ID: 949916162

View in Genome Browser
Species Human (GRCh38)
Location 3:8966238-8966260
Sequence GGCATGGAACTCTCCACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949916162_949916165 15 Left 949916162 3:8966238-8966260 CCAGAAGTGGAGAGTTCCATGCC No data
Right 949916165 3:8966276-8966298 GATTTTAATCCATGTTAACTTGG No data
949916162_949916166 16 Left 949916162 3:8966238-8966260 CCAGAAGTGGAGAGTTCCATGCC No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949916162 Original CRISPR GGCATGGAACTCTCCACTTC TGG (reversed) Intergenic