
1043652544 8:82614446-82614468 GCTGATTGTTAGAAAGAGCCTGG + Intergenic
1044193854 8:89351938-89351960 GCTGGTGGTTGAAAAAAGCCTGG - Intergenic
1046787479 8:118283732-118283754 GCAGATGGAGGGAAACAGAATGG + Intronic
1047510511 8:125512076-125512098 GCTGATATTGGGACAGAGCCTGG + Intergenic
1048798184 8:138171019-138171041 GCTGATGGTGGCCAAAGGCCTGG - Intronic
1049828259 8:144684573-144684595 GCTGCTGGTGGGAAGCGGCTCGG + Intergenic
1050338434 9:4612280-4612302 CCTGGTGGTAGGAAACAACCAGG - Intronic
1051863517 9:21652516-21652538 GCTAATGGTGGTAGACAGCCTGG + Intergenic
1051971140 9:22889184-22889206 GGTGATGAAGAGAAACAGCCAGG - Intergenic
1053162649 9:35824403-35824425 GCTGAGGCTTGGAAACAGCAGGG + Intronic
1053668545 9:40336477-40336499 TCTGATTGTTAGAAACAGCCTGG + Intergenic
1054379685 9:64476530-64476552 TCTGATTGTTAGAAACAGCCTGG + Intergenic
1054516066 9:66039817-66039839 TCTGATTGTTAGAAACAGCCTGG - Intergenic
1058270670 9:102968056-102968078 GATGGTGGTGGGAGACAGACAGG - Intergenic
1058759877 9:108120230-108120252 GTTCATGGAGGGAAACAGTCAGG + Intergenic
1060029668 9:120203425-120203447 GCAGTTGCTGGGTAACAGCCTGG - Intergenic
1061483266 9:130907497-130907519 GCTGATGGCTTGAAACAGACAGG + Intronic
1061897239 9:133654894-133654916 GCTGATGGTGGGGACTTGCCTGG - Intronic
1062029758 9:134356913-134356935 GCTGAGGCTGGGAGACAGGCAGG - Intronic
1062275688 9:135729406-135729428 GCAGATGGCGGGAATGAGCCTGG + Intronic
1062279526 9:135745743-135745765 GCAGGTGGAGGGGAACAGCCGGG + Intronic
1062287452 9:135779355-135779377 GCTGAGGCTGGGGAAGAGCCTGG - Exonic
1186188329 X:7043333-7043355 GCTGATTGTTAGAAAGAGCCTGG + Intergenic
1187617919 X:21018355-21018377 GGTGTTGTTGAGAAACAGCCAGG - Intergenic
1188810984 X:34654653-34654675 GGTGATGGTGGGACACAGGGCGG - Intronic
1192244601 X:69362149-69362171 GCTGGTGTTGGGAGAAAGCCAGG + Intergenic
1194023921 X:88727201-88727223 GCAGAGGATGGTAAACAGCCAGG + Intergenic
1200071747 X:153532583-153532605 CCTCGTGGTGGGAGACAGCCAGG - Intronic
1202079663 Y:21071398-21071420 GTTGATGGTGGGAGGCAGGCAGG + Intergenic