ID: 949916163 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:8966254-8966276 |
| Sequence | CTGAACTTTTTACTAAGGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949916163_949916166 | 0 | Left | 949916163 | 3:8966254-8966276 | CCATGCCTTAGTAAAAAGTTCAG | No data | ||
| Right | 949916166 | 3:8966277-8966299 | ATTTTAATCCATGTTAACTTGGG | No data | ||||
| 949916163_949916165 | -1 | Left | 949916163 | 3:8966254-8966276 | CCATGCCTTAGTAAAAAGTTCAG | No data | ||
| Right | 949916165 | 3:8966276-8966298 | GATTTTAATCCATGTTAACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949916163 | Original CRISPR | CTGAACTTTTTACTAAGGCA TGG (reversed) | Intergenic | ||