ID: 949915085

View in Genome Browser
Species Human (GRCh38)
Location 3:8955167-8955189
Sequence GTTCTCAGTGGCCCTCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949915085_949915089 13 Left 949915085 3:8955167-8955189 CCAGGTTGAGGGCCACTGAGAAC 0: 1
1: 0
2: 3
3: 20
4: 146
Right 949915089 3:8955203-8955225 TGGACTAGTACCACACTCACTGG 0: 1
1: 0
2: 0
3: 4
4: 61
949915085_949915088 -7 Left 949915085 3:8955167-8955189 CCAGGTTGAGGGCCACTGAGAAC 0: 1
1: 0
2: 3
3: 20
4: 146
Right 949915088 3:8955183-8955205 TGAGAACAAAAGCAAAGGTCTGG 0: 1
1: 0
2: 6
3: 45
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949915085 Original CRISPR GTTCTCAGTGGCCCTCAACC TGG (reversed) Intronic
900203966 1:1423430-1423452 TTTCTAAGTGCCCCCCAACCAGG - Intergenic
900317015 1:2061960-2061982 CTTCTCACTGACCCTCAGCCTGG - Intronic
900890167 1:5443886-5443908 CTTCTCACTGGTCTTCAACCAGG + Intergenic
901407946 1:9062468-9062490 CTTTTCTGTGGCCCTCACCCCGG - Intronic
903331451 1:22599151-22599173 TTTCGGGGTGGCCCTCAACCTGG + Intronic
903577881 1:24350391-24350413 TTTCCCAGTGGCCTTGAACCTGG - Intronic
903868743 1:26417135-26417157 GTACTGAGTGGCCCGCTACCTGG - Intronic
903994816 1:27299098-27299120 GAACTCAGTGGTCCTCATCCAGG + Intronic
906291003 1:44619116-44619138 CTTCCCAGTGGCCCTCAGGCAGG + Intronic
907413766 1:54300228-54300250 GTCCTCAGTGGCCCTCTCCTGGG - Intronic
913319754 1:117579971-117579993 GTATTCAGTGGCCCTAAGCCTGG - Intergenic
913349304 1:117840754-117840776 TCTCTCTGTGGTCCTCAACCAGG + Intergenic
917430725 1:174965648-174965670 GTGCTCAGTAGCACTCACCCTGG + Intronic
920665940 1:207963233-207963255 GTTCCCAGTGGCCCTCTCCCAGG + Intergenic
1062909525 10:1203813-1203835 CTTCTCAGTGGACCTCAAAGTGG + Intronic
1065704533 10:28460035-28460057 GTTCTCAGTGGCTCCCAACCTGG + Intergenic
1066071624 10:31820440-31820462 GTTCACAGTGGACCTCAAGGGGG - Exonic
1069716448 10:70524133-70524155 CTTCCCAGCTGCCCTCAACCAGG - Intronic
1075718274 10:124569620-124569642 GCACTCTGTGGCCCTGAACCAGG + Intronic
1076246670 10:128952355-128952377 GTTCTCCGTGACCCTACACCAGG - Intergenic
1076487297 10:130832365-130832387 GTTCTCAATGACCCTACACCTGG - Intergenic
1076886644 10:133266136-133266158 GTTTTCAGAGTCCCTCAGCCTGG - Intronic
1077405452 11:2380534-2380556 GTTCTCACTGGCCCCCAAAGCGG - Intronic
1079121231 11:17686510-17686532 CTTCCCAGAGGCCCTCAAGCTGG + Intergenic
1079541377 11:21579917-21579939 CTTTCCAGTGGCCCTAAACCAGG - Intergenic
1079822751 11:25151501-25151523 GTTCTCAGTGGCCATCAGCCTGG + Intergenic
1083103428 11:60334147-60334169 GTTCTCAGAGGCCCCCAACATGG - Intergenic
1083859718 11:65413647-65413669 GTGCTCCGTGGGCATCAACCTGG - Intergenic
1084191916 11:67503379-67503401 GCTCTCAGAGGCCCTGACCCTGG + Intronic
1085413991 11:76308236-76308258 GCTCTCAGGGGCCCTAATCCTGG - Intergenic
1085547735 11:77335991-77336013 GTTCTCTGTGGTTTTCAACCTGG - Intronic
1085852419 11:80137463-80137485 GTTCTTAGCAACCCTCAACCTGG + Intergenic
1087789371 11:102391068-102391090 GTTCCCAGTGGTCCCCATCCCGG + Intergenic
1089077346 11:115748854-115748876 GTGCTCAGTGGCTCTCAGCTGGG + Intergenic
1090766624 11:129881775-129881797 GTTCTCTGCGGCCCCCAACTGGG - Exonic
1093370751 12:18362222-18362244 GTTTTCAGTGGCCCCTAAACTGG + Intronic
1094849648 12:34376637-34376659 GCTCTCAGTGGGCGCCAACCAGG + Intergenic
1097233958 12:57527513-57527535 GTCCTGAGTGCCCCCCAACCTGG + Exonic
1101442291 12:104712850-104712872 GTTCTCATAGGCCCTGACCCTGG + Intronic
1102250196 12:111381457-111381479 GTTCTCAGAGCCCCTCATGCTGG + Intergenic
1108494936 13:51016162-51016184 GTACTCAGTTGCTCTCTACCTGG + Intergenic
1110517355 13:76430400-76430422 GTTCTCAGTGGAACTAAAACTGG - Intergenic
1111900212 13:94190505-94190527 GTCCTCAGTGTCCCTCAATCTGG - Intronic
1113072750 13:106437600-106437622 ATTCTCAGTGGCGCTCACCTAGG - Intergenic
1117773097 14:59154474-59154496 CTTCTCAGTGGCCCTCTCCATGG + Intergenic
1118372825 14:65152280-65152302 CTTGTCATTGGCCCTCACCCTGG - Intergenic
1119972495 14:78987220-78987242 GTTCTCAGACGACCACAACCTGG - Intronic
1120607534 14:86597638-86597660 GTTCTCGTTGGCTCTTAACCAGG + Intergenic
1122185926 14:99995995-99996017 GTTTTCAGTGGCTTCCAACCTGG + Intronic
1123401998 15:19996367-19996389 GTTCCCAGTGGCACTGGACCCGG - Intergenic
1123511338 15:21003031-21003053 GTTCCCAGTGGCACTGGACCCGG - Intergenic
1123578172 15:21693802-21693824 GTTCCCAGTGGCACTGGACCCGG - Intergenic
1123614797 15:22136284-22136306 GTTCCCAGTGGCACTGGACCCGG - Intergenic
1123858276 15:24436017-24436039 GTTCTCAGTGGCGTTCCCCCGGG - Intergenic
1124810910 15:32937173-32937195 CTTCTCAGTGGTTCCCAACCTGG + Intronic
1126842798 15:52733746-52733768 GCCCTTAGTGGCCCCCAACCTGG + Intergenic
1127389770 15:58496109-58496131 GTTCTCAGTGGTTCTCAACTGGG + Intronic
1128208158 15:65870476-65870498 CTACTCAGTGGCACCCAACCCGG + Intronic
1128643880 15:69360692-69360714 GTTCTCTGTAGCACACAACCAGG - Intronic
1128946253 15:71823943-71823965 GTTCTCACTGGCCCTCTGCATGG - Exonic
1130878991 15:88038809-88038831 TCTCTCAGTGGTTCTCAACCTGG - Intronic
1130956612 15:88631275-88631297 TTACGCAGTGGCCCTGAACCTGG + Exonic
1130991313 15:88877595-88877617 GTTCTCCCTGCCCCTCAGCCTGG - Exonic
1202987042 15_KI270727v1_random:428047-428069 GTTCCCAGTGGCACTGGACCCGG - Intergenic
1132835502 16:1950999-1951021 GTGCTCAGAAGCCCCCAACCGGG + Intronic
1133626272 16:7573356-7573378 CTTCTCAGTGGTCTCCAACCTGG - Intronic
1134180817 16:12046321-12046343 GTTCTCTGTGTCCATTAACCAGG - Intronic
1135307567 16:21380082-21380104 GTTCTCTGTGTCCATTAACCAGG - Intergenic
1136304311 16:29359202-29359224 GTTCTCTGTGTCCATTAACCAGG - Intergenic
1147689945 17:42308864-42308886 GGTCTCAGTGACCCTCAGGCAGG + Intronic
1152920781 17:83065523-83065545 GTTCTCAGTGGACACCAACGGGG + Intergenic
1154034720 18:10789078-10789100 GTTCTGTGTGGCCCTATACCAGG - Exonic
1155847195 18:30722967-30722989 GTTCTCAGTGGCCTCCAAGCAGG + Intergenic
1156525861 18:37766643-37766665 CTTCTCAGTGGCCCTCTGCCTGG + Intergenic
1159632425 18:70764382-70764404 CCTCTCAGTGCCCCTCACCCAGG + Intergenic
1160771862 19:835579-835601 CTTCTCTGTGCCCCTCTACCCGG + Intergenic
1161429704 19:4224487-4224509 TTTCTCAGCGGCCCTGAGCCTGG - Exonic
1163553953 19:17982330-17982352 GTCCCCAGCTGCCCTCAACCAGG + Intronic
1164418016 19:28062406-28062428 GTTCACAGTGGTCCTCATCAGGG - Intergenic
1164418094 19:28062871-28062893 GTCCTCACTGGGCCTCACCCAGG - Intergenic
1165038277 19:33050155-33050177 GTCCTCATTGGCCTTGAACCTGG + Intronic
1165147024 19:33737380-33737402 TGTCTCAGTGGCCCTGAACCTGG - Intronic
930052601 2:47228299-47228321 GTTCACAGAGGCCTTCAAGCAGG + Intergenic
932735141 2:74249190-74249212 CTTGGCAGTGGCTCTCAACCAGG - Intronic
934034586 2:88078195-88078217 GTACTCAGTGGACATCAGCCCGG - Intronic
934121360 2:88843261-88843283 ATTCTCAGCAGCCCTCAGCCAGG + Intergenic
935111565 2:100099020-100099042 GCTCTCATTGGCCCTCAGCATGG - Intronic
936123403 2:109766144-109766166 GCTCTCATTGGCCCTCAGCATGG + Intergenic
936221282 2:110605320-110605342 GCTCTCATTGGCCCTCAGCATGG - Intergenic
938773521 2:134521330-134521352 TATGTCAGTGGCTCTCAACCAGG + Intronic
939595962 2:144122738-144122760 TTTATCAGTGGTCCTTAACCTGG + Intronic
941095441 2:161236505-161236527 GTCTTCAGTGGCCATCAATCAGG - Intergenic
942634533 2:177988775-177988797 GCTCTAAGTGGCCCTCAGCTTGG - Intronic
943114262 2:183646663-183646685 GGTCTCAGTAGGCCCCAACCAGG - Intergenic
944612116 2:201421588-201421610 TTTATCAGTGGTTCTCAACCAGG - Intronic
948387905 2:237593067-237593089 GTTCACAGTGGCTCTCACCATGG + Intronic
1168917595 20:1503968-1503990 GTTTTCAGTGGCCTCAAACCTGG + Intergenic
1170431122 20:16277963-16277985 GTTCTCAGTGGCCCTGACACAGG - Intronic
1172592702 20:36128729-36128751 GTCCTCTCTGACCCTCAACCTGG - Intronic
1179563495 21:42232034-42232056 GTTCTCAGTGGCCCCCAGGTGGG + Intronic
1179578790 21:42324979-42325001 GTGCTCAGTGCCCCTGAGCCAGG + Intergenic
1182462533 22:30492525-30492547 GTTCCCCGTGGCCTTCAACTTGG - Exonic
1184421534 22:44385289-44385311 GCTCTCAGTGGCGCTGACCCTGG + Intergenic
949915085 3:8955167-8955189 GTTCTCAGTGGCCCTCAACCTGG - Intronic
951716097 3:25648166-25648188 GTTTTCAATGGCCCTCAACCTGG - Intronic
952831716 3:37570605-37570627 GTTCCCAGTGGTCCTCACCCAGG - Intronic
954024104 3:47768332-47768354 GTTCCCAGTGGCACTAAACCAGG + Intronic
956334050 3:68143690-68143712 TGGCTCAGTGGCTCTCAACCAGG - Intronic
961522406 3:127474584-127474606 GATCTCAGTGTCCTTCAACAGGG + Intergenic
964343049 3:155728862-155728884 ACTCTCAGTGGCCATCAATCTGG + Intronic
965695650 3:171405883-171405905 GTTCTTACTTGCCCTCAACCTGG - Intronic
967078362 3:186025663-186025685 GTTCCCAGTGGTTGTCAACCAGG - Intergenic
967682003 3:192374830-192374852 ATTCTCACTGCCTCTCAACCAGG + Intronic
967697817 3:192553865-192553887 GTTTTCAGTGGTCCCCAACCTGG - Intronic
973636392 4:52865213-52865235 GTTGTTTATGGCCCTCAACCTGG + Intronic
975714610 4:77193607-77193629 TTTCTCATTGGTCCTCACCCAGG + Intronic
979341665 4:119531962-119531984 TATCTCAGTGTCCCTCAACATGG + Intronic
981283224 4:142985025-142985047 GTTCTCAGTGGCTTCCAACTGGG - Intergenic
985761018 5:1748810-1748832 GTTCTCAGTGTCCCTCATTCTGG - Intergenic
986618071 5:9640222-9640244 GTTCTGACTGACCCTCTACCCGG - Intronic
990308969 5:54519404-54519426 CTTCTCGGTGGGCCTGAACCAGG + Exonic
992206932 5:74440082-74440104 AGTCTCACTGGCCATCAACCAGG + Intergenic
996404113 5:123089927-123089949 GGTCCCAGTGGCCCTCTTCCCGG + Intronic
996473585 5:123888569-123888591 GTTTTCATTGGCATTCAACCTGG + Intergenic
997721207 5:136079550-136079572 CTGCTCAGTGGTCCGCAACCGGG + Intergenic
999997534 5:157106505-157106527 GGTCTTAGTGGCCCTCCTCCAGG + Intronic
1005258267 6:24028141-24028163 GTGCTCAGAATCCCTCAACCTGG + Intergenic
1007084886 6:39136302-39136324 GTGCTCAGTGGCTCTGAGCCAGG + Intergenic
1009913525 6:69963604-69963626 ATTCTCACTGGCTCTCAACTTGG - Intronic
1015223596 6:130831556-130831578 GATCTCATTTGCCCTCAAACTGG - Intronic
1015754770 6:136596302-136596324 CTTCTCAGTGGCTCTCAGCCTGG - Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018588114 6:165385445-165385467 CTTCTCATTGGCCCACCACCTGG - Intronic
1020012744 7:4815535-4815557 GTCCTCAGTGGCCCAGAGCCGGG - Intronic
1020154220 7:5709167-5709189 GTCCTCAGAGGTCCCCAACCTGG + Intronic
1020513662 7:9090303-9090325 CCTCTCAGTGCCTCTCAACCTGG + Intergenic
1022493885 7:30841058-30841080 GTTCTCAGTGGTGCTCCACCTGG + Intronic
1023452933 7:40307400-40307422 TTTCTGAGTGGCCCTGAACCTGG - Intronic
1024340484 7:48253224-48253246 GCTTTCAGTGGCCTCCAACCTGG + Intronic
1025955853 7:66182523-66182545 GTTCTAAGGGGTCCTCAACTGGG + Intergenic
1032282884 7:130519158-130519180 ATTCTCAGTGCTCCTCATCCCGG - Intronic
1034383582 7:150720117-150720139 GTTCCCAGTGGCGCTCTTCCCGG - Exonic
1037820707 8:22133414-22133436 GTCCTCAGATGCCCTCCACCCGG - Intergenic
1041503109 8:58560540-58560562 GTTTTCAGAGGCCTCCAACCTGG - Intronic
1042222319 8:66485933-66485955 CTTCTCAGAGGCCCACAGCCCGG + Intronic
1045727290 8:105188709-105188731 GTTCTCAGCAGCTCTCAACTTGG - Intronic
1051237086 9:15012776-15012798 GTACTCAGTGGCCATCACACTGG - Intergenic
1053353459 9:37428419-37428441 GTTCTCAGCGGCCCCCATCTTGG + Intronic
1054847834 9:69815652-69815674 GTTCTCTGTGGCCTTTAATCTGG - Intergenic
1056028070 9:82521649-82521671 TTACTCAATGGTCCTCAACCTGG - Intergenic
1056862465 9:90198873-90198895 CTTCTCAGTGGCCCCCTAACTGG + Intergenic
1057216226 9:93230337-93230359 GGCCTCAGTGCCCCTCAGCCGGG + Intronic
1058416366 9:104793119-104793141 CTCCTCTGTGACCCTCAACCAGG + Intronic
1059162592 9:112049389-112049411 GTTCTCAGTCGCCCTCTCTCTGG - Intronic
1061738592 9:132681779-132681801 GTTCTCAGTAGCCCTGATCTCGG - Intronic
1062022137 9:134324884-134324906 GTCAACAGTGGCCCTCATCCCGG + Intronic
1185669294 X:1792919-1792941 GTTCTCAGAGGACCCCATCCAGG - Intergenic
1187485831 X:19702464-19702486 TTTCTCAGTGGCCCCCAGTCAGG - Intronic
1189576441 X:42358827-42358849 GGTCTCAGTGGCAGTCAACCTGG + Intergenic
1190121748 X:47666045-47666067 GTTCTCAGTGGCTAACAACCAGG - Intergenic
1190125647 X:47703076-47703098 GATCTCAGTGGCTAACAACCAGG - Intergenic
1190292343 X:49001246-49001268 ATTCTCAGTGTCCCTCACACAGG + Intronic
1192138955 X:68631221-68631243 GTTCTGATTTGCCCTCAGCCAGG + Intergenic
1192146832 X:68688072-68688094 GTTCTGATTTGCCCTCAGCCAGG - Intronic
1192544959 X:72005579-72005601 CTCCACAGTGGCCCTCAACCAGG - Intergenic
1193221791 X:78935095-78935117 CTTCTCTGTGCCCCTCAAGCAGG + Intergenic
1195004413 X:100671876-100671898 GTTCTCTGGGGCCCTCCAGCTGG + Intergenic
1195014913 X:100768999-100769021 TTTCTCAGCAGCCCCCAACCTGG + Intergenic
1199673265 X:150164049-150164071 GGGCTCAGTGGGCCTCTACCAGG - Intergenic
1199852276 X:151733780-151733802 GTTCTCTGTGTCCCTAACCCAGG + Intergenic