ID: 949916166

View in Genome Browser
Species Human (GRCh38)
Location 3:8966277-8966299
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949916160_949916166 18 Left 949916160 3:8966236-8966258 CCCCAGAAGTGGAGAGTTCCATG No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data
949916159_949916166 25 Left 949916159 3:8966229-8966251 CCAAAGACCCCAGAAGTGGAGAG No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data
949916158_949916166 26 Left 949916158 3:8966228-8966250 CCCAAAGACCCCAGAAGTGGAGA No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data
949916161_949916166 17 Left 949916161 3:8966237-8966259 CCCAGAAGTGGAGAGTTCCATGC No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data
949916163_949916166 0 Left 949916163 3:8966254-8966276 CCATGCCTTAGTAAAAAGTTCAG No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data
949916162_949916166 16 Left 949916162 3:8966238-8966260 CCAGAAGTGGAGAGTTCCATGCC No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data
949916164_949916166 -5 Left 949916164 3:8966259-8966281 CCTTAGTAAAAAGTTCAGATTTT No data
Right 949916166 3:8966277-8966299 ATTTTAATCCATGTTAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type