ID: 949916163

View in Genome Browser
Species Human (GRCh38)
Location 3:8966254-8966276
Sequence CTGAACTTTTTACTAAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949916163_949916166 0 Left 949916163 3:8966254-8966276 CCATGCCTTAGTAAAAAGTTCAG No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data
949916163_949916165 -1 Left 949916163 3:8966254-8966276 CCATGCCTTAGTAAAAAGTTCAG No data
Right 949916165 3:8966276-8966298 GATTTTAATCCATGTTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949916163 Original CRISPR CTGAACTTTTTACTAAGGCA TGG (reversed) Intergenic