ID: 949916159

View in Genome Browser
Species Human (GRCh38)
Location 3:8966229-8966251
Sequence CTCTCCACTTCTGGGGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949916159_949916165 24 Left 949916159 3:8966229-8966251 CCAAAGACCCCAGAAGTGGAGAG No data
Right 949916165 3:8966276-8966298 GATTTTAATCCATGTTAACTTGG No data
949916159_949916166 25 Left 949916159 3:8966229-8966251 CCAAAGACCCCAGAAGTGGAGAG No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949916159 Original CRISPR CTCTCCACTTCTGGGGTCTT TGG (reversed) Intergenic