ID: 949916161

View in Genome Browser
Species Human (GRCh38)
Location 3:8966237-8966259
Sequence GCATGGAACTCTCCACTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949916161_949916165 16 Left 949916161 3:8966237-8966259 CCCAGAAGTGGAGAGTTCCATGC No data
Right 949916165 3:8966276-8966298 GATTTTAATCCATGTTAACTTGG No data
949916161_949916166 17 Left 949916161 3:8966237-8966259 CCCAGAAGTGGAGAGTTCCATGC No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949916161 Original CRISPR GCATGGAACTCTCCACTTCT GGG (reversed) Intergenic