ID: 949916215

View in Genome Browser
Species Human (GRCh38)
Location 3:8966647-8966669
Sequence TGGGGTCCACAGTAAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949916215_949916223 16 Left 949916215 3:8966647-8966669 CCTCACACTTACTGTGGACCCCA No data
Right 949916223 3:8966686-8966708 CCTGCTGTGTCCTTGTGACCAGG No data
949916215_949916217 -8 Left 949916215 3:8966647-8966669 CCTCACACTTACTGTGGACCCCA No data
Right 949916217 3:8966662-8966684 GGACCCCAGTTCTAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949916215 Original CRISPR TGGGGTCCACAGTAAGTGTG AGG (reversed) Intergenic
No off target data available for this crispr