ID: 949918150

View in Genome Browser
Species Human (GRCh38)
Location 3:8981064-8981086
Sequence GGCCATGTGGCCAGTCCCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 359}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949918142_949918150 24 Left 949918142 3:8981017-8981039 CCGGGGACAACTCACACAGAAAG 0: 1
1: 0
2: 0
3: 16
4: 223
Right 949918150 3:8981064-8981086 GGCCATGTGGCCAGTCCCAGAGG 0: 1
1: 0
2: 2
3: 31
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949918150 Original CRISPR GGCCATGTGGCCAGTCCCAG AGG Exonic
900237117 1:1598192-1598214 GTCCAGGTGGTCAGTGCCAGGGG + Exonic
900367422 1:2316882-2316904 GGCCAGGTGCCCAGCCCCATAGG - Intergenic
900491425 1:2951174-2951196 GGCCAAGTGGCCAGTCTTACAGG - Intergenic
900941571 1:5801895-5801917 AGCTCTGTGGCCAGTCTCAGTGG + Intergenic
901461692 1:9395771-9395793 GGCCCAGTGGCCAGACCCAGGGG + Intergenic
901732996 1:11293958-11293980 TGCCATGGGGCCAGGCACAGTGG - Intronic
901772831 1:11539325-11539347 GCCCATTTGGCCAGGCGCAGTGG + Intergenic
901847901 1:11996212-11996234 GGTGGTGTGGCCAATCCCAGAGG - Exonic
902433602 1:16382473-16382495 AACCATGTGGCCAGGCGCAGTGG - Intronic
902511083 1:16967461-16967483 GGCCATGGGCCCAGCCGCAGGGG + Intronic
903039129 1:20515388-20515410 GGCCATGGGGCCGGTCGCAGTGG - Intergenic
903891172 1:26571657-26571679 GGCCTTGTGCCCCCTCCCAGAGG + Intronic
904051914 1:27645097-27645119 GGCCAACTGGCCTGTCCCAGGGG + Intergenic
904265566 1:29316839-29316861 GGGCATGTGACCAGAGCCAGGGG - Intronic
904855319 1:33493470-33493492 GGCCATGGGGACTGTCCGAGAGG + Exonic
905455202 1:38083800-38083822 GAGGAGGTGGCCAGTCCCAGGGG - Intergenic
906306040 1:44719905-44719927 GGCCATGGGGCCAGGTGCAGTGG + Intronic
906378148 1:45313523-45313545 GGCCAGGTGGCCAGGTGCAGTGG - Intergenic
906515363 1:46435915-46435937 GGCCATGGGGCCAGCCACCGTGG - Intergenic
908247801 1:62241865-62241887 AGCCACAGGGCCAGTCCCAGGGG + Intronic
909039331 1:70630540-70630562 GGCCATGTGGCAAGACCTATGGG + Intergenic
911163580 1:94705913-94705935 GGCCATGTGGTCAGGCACAGTGG - Intergenic
911280167 1:95915518-95915540 AGCCAGGAGGCCAGTCACAGTGG + Intergenic
912309894 1:108609675-108609697 GGCCAGGTAGCCAGGCACAGAGG + Intronic
912381432 1:109249970-109249992 GGCCAGGGCGCCAGTCCCCGGGG - Intergenic
912401580 1:109397841-109397863 GGCCATGGGGCCAGCGCGAGAGG + Exonic
914331318 1:146673275-146673297 TGCCATGTGGCCCCTCCCATAGG + Intergenic
914869388 1:151459826-151459848 GGCCAGGTGGTGAGGCCCAGTGG + Intergenic
915167966 1:153959048-153959070 GGGCATGTGGCCAGCCTGAGAGG - Intergenic
915497427 1:156291866-156291888 GGGCATGGGGCCAGGACCAGGGG + Exonic
915739008 1:158103943-158103965 GCCCATGTTGCCAGTCCCCAGGG + Intergenic
920254866 1:204647794-204647816 TGCAATGTGGCCAGTCCAAATGG + Intronic
921051594 1:211515407-211515429 CGTCCTGTGGCCAGGCCCAGCGG + Intergenic
921232657 1:213088648-213088670 AGCCATGAGGCCAGGCGCAGTGG - Intronic
921251831 1:213305368-213305390 GTGCATGTGGCCAGGCACAGTGG - Intergenic
921860589 1:220038663-220038685 GGGTATGTGGCCAGGCGCAGTGG - Intronic
922605414 1:226887135-226887157 TGTCTGGTGGCCAGTCCCAGAGG + Intronic
922791687 1:228314505-228314527 GGCCATGTGCCCAGGGCTAGAGG + Intronic
922902018 1:229144561-229144583 CACCTTGTGCCCAGTCCCAGAGG - Intergenic
923158368 1:231297653-231297675 GGCCATGTGGTCAGGCCAAAAGG - Intergenic
923733793 1:236581766-236581788 CTCCATGTTGCCAGGCCCAGTGG - Intronic
1067945617 10:50686436-50686458 GGCCCCGAGGCCAGTCCCTGTGG - Intergenic
1068692624 10:59932510-59932532 GGCCATCTGGCCGGGCACAGTGG - Intergenic
1070867130 10:79713309-79713331 GGCCCCGAGGCCAGTCCCTGTGG - Intronic
1070880920 10:79851430-79851452 GGCCCCGAGGCCAGTCCCTGTGG - Intergenic
1071262514 10:83933614-83933636 GCCCATGAGGCCAGTCCTGGCGG - Intergenic
1071634045 10:87235533-87235555 GGCCCCGAGGCCAGTCCCTGTGG - Intronic
1071647491 10:87367750-87367772 GGCCCCGAGGCCAGTCCCTGTGG - Intronic
1071793817 10:88984697-88984719 GGCCATTTAGACAGGCCCAGTGG - Intronic
1072283080 10:93887869-93887891 GGGCTTGGGGCCAGTCACAGTGG + Intergenic
1072319854 10:94238436-94238458 GACCATGTGTTCAGTCACAGGGG + Intronic
1073962145 10:108944647-108944669 GGGAATGTGGCCAGGCACAGTGG - Intergenic
1075310965 10:121413030-121413052 GGCCATGAGGACACTCACAGGGG + Intergenic
1075547144 10:123363477-123363499 GGCCATGGGGGCTCTCCCAGAGG - Intergenic
1075754814 10:124802082-124802104 AGCCAGGGGGCCTGTCCCAGGGG - Intronic
1075758960 10:124840621-124840643 GGCCATGTGGCCGGGCGCGGTGG - Intergenic
1075778579 10:125003159-125003181 GGCCAGGGGGCCAGGCCAAGTGG - Intronic
1075788355 10:125065674-125065696 GCTCTTGTGGCCAGCCCCAGTGG + Intronic
1077033644 11:482599-482621 GTCCATCTGGCCAGGCACAGTGG - Intronic
1077374247 11:2198187-2198209 GGCCATGTGGATCCTCCCAGGGG - Intergenic
1077518579 11:3017353-3017375 CCCCATGTGGCCAGGCGCAGTGG + Intronic
1083831187 11:65234864-65234886 GTCCATGAGGCCAGGCACAGTGG - Intergenic
1084085302 11:66852374-66852396 CGCTCTGTGGCCAGTCCCACAGG - Intronic
1085562651 11:77486582-77486604 TGCCATGTGGCCACTGCCAGGGG - Intergenic
1085682741 11:78593503-78593525 GGGCATGTGGCCAGTCATACTGG - Intergenic
1086313212 11:85559434-85559456 AGCCATGTGGCCGGGCGCAGTGG - Intronic
1089484130 11:118831696-118831718 TGCCTTGTGGCCAGGCGCAGTGG - Intergenic
1089626563 11:119754827-119754849 TCCCATGTGTCCAGGCCCAGGGG - Intergenic
1089755048 11:120680368-120680390 GGCCATCGGGCCAGGCACAGTGG - Intronic
1093745588 12:22737242-22737264 GACCATGTGGCTAGTCCAAATGG - Intergenic
1093984429 12:25513357-25513379 ACCCATGTGGCCAGGCACAGTGG + Intronic
1094610468 12:31990724-31990746 GCCCATGTGGCCGGGCGCAGTGG - Intronic
1095690294 12:45080939-45080961 GGCCATGTGGTCTCTTCCAGAGG + Intergenic
1096546868 12:52346121-52346143 GGCCAGGTCCTCAGTCCCAGGGG + Intergenic
1096740565 12:53690936-53690958 GGACATCTGGCCAGGCACAGTGG - Intergenic
1097643587 12:62209911-62209933 GGGCATCTGGCCAGGCGCAGGGG + Intronic
1100112467 12:91262049-91262071 GGCCTTATGGCAAGCCCCAGTGG - Intergenic
1100760111 12:97797806-97797828 GGGCATGAGGCCAGTCTGAGAGG + Intergenic
1101574076 12:105981236-105981258 AGGCAAATGGCCAGTCCCAGCGG + Intergenic
1102172087 12:110849947-110849969 TTCAATGTGCCCAGTCCCAGAGG - Intronic
1103442769 12:120975784-120975806 GGCCCTGTGGCCAGGCACAGTGG - Intergenic
1103886734 12:124208122-124208144 TGCCATGTGGACAGTACCAGGGG + Intronic
1104878124 12:132050929-132050951 GGCCATGTGGCCAACCACAAGGG + Intronic
1106000717 13:25720447-25720469 GGTCATGTGGCCAGGCGCAGTGG - Intronic
1106298329 13:28439085-28439107 TGGCATTTGGCCAGTCTCAGAGG + Intronic
1106460782 13:29965776-29965798 GGCCATGGGGCCACCCCCAAGGG - Intergenic
1107817450 13:44256633-44256655 GGGCATGTGCCCATTTCCAGGGG + Intergenic
1107831153 13:44374333-44374355 GCCCAGGTAGCCACTCCCAGAGG - Intronic
1108918028 13:55640567-55640589 GGCATAGTGGCCAGTCCCTGTGG - Intergenic
1109489901 13:63083529-63083551 TGTCATGTGGCCAGGCGCAGTGG - Intergenic
1110567869 13:76974460-76974482 AGCCATGTGACCATTCCCTGTGG - Intergenic
1110918733 13:81057424-81057446 GCTCATGTGGCCAGGCGCAGTGG - Intergenic
1112740931 13:102472245-102472267 GGCCAGGCTGCCTGTCCCAGTGG - Intergenic
1114239780 14:20855847-20855869 GGTCATGGTGTCAGTCCCAGAGG + Intergenic
1114702232 14:24690789-24690811 GGCCAGGTGGGCAGCTCCAGTGG - Intergenic
1115070993 14:29321389-29321411 GGCCATTAGGCCAGGCGCAGTGG - Intergenic
1116028960 14:39547934-39547956 GGCCATGTGGCTAGGACCTGAGG + Intergenic
1117161628 14:52995391-52995413 CACCATGTGGCCACTGCCAGGGG + Intergenic
1118096794 14:62546328-62546350 TGCCATGTGGCCACTGCCAGGGG - Intergenic
1119838746 14:77774456-77774478 GGCCATGAGGCCAGGCGCAATGG - Intergenic
1121884647 14:97532388-97532410 GTCCATGGGGCCACTGCCAGTGG - Intergenic
1122606529 14:102950340-102950362 GGCCCTGGTGCCAGTCCTAGGGG - Intronic
1122772659 14:104104230-104104252 GGGCATGGGGCGAGTCTCAGTGG + Intronic
1122918444 14:104869473-104869495 GGCCATGTGCACATTCCCTGGGG + Intronic
1124349013 15:28942044-28942066 GGCTATGAGGCCAGGCGCAGTGG - Intronic
1125847965 15:42875617-42875639 GACCATCTGGCCAGGCACAGTGG + Intronic
1127632303 15:60838461-60838483 GGCCATGGGGCCAGCCTCTGTGG + Intronic
1128557260 15:68640220-68640242 GGCCACCTGGCCAGTGCCAAGGG - Intronic
1129711686 15:77823625-77823647 GGCCATGTGGCCAGAGCATGAGG + Intergenic
1130295853 15:82646949-82646971 GGCCAGGTGCCCAGACTCAGGGG - Intronic
1132247492 15:100309072-100309094 GGCCATGTGGCCAGGGGCAATGG + Intronic
1132680965 16:1141597-1141619 GGACCCCTGGCCAGTCCCAGGGG - Intergenic
1132826303 16:1907341-1907363 GGCCATGTGGCCAGATCTAGAGG - Intergenic
1133025664 16:2988021-2988043 GGCCCTGGCGCCAGGCCCAGAGG - Intergenic
1133030199 16:3007169-3007191 GGCCAGGTGCCCATTCCCACTGG + Intergenic
1133196279 16:4173015-4173037 GAGCAAGTGGCCAGTCGCAGTGG - Intergenic
1134078415 16:11308478-11308500 GGCCAGGCTGCCAGTCCCACAGG - Intronic
1134484458 16:14646473-14646495 GGGCATTTGGCCAGGCACAGTGG - Intronic
1134602652 16:15545617-15545639 GGTCCTGTGGCCAGTCTCTGGGG - Intronic
1136452875 16:30364151-30364173 GTCCATCTGGCCAGGCGCAGTGG + Intronic
1136495799 16:30643222-30643244 AGACGTGTGGCCAGGCCCAGTGG + Intergenic
1137681572 16:50351138-50351160 TACCATGTTGCTAGTCCCAGTGG + Intronic
1137701080 16:50498314-50498336 GGTCATGGGGCCAGTTCGAGAGG - Intergenic
1138367189 16:56489834-56489856 TGCAATGTGGCCAGGCACAGTGG + Intronic
1138679464 16:58674560-58674582 AGCGATGAGGCCAGTCACAGTGG - Intronic
1139625292 16:68183714-68183736 GGCAGTGTGGCCAGGCGCAGTGG + Intronic
1140002238 16:71037626-71037648 TGCCATGTGGCCCCTCCCATAGG - Intronic
1140125972 16:72119413-72119435 GGCCATGCGGCCAGCCCTTGAGG - Intronic
1141244716 16:82295056-82295078 GGCAAAGTGGCAAGTCCAAGGGG - Intergenic
1141524397 16:84602565-84602587 GCACATGTGGCCAGACGCAGTGG + Intronic
1142159630 16:88550377-88550399 GGCCATGTGGGCTGCTCCAGAGG - Intergenic
1142275166 16:89114601-89114623 GGCCGAGTGGCCTGTCCCACGGG - Intronic
1142373407 16:89695177-89695199 AGCCAGGTGGCCACTCCGAGCGG - Intronic
1142719962 17:1769469-1769491 GGCCATGAGGCCAGGCGCAGTGG + Intronic
1142957249 17:3530325-3530347 GGCCATGGCGCCAGGCGCAGAGG - Intronic
1143231057 17:5355538-5355560 GCTCATGTGGCCTGTCCCTGCGG + Intronic
1144713362 17:17417651-17417673 GGCCATGTGGAGAGCCCCAGAGG - Intergenic
1144777393 17:17791675-17791697 GGCCATTGGCCGAGTCCCAGAGG - Intronic
1146214215 17:30965851-30965873 GGCCATGTGGCCTCAACCAGAGG - Intergenic
1147144423 17:38477064-38477086 CGCCATGTGGCCAAAGCCAGTGG - Intronic
1147596215 17:41719403-41719425 GGCAATTTGGCCAGCCGCAGTGG + Intronic
1148373648 17:47122023-47122045 AGCCATGGGGCCAGTCGCAGTGG - Intronic
1148553229 17:48563213-48563235 GGCCAGGAGGCCAGGCCAAGTGG + Intronic
1150701729 17:67452771-67452793 GACCCAGTGGCCAGGCCCAGTGG - Intronic
1151542104 17:74769887-74769909 GGGCAAGTGTCCAGTGCCAGGGG + Intergenic
1151542807 17:74773408-74773430 GGCCCTGAAGCCAGTCCCTGTGG - Intronic
1151557884 17:74855786-74855808 TGCCATGGGGCCAGCCCCAAGGG + Intronic
1151643556 17:75414197-75414219 GGCCAGGAGGCCAGGCACAGTGG - Intergenic
1152246722 17:79188334-79188356 GGCCAGGGGGACAGTGCCAGTGG - Intronic
1152554277 17:81045331-81045353 GGCCGTGTGGCCCTTCCCACAGG + Intronic
1154155837 18:11943601-11943623 GGCCATGTGGCAAGGAACAGGGG + Intergenic
1156034228 18:32748775-32748797 GGCAAAGAGGCCAGGCCCAGTGG - Intronic
1156367301 18:36440832-36440854 GGCCAAGTGCCCAGCCTCAGAGG - Intronic
1156382109 18:36572696-36572718 GGGCACTTGGCCAGTACCAGAGG + Intronic
1160527081 18:79544421-79544443 GGCCCTGAGGCCAAGCCCAGGGG + Intergenic
1160733456 19:651446-651468 GGCCGTGTGGGGAGTCACAGGGG + Intronic
1160912677 19:1482101-1482123 CGCCGTGTGCCCAGGCCCAGCGG + Exonic
1161247409 19:3260907-3260929 AGCCAGGTGGCCAGGCGCAGTGG - Intronic
1161522743 19:4734461-4734483 GGTCATGGGGCCAGGCACAGTGG + Intergenic
1162056264 19:8065946-8065968 GGCCATGGGGCCAGGCCTTGAGG - Exonic
1162227321 19:9234187-9234209 AGACATGTGGCCAGGCACAGTGG - Intergenic
1162461243 19:10815649-10815671 GGCCAGCTGGCCAGTCCCCATGG + Intronic
1163414471 19:17177723-17177745 AGCCCTGTGGCCAGGCCCTGGGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1163748810 19:19063580-19063602 GGCCCCGCGGCCAGTCGCAGCGG - Intergenic
1164910571 19:32008020-32008042 GCCCCTGTGGCCAGGCACAGTGG + Intergenic
1164983598 19:32631999-32632021 GGCCACATGGCCAGGCGCAGTGG + Intronic
1165682589 19:37790417-37790439 GGCCAGGTGGCCACTCCCAGAGG + Intronic
1165741770 19:38209221-38209243 AGCCATGTGGCCAGGGCCAAAGG - Intergenic
1166646290 19:44534132-44534154 GGAAATGTGGCCAGGCACAGTGG + Intergenic
1166767118 19:45258270-45258292 GGCCAGGTGGCCAGGTGCAGTGG - Intronic
1167421856 19:49408733-49408755 GGCCAAGAGGCCAGGCGCAGTGG - Intronic
1168168435 19:54571126-54571148 GGCCCTGAGGCCAGTGTCAGAGG - Intergenic
1168707975 19:58480443-58480465 GGCCAGGTGTGCAGTCCCCGGGG + Exonic
927477298 2:23423612-23423634 GGCCATGGGGTCAGTCAGAGAGG + Intronic
927489281 2:23510148-23510170 GGCCATGTGCTCAGTGACAGGGG + Intronic
928095790 2:28404270-28404292 GGCCATGTGTCCAGGGACAGAGG - Exonic
928854731 2:35790049-35790071 GGCCATGTGGCAAGACCTATAGG + Intergenic
929142203 2:38676473-38676495 GGCCACATGGCCAGGCACAGTGG + Intronic
930479018 2:51923891-51923913 GTCCATGTGGCAAGGCACAGAGG + Intergenic
930725464 2:54677357-54677379 GGCCCTGTGGCCAGTTCAGGGGG - Intergenic
931669960 2:64638307-64638329 AGGCATTTGGCCAGGCCCAGTGG + Intronic
932122467 2:69114463-69114485 GACCATGAGTCCATTCCCAGAGG - Intronic
932488574 2:72103907-72103929 GGCCAGGGGGCATGTCCCAGGGG - Intergenic
934234348 2:90216970-90216992 AGCCATGTGGCCAGGGCCTGTGG + Intergenic
937349166 2:121149547-121149569 AGCGGTGTGGCCAGCCCCAGGGG - Intergenic
938260230 2:129890585-129890607 AGGCATCTGGCTAGTCCCAGAGG + Intergenic
940052580 2:149479918-149479940 GGCTATGTGGCCAGTGCAGGGGG - Intergenic
943237338 2:185338893-185338915 TGCCATGTGGTCACTGCCAGTGG + Intergenic
945315005 2:208361159-208361181 GGCCTTGTGGCCTGTGCCATAGG + Intronic
945876315 2:215281718-215281740 GGCCATGTGGTAAGGACCAGAGG + Intergenic
946080939 2:217117713-217117735 AGTCATGTGGCCAATCTCAGTGG - Intergenic
946148024 2:217745414-217745436 GGCCATGTGGCAAGGACCTGAGG - Intronic
948237482 2:236401453-236401475 GGCCAAGTGGCCAGGCCCCAGGG - Intronic
948623300 2:239250363-239250385 GGCCACCTGGCCAGAACCAGTGG + Intronic
948835376 2:240623839-240623861 GACCATGTGGCCCTGCCCAGTGG + Intronic
949000091 2:241608200-241608222 GCACATGTGGCCTGGCCCAGTGG + Intronic
1168735934 20:136377-136399 GGTCATATGGCCAGGCGCAGTGG - Intergenic
1168759879 20:342902-342924 GGCAGTGGGGCCAGGCCCAGTGG - Intergenic
1169324324 20:4663039-4663061 GTCCAGGTGGCCAGACGCAGTGG - Intergenic
1169970127 20:11261158-11261180 GGGGATGTGGCCAGTCTGAGAGG + Intergenic
1171306511 20:24111994-24112016 GGCCCTGTGGTATGTCCCAGAGG + Intergenic
1172500464 20:35422589-35422611 GGTCATTTGGCCAGGCTCAGTGG - Intergenic
1173171840 20:40732163-40732185 GGCAATTTGGCCAGTCACAGTGG - Intergenic
1174014712 20:47478514-47478536 GGCCTTGGGTCCAGGCCCAGTGG + Intergenic
1174157928 20:48528643-48528665 GGCCATGTGACCAGAGCAAGGGG + Intergenic
1174337251 20:49871742-49871764 GGCCATCTGGACAATCCCAGAGG - Intronic
1174427401 20:50441908-50441930 GGCCATGTGCCTAGTCCTAGGGG - Intergenic
1174685499 20:52450992-52451014 AGTCATGTGGCCAGGCACAGTGG - Intergenic
1175900590 20:62358461-62358483 AGCCATGTGGCCAGTGCCCCAGG - Intronic
1177635634 21:23783550-23783572 GTCCAACTGGCCAGTCACAGTGG - Intergenic
1179067813 21:38042626-38042648 GGCCAGGAGGCCAATCCCATTGG + Intronic
1180172690 21:46067951-46067973 AGCCCTGTGGCCAGTACAAGGGG + Intergenic
1180663137 22:17486531-17486553 AGCCATGTGGGCTTTCCCAGTGG - Intronic
1180787011 22:18553065-18553087 GGCCATGTGGTCAGGCCAGGCGG - Intergenic
1180814661 22:18781935-18781957 GGACACGTGGCCAGCCACAGTGG + Intergenic
1181200850 22:21216271-21216293 GGACACGTGGCCAGCCACAGTGG + Intronic
1181234729 22:21442241-21442263 GGCCATGTGGTCAGGCCAGGCGG + Intronic
1181243921 22:21492590-21492612 GGCCATGTGGTCAGGCCAAGCGG - Intergenic
1181256225 22:21564495-21564517 GGAAATGTACCCAGTCCCAGTGG - Intronic
1181497748 22:23297366-23297388 GCACATGTGGCCAGGCACAGTGG - Intronic
1181962336 22:26631493-26631515 GACCATGTGGCCAGGAGCAGTGG - Intergenic
1182156142 22:28074810-28074832 GGTCATGAGGCCAGGCGCAGTGG + Intronic
1182218014 22:28735592-28735614 GGCCAGGTGGCCAGGTGCAGTGG + Intronic
1182900611 22:33895245-33895267 GGCCATCTGCCCACTCACAGAGG + Intronic
1183062552 22:35345146-35345168 GGCCAGGTGGGTAGACCCAGAGG - Intronic
1183119407 22:35718768-35718790 GGGCACGTGGCCAGGCACAGCGG + Intronic
1183135041 22:35879015-35879037 GGCCATACGGCCAGGCACAGTGG - Intronic
1183411212 22:37655810-37655832 GGCCATGGGGGCCGACCCAGTGG - Exonic
1183664033 22:39237155-39237177 AGCCCTGTGGCCAGCCTCAGGGG + Intronic
1183847829 22:40557481-40557503 TGCCAGGTGGCCAGGCACAGTGG + Intronic
1184107501 22:42376733-42376755 GGACATGTGGCCTGGCCTAGAGG + Intergenic
1184257493 22:43295501-43295523 CGCCAAGGGACCAGTCCCAGGGG + Intronic
1184417254 22:44359544-44359566 GGCAATGTGCCTAGGCCCAGAGG + Intergenic
1185381789 22:50512071-50512093 TGGCTTGTGGCCAGTCGCAGTGG - Intronic
949338616 3:3004760-3004782 GGCCATTTGGCCAGACACTGGGG - Intronic
949628497 3:5895157-5895179 AGCCATGTGGGCAGGCACAGAGG + Intergenic
949918150 3:8981064-8981086 GGCCATGTGGCCAGTCCCAGAGG + Exonic
949971287 3:9407382-9407404 GGCCATGTGTGGAGTCCCAGGGG + Intronic
950014702 3:9747450-9747472 GGTCTTGGGGCCAGTCTCAGGGG + Exonic
950291363 3:11787084-11787106 CTCCATGTGGCCTCTCCCAGTGG + Intergenic
950469088 3:13173577-13173599 GGCTCTGTGGACAATCCCAGAGG + Intergenic
951181784 3:19667968-19667990 TGCCATATGGCCATTGCCAGAGG - Intergenic
952241251 3:31533051-31533073 GGCCATGAGGCCACTCCACGGGG - Exonic
952812297 3:37415149-37415171 GGTCATGTGGCCACGCACAGTGG - Intronic
953915463 3:46917407-46917429 GTCCATGTGGCAAGACACAGGGG + Intergenic
954940244 3:54365574-54365596 GGCTATCTGGCCGGTCACAGTGG + Intronic
954994062 3:54865767-54865789 GCCCATTTGGCCAGTACCAATGG - Intronic
955054527 3:55443943-55443965 GGCCATGTGCAAAGGCCCAGGGG - Intergenic
955622345 3:60877911-60877933 CTCCATGTGGCCAGGCGCAGTGG - Intronic
955682578 3:61517926-61517948 GTCCATGAGGCCAGACACAGTGG + Intergenic
956817944 3:72925441-72925463 GACGATGTGGCCAGGCGCAGTGG - Intronic
958631310 3:96686631-96686653 CACCATGTGGCCACTGCCAGGGG + Intergenic
961451389 3:127003868-127003890 GGCCCTGTGGGCAGACCCACTGG - Intronic
961695107 3:128698754-128698776 GGCGCTGTGGCCGCTCCCAGGGG - Intergenic
961745703 3:129062301-129062323 GGCCAGGGGGCCAGTCCCTGAGG + Exonic
962270077 3:133971128-133971150 GGCACTGTGGCCAGGCCGAGGGG - Intronic
963807603 3:149740918-149740940 GGCCATCTGGCTAGTTCCAACGG + Exonic
963854246 3:150237815-150237837 GGCTATGTTGCCTCTCCCAGGGG + Intergenic
965099324 3:164276752-164276774 TGCCATGTGGCCACTGCCTGCGG - Intergenic
966590355 3:181675336-181675358 GCACTTGTGGCCAGACCCAGTGG + Intergenic
966761575 3:183423907-183423929 GGCCATGTCGCCGGGCGCAGTGG - Intronic
967949007 3:194825784-194825806 TGCCATGTGGCCAGTCAAGGTGG + Intergenic
968511213 4:996769-996791 TGTCCTGTGGCCAGGCCCAGAGG + Intronic
968738347 4:2312195-2312217 ATCCATGTGGCCAGGCCCAATGG - Intronic
968917321 4:3502245-3502267 GTGCATGTGGCCAGCCCCGGAGG - Intergenic
969511636 4:7621142-7621164 GGCAGTGTGACCAGGCCCAGCGG + Intronic
971793234 4:31195934-31195956 GGCTATGTGGCCTGGCACAGTGG + Intergenic
974374542 4:61059597-61059619 GGCGAGGTGGCCAGGCGCAGTGG - Intergenic
976811857 4:89107484-89107506 GGCCATGTGGCAAGACCTATGGG + Intronic
979286661 4:118933383-118933405 GGGCATCTGGCCAGGGCCAGAGG - Intronic
979314853 4:119249949-119249971 GGACATAAGGCCAGTCGCAGTGG - Intronic
981637747 4:146899716-146899738 AGCCATGTGCCCAGTCTCTGTGG + Intronic
981981857 4:150802734-150802756 GGGCATATGGCCAGACGCAGTGG + Intronic
983604594 4:169570379-169570401 GGCCAGCTGCCCAGTCCGAGAGG + Intronic
983895596 4:173078057-173078079 GTCAATGTGGCCAGACTCAGTGG - Intergenic
984220071 4:176964397-176964419 TGCCATGTTGCCACTGCCAGTGG - Intergenic
984862284 4:184251880-184251902 GGCCATGTTGCCAGGCACATAGG + Intergenic
985591346 5:766993-767015 GGCCATGTTCCCAGTCCCCGTGG - Intergenic
985758541 5:1733294-1733316 GGCCATGGGACCAGTGCCCGAGG - Intergenic
985777510 5:1852497-1852519 GGCCATCTGGCATGTCCCAGAGG + Intergenic
985852519 5:2398920-2398942 GGCCACATGGCCAATCCCACTGG - Intergenic
985958181 5:3280055-3280077 GGCCATGTTGGGAGACCCAGAGG - Intergenic
986181203 5:5394591-5394613 GGCCAGTTGGCCAGGGCCAGTGG + Intergenic
987706920 5:21469917-21469939 GGCCAGTTGGCCAGGGCCAGTGG - Intergenic
988969398 5:36451023-36451045 GGACATGTGGCTAGTCCCAGTGG + Intergenic
990150943 5:52816662-52816684 GACCATGTGGCCATATCCAGAGG + Intronic
990810352 5:59715680-59715702 GGCCATGTGGCAAGACCTATGGG + Intronic
991209258 5:64085260-64085282 TGCAATGTAGCCAGTGCCAGGGG + Intergenic
991616613 5:68503327-68503349 AGCTATGTGGCCAGAGCCAGGGG + Intergenic
991928177 5:71725557-71725579 TGCCATGAGGCCAGGCGCAGTGG - Intergenic
992102141 5:73418350-73418372 CTCCATGTGGCGGGTCCCAGGGG - Intergenic
993605796 5:89989448-89989470 GGCCAAGAGGCCATTCTCAGAGG - Intergenic
993868388 5:93221394-93221416 GGCCCTGTGGCCAGGTGCAGTGG + Intergenic
996738621 5:126778575-126778597 GGAAATGTGTCCTGTCCCAGCGG + Intronic
996954268 5:129164369-129164391 GGCCAAGGGGGCTGTCCCAGTGG + Intergenic
997354632 5:133254454-133254476 GGCCGTGTGGCCACCTCCAGGGG + Intronic
997364162 5:133314873-133314895 CACCATGTGGCCAGGCACAGTGG + Intronic
997388727 5:133496454-133496476 GGCCATGTGGCCAGGTTTAGTGG - Intronic
997399520 5:133591572-133591594 GGCCAGGAGGCAGGTCCCAGTGG - Intronic
998017730 5:138745914-138745936 GTCCAAGTGGCCAGGCACAGTGG - Intronic
999248869 5:150169736-150169758 GACCTGGTGGCCAGTGCCAGTGG - Intronic
999756509 5:154668588-154668610 GGCCCAGTGGCCAGTTGCAGTGG - Intergenic
1000940706 5:167356590-167356612 GGCCATTTGGCCATTATCAGAGG - Intronic
1001586729 5:172837937-172837959 AGCCCTGTGCCCAGGCCCAGTGG + Intronic
1001594893 5:172891922-172891944 GGGCCTGTGGCCAGCCCCTGAGG + Intronic
1001685172 5:173589070-173589092 GGGGATGTGGCCAGGCGCAGTGG + Intergenic
1002208001 5:177577445-177577467 GTACATGTGGCCAGGCGCAGTGG - Intergenic
1002777905 6:344135-344157 GGCCTTGTGCCAAGTCCCTGAGG - Intronic
1004259689 6:14097251-14097273 GGCCATGGGGCCTGGCCTAGGGG - Intergenic
1004564204 6:16780351-16780373 GGCCAGGTGGCCGGGCGCAGTGG - Intergenic
1006023290 6:31130686-31130708 GGCCAGGTTGCCAGGCGCAGTGG - Intronic
1006398604 6:33802757-33802779 GGCCTTGTGTGCAGCCCCAGAGG + Intronic
1006813136 6:36833575-36833597 GGCCATGTGGCAAGGGCCTGGGG + Intronic
1007496019 6:42260804-42260826 GGCCATGTGACCTGCCCCATGGG + Intronic
1009021304 6:57950582-57950604 GGCCAGTTGGCCAGGGCCAGGGG + Intergenic
1009392488 6:63161200-63161222 GGCAGTGTGTCCAGTGCCAGGGG - Intergenic
1010382948 6:75245202-75245224 AGCCATGAGGCCAGGCGCAGTGG + Intronic
1012518639 6:100093365-100093387 GGCCATGTTGCAGGTTCCAGTGG + Intergenic
1012593423 6:101011337-101011359 GGAAATGTGGGCAGTCTCAGTGG + Intergenic
1013282161 6:108648705-108648727 GGCAAAGTGGCCAGGCACAGTGG + Intronic
1013446958 6:110239311-110239333 GGCCATGTCTACAGCCCCAGTGG - Intronic
1013603401 6:111726034-111726056 GGCTATGTGGCCAGACACATGGG + Intronic
1014840913 6:126219053-126219075 TGCCATGTGGCCGCTGCCAGGGG + Intergenic
1016892896 6:149024086-149024108 GGCCACTTGGCCAGTCCACGTGG + Intronic
1018356832 6:163026809-163026831 GGCCATGTGCCCAGGCACAGAGG + Intronic
1018430059 6:163714988-163715010 TGCCATGTGGACAGGCCCAGCGG + Intergenic
1018572244 6:165223954-165223976 GGCCATATGGCCAGAGCCTGTGG - Intergenic
1019794277 7:3038354-3038376 AGGAATGAGGCCAGTCCCAGGGG + Intronic
1019998109 7:4738147-4738169 GGTGATGTGGCCAGTCACGGTGG + Intronic
1020175770 7:5881029-5881051 GGCCAGGCGGCCAGACGCAGTGG + Intronic
1020344952 7:7152536-7152558 GGCCAGGTGGCCAGGCGCGGTGG - Intergenic
1020394295 7:7696449-7696471 GGTCTTGTGGCCAGTTCCAGTGG - Intronic
1021512253 7:21446996-21447018 GGACATGTGGCTAGTCACAAGGG - Intronic
1022175407 7:27867854-27867876 GGCATTGTGGCCAGTTTCAGAGG + Intronic
1022539295 7:31121359-31121381 AACCCTGGGGCCAGTCCCAGTGG - Intergenic
1024683381 7:51717873-51717895 GGCCATCTGGCCAGTTTGAGTGG + Intergenic
1025739080 7:64182151-64182173 GCCCCTCTGGCCTGTCCCAGCGG + Intronic
1026129210 7:67606473-67606495 GGTCCTGTGGCCAGGCCCGGGGG + Intergenic
1026172262 7:67964256-67964278 GGACATGTGGCCAGGCACGGTGG - Intergenic
1027755330 7:82204368-82204390 GGCCATGTGGCAAGACCTAGGGG + Intronic
1029083055 7:97989943-97989965 GGCCAGGCGGCCAGACGCAGTGG - Intronic
1029549484 7:101230070-101230092 GGGCATCTGGCCAGGCGCAGCGG + Intergenic
1031162060 7:118180239-118180261 GGTGATGAGGCCAGACCCAGTGG - Intergenic
1033019904 7:137713925-137713947 GGGCAAGTGGCCAGGCACAGTGG - Intronic
1033533106 7:142285993-142286015 GCCCAAGTGGGCATTCCCAGTGG - Intergenic
1033542484 7:142369655-142369677 AGCCATATGGCCACTGCCAGGGG + Intergenic
1033929651 7:146506602-146506624 GGCCATGTGGCCAGACCTATGGG - Intronic
1034126273 7:148674775-148674797 TGCCCTGTGGCCACTGCCAGGGG - Intergenic
1034398006 7:150842039-150842061 TGCCATGTAGCCACTGCCAGGGG - Intronic
1035297317 7:157874433-157874455 GGCCATGTGGACAGAAGCAGAGG - Intronic
1035663683 8:1364941-1364963 GGCCCTGTGCCCAGTCTCTGAGG - Intergenic
1036275071 8:7343592-7343614 GGCCATGAGGCAAGGCCTAGAGG - Intergenic
1036346283 8:7966756-7966778 GGCCATGAGGCAAGGCCTAGAGG + Intergenic
1036790087 8:11711488-11711510 GTGCATGTGGCCAGGCGCAGAGG + Intronic
1036841606 8:12127514-12127536 GGCCATGAGGCAAGGCCTAGAGG + Intergenic
1036863413 8:12373761-12373783 GGCCATGAGGCAAGGCCTAGTGG + Intergenic
1037271468 8:17135111-17135133 GGACATTTGGCCAGGCGCAGTGG + Intergenic
1037926607 8:22848384-22848406 GGCGATGTGGGCTGTGCCAGGGG + Intronic
1038803749 8:30772056-30772078 GGCCCTGTGGCCCCACCCAGAGG - Intergenic
1038870686 8:31489952-31489974 GGCCAGGTGGCCACTCTGAGAGG - Intergenic
1038993299 8:32893334-32893356 GGCCATGTGGCTAGTTTTAGTGG + Intergenic
1041245781 8:55887165-55887187 GGCCAGGCGGCCAGGCGCAGTGG + Intronic
1042318282 8:67448070-67448092 GGCCAATTGGCCAGGCACAGTGG - Intronic
1044129033 8:88497317-88497339 AGCCATGTGTCAATTCCCAGAGG - Intergenic
1047006486 8:120625249-120625271 CACCATGTGGCCAGGCACAGGGG + Intronic
1048339124 8:133525465-133525487 GGCCAGGCTGCCAGTTCCAGGGG - Intronic
1049842695 8:144783875-144783897 GGCAGTGTGGCCAGGCGCAGTGG + Intronic
1050361614 9:4836185-4836207 GGCCATGTGGCTATATCCAGTGG + Intronic
1052549248 9:29927043-29927065 GGACATGTTGCCAGTTCCAAAGG + Intergenic
1053008114 9:34617660-34617682 GGCCATGGTGCCAGCCACAGTGG - Intronic
1056989691 9:91399322-91399344 GGCAATGTGGCCAGACACAGTGG + Intergenic
1057150406 9:92791539-92791561 GGCCATGTGACCAGGCAGAGGGG + Intergenic
1058314970 9:103554140-103554162 GGCCATGTGGGCTGACCCACTGG - Intergenic
1058617468 9:106847015-106847037 AGCAATGTGCCCATTCCCAGAGG + Intergenic
1059967290 9:119627725-119627747 GGCCATGTGCACAGTCCTAGGGG - Intergenic
1060049915 9:120371307-120371329 TGCCAGGTGGCCAGTCCCAAGGG + Intergenic
1060667462 9:125440522-125440544 GGCCATGTGTCCTGTGCCAGAGG + Intronic
1060941047 9:127543010-127543032 GGCCTTGGGGCCAGGCACAGTGG - Intronic
1061031475 9:128086618-128086640 AGCCAAGTGGCCAGGCACAGTGG - Intronic
1061124884 9:128668328-128668350 GGCGTTGTGGCCAGACGCAGTGG - Intergenic
1061537545 9:131259234-131259256 GGCCTTGTGGCCACTTGCAGGGG - Exonic
1061858671 9:133456789-133456811 GGGGATGGGGCCAGTCCCAGTGG + Intronic
1061875349 9:133540821-133540843 GGCGCTGTGGCCAGGCCCCGGGG - Intronic
1061951719 9:133939997-133940019 GGCCATCTGCCCAGTCCTCGTGG + Intronic
1062293088 9:135806241-135806263 GGCCAGCTGGACAGTCCCTGTGG - Intergenic
1062405563 9:136394647-136394669 AGTCAAGGGGCCAGTCCCAGTGG + Intronic
1186715271 X:12244783-12244805 GGCAAGGTGGACAGTTCCAGTGG + Intronic
1187481432 X:19659400-19659422 GGGCATGTGGCCGGGCACAGTGG - Intronic
1188421238 X:29992568-29992590 TGCCATGAGGCCACTGCCAGGGG + Intergenic
1193246929 X:79239833-79239855 TGTCATGTGGCCACTGCCAGGGG + Intergenic
1197082743 X:122439483-122439505 CAGCATGTGGGCAGTCCCAGTGG + Intergenic
1199982137 X:152927004-152927026 GGCAATGTGGGCAGACACAGAGG - Intronic