ID: 949915570

View in Genome Browser
Species Human (GRCh38)
Location 3:8961099-8961121
Sequence ATGCCATCCTCTTCTGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949915565_949915570 19 Left 949915565 3:8961057-8961079 CCAGAAGCCAGAACCAGTCTATT 0: 1
1: 0
2: 0
3: 23
4: 245
Right 949915570 3:8961099-8961121 ATGCCATCCTCTTCTGGTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 145
949915566_949915570 12 Left 949915566 3:8961064-8961086 CCAGAACCAGTCTATTATATCAC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 949915570 3:8961099-8961121 ATGCCATCCTCTTCTGGTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 145
949915564_949915570 20 Left 949915564 3:8961056-8961078 CCCAGAAGCCAGAACCAGTCTAT 0: 1
1: 0
2: 2
3: 13
4: 147
Right 949915570 3:8961099-8961121 ATGCCATCCTCTTCTGGTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 145
949915567_949915570 6 Left 949915567 3:8961070-8961092 CCAGTCTATTATATCACACTTTC 0: 1
1: 0
2: 0
3: 20
4: 206
Right 949915570 3:8961099-8961121 ATGCCATCCTCTTCTGGTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949915570 Original CRISPR ATGCCATCCTCTTCTGGTGG AGG Intronic