ID: 949920107

View in Genome Browser
Species Human (GRCh38)
Location 3:8993627-8993649
Sequence CAGAGGAATGCCATAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949920107_949920114 8 Left 949920107 3:8993627-8993649 CCCTCCACTATGGCATTCCTCTG 0: 1
1: 0
2: 0
3: 14
4: 194
Right 949920114 3:8993658-8993680 CTTGGCCCTGGCCTTTTCTCTGG 0: 1
1: 0
2: 2
3: 34
4: 383
949920107_949920113 -4 Left 949920107 3:8993627-8993649 CCCTCCACTATGGCATTCCTCTG 0: 1
1: 0
2: 0
3: 14
4: 194
Right 949920113 3:8993646-8993668 TCTGGCAGTCTGCTTGGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 233
949920107_949920111 -10 Left 949920107 3:8993627-8993649 CCCTCCACTATGGCATTCCTCTG 0: 1
1: 0
2: 0
3: 14
4: 194
Right 949920111 3:8993640-8993662 CATTCCTCTGGCAGTCTGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949920107 Original CRISPR CAGAGGAATGCCATAGTGGA GGG (reversed) Intronic
900012166 1:124164-124186 CAGAGGATTGCCAAAGAGAATGG - Intergenic
900042226 1:480154-480176 CAGAGGATTGCCAAAGAGAATGG - Intergenic
900063666 1:715150-715172 CAGAGGATTGCCAAAGAGAATGG - Intergenic
904251999 1:29231533-29231555 TAGAGGAATGCTATTGTGGGTGG + Intergenic
904385433 1:30138913-30138935 CAGAGGGTTGCCACAGTGGCTGG + Intergenic
905607563 1:39316588-39316610 CAGAGAAATGCAATTTTGGATGG + Intronic
905628013 1:39501189-39501211 CAGACTAATGCCATGGAGGAGGG - Intronic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
913094803 1:115506282-115506304 CAGAGGAATGACAGAGGAGAAGG - Intergenic
915955158 1:160214700-160214722 GAGGGGAATGCCACAGTGAAGGG + Exonic
917088842 1:171331528-171331550 CAAAGGACTGCCATAGTTGTGGG + Intronic
917261987 1:173179761-173179783 AAGAGGAATGGGAGAGTGGAAGG + Intergenic
918291306 1:183110798-183110820 CAGAGGAAAGTCATAGATGAGGG + Intronic
920078413 1:203353936-203353958 CAGAGGATTGGCAAAGTGGAGGG + Intergenic
921036958 1:211389087-211389109 CAGAAAAATGGCATAGTGGTTGG - Intergenic
922260594 1:223940640-223940662 CAGAGGATTGCCAAAGAGAATGG - Intergenic
922736478 1:227985090-227985112 CAGAGGATTGCCAAAGAGAATGG + Intergenic
924341770 1:243042834-243042856 CAGAGGATTGCCAAAGAGAATGG - Intergenic
1066734709 10:38462713-38462735 CAGAGGATTGCCAAAGAGAATGG + Intergenic
1075260295 10:120957758-120957780 CAGAAGTCTGCCATATTGGATGG + Intergenic
1076076846 10:127540168-127540190 CAGAGGATTCCCACAGTGCAGGG - Intergenic
1076814070 10:132906007-132906029 CAGAGGGATGCCAAAGAGGGGGG + Intronic
1076968497 11:116370-116392 CAGAGGATTGCCAAAGAGAATGG - Intergenic
1078417642 11:11178809-11178831 CAGAGGAACACCATGGTGAAAGG + Intergenic
1078447710 11:11416974-11416996 CAGAGGAGTCACATAGAGGAAGG - Intronic
1078811030 11:14763449-14763471 CAGAGAAATGAGATAGTGGCCGG + Intronic
1078828486 11:14954754-14954776 CAGAGAAATGCCACATTGAAAGG + Intronic
1078967081 11:16358271-16358293 CAGGAGAATGGCAGAGTGGAAGG - Intronic
1082207487 11:49455559-49455581 AAGAGGAATCCTGTAGTGGAAGG - Intergenic
1084901712 11:72314833-72314855 CAGAGGCAGGCCATTGTGGCTGG + Intronic
1084963829 11:72733106-72733128 CAGAGGAAGGCCTTCCTGGAGGG + Intronic
1085697709 11:78719704-78719726 CAGGTGAATGCCATAGTGACAGG + Intronic
1086647789 11:89246198-89246220 AAGAGGAATCCTGTAGTGGAAGG + Intronic
1088498352 11:110455705-110455727 CAGTGGAAGGACCTAGTGGAAGG + Intronic
1090694642 11:129226532-129226554 GAAAAGAATGCCATAATGGAGGG - Intronic
1090899336 11:131013559-131013581 CAGAGGAATGACATGGTGGTGGG + Intergenic
1091323963 11:134670420-134670442 CAGTGGAATCCCGTGGTGGAAGG - Intergenic
1095935068 12:47670677-47670699 CACAGGAATGGCAAAGTTGAAGG + Intronic
1097968174 12:65603509-65603531 CTTAGGAAAGCCATAGTGCATGG - Intergenic
1098267659 12:68738693-68738715 CAGAGGAATGGCAGAGAGAATGG + Intronic
1101605561 12:106246052-106246074 TTGAGCAATGACATAGTGGAGGG + Intronic
1103004386 12:117409488-117409510 CAGAGGAATGAATGAGTGGAAGG + Intronic
1104441336 12:128795816-128795838 CAGAGGGACGCCATGGTGGCAGG - Intronic
1107776616 13:43850543-43850565 CAGTGGAATTCAAGAGTGGATGG + Intronic
1108198361 13:48017910-48017932 TAGAGGAATTCCATATTGGGTGG + Intergenic
1108557639 13:51610853-51610875 CAGATGAATGCCAAAGAGGAAGG - Intronic
1112421913 13:99260064-99260086 GTGAGGAATGCCACAGTGGGTGG - Intronic
1113718605 13:112534013-112534035 CAGAGGATTGCGAGTGTGGAAGG + Intronic
1114427204 14:22633919-22633941 CTGAGGAATGACACAGTGCAGGG - Exonic
1119668517 14:76501041-76501063 GAGAGGACTGACTTAGTGGAAGG + Exonic
1127064432 15:55222275-55222297 CAGAGTAAGCCTATAGTGGATGG + Intronic
1137348552 16:47688747-47688769 CAGAATAATACCACAGTGGATGG + Intronic
1138696169 16:58815506-58815528 CAGAGGAATGTGATAGTGACTGG - Intergenic
1142452180 16:90182750-90182772 CAGAGGATTGCCAAAGAGAATGG + Intergenic
1143445455 17:7006517-7006539 CAAAGGGATGACATAGTGAAGGG + Exonic
1145834383 17:27943216-27943238 CTGAGGGCTGCCATAGTGGGAGG - Intergenic
1148249624 17:46064835-46064857 GAGAGAAATGCAATAGAGGAGGG - Intronic
1148911461 17:50945122-50945144 CAGCTGAAGGCCATAGGGGAAGG + Intergenic
1149165997 17:53752803-53752825 CAGCAGAATGCCACACTGGAAGG + Intergenic
1149393746 17:56218231-56218253 CAGAGGAGTAACATAGGGGAGGG - Intronic
1149696573 17:58621029-58621051 CAGAGGAAAGCCAAATGGGAAGG + Intronic
1151892720 17:76960200-76960222 CAGAGGAATGAGATACAGGAAGG - Intergenic
1156130060 18:33961832-33961854 CAGTGGATTGCCAAAGTAGAAGG + Intronic
1157444605 18:47735259-47735281 CAGAGGGGTGCCATGCTGGATGG - Intergenic
1159793310 18:72811392-72811414 CAGAAGAAAGCCATAGCTGATGG - Intronic
1160645306 19:186295-186317 CAGAGGATTGCCAAAGAGAATGG - Intergenic
1163145634 19:15377874-15377896 CAGACAGATGCCATAGTGGGCGG - Intronic
1164759582 19:30718995-30719017 CAGAGGGATGACAAAGTTGAGGG + Intergenic
1165153136 19:33772465-33772487 GAGAGCGCTGCCATAGTGGACGG - Exonic
1165448156 19:35868212-35868234 CAGAGGAATGTACTAGGGGATGG + Intronic
1165759064 19:38310028-38310050 CAGATGAATGCATCAGTGGATGG - Intronic
1168138665 19:54369517-54369539 TAGAGGAATGCAAAGGTGGAGGG - Intronic
1168159411 19:54499266-54499288 TAGAGGAATGCAAAGGTGGAGGG + Intronic
927029121 2:19102311-19102333 CAGAGGAAGGCCACAGCAGAGGG + Intergenic
928083862 2:28333475-28333497 CACAGGCATGGCATGGTGGAGGG - Intronic
928454634 2:31408224-31408246 AAGAGGAATGGCATAGTCAAAGG - Intronic
929273501 2:40000189-40000211 CACAGGGATGCCACAGGGGAAGG - Intergenic
930265561 2:49195192-49195214 GAAAGGAAAGCCATATTGGAAGG + Intergenic
930979837 2:57510434-57510456 CAGAGGAAAGCCAAAGTTGCTGG + Intergenic
933383747 2:81583780-81583802 CAGAGGAAGGCCAGAGGTGAAGG + Intergenic
936563807 2:113566824-113566846 CAGAGGATTGCCAAAGAGAATGG + Intergenic
937798468 2:126053190-126053212 CATAAGAATGGCATAATGGATGG - Intergenic
937887299 2:126908702-126908724 CAGTGGCATGCCACAGGGGAGGG + Intergenic
938089944 2:128424869-128424891 CAGAGGAAGTTGATAGTGGAAGG + Intergenic
942967636 2:181916099-181916121 TGGAGGAATGCCATCATGGAAGG + Exonic
946571165 2:221025755-221025777 CAGAGGAGGGACATAGTGGGAGG - Intergenic
946573983 2:221054223-221054245 CAGAGGAAAGCAATATTTGAAGG - Intergenic
946879097 2:224159762-224159784 CACAGGGATGCCATAGTACATGG + Intergenic
949083622 2:242127393-242127415 CAGAGGATTGCCAAAGAGAATGG + Intergenic
1169604904 20:7306397-7306419 CACAGGAATGTCATAGGGCACGG + Intergenic
1172615566 20:36281302-36281324 CAGATGAATGGGAGAGTGGATGG - Intergenic
1172912298 20:38418979-38419001 CAGATGTCTGCCACAGTGGAGGG - Intergenic
1173224043 20:41151548-41151570 CAAAGGAAGGTCAAAGTGGAGGG - Intronic
1173501358 20:43556445-43556467 CTGAGGAATGTCAAAGTGAAGGG + Intronic
1173646008 20:44633597-44633619 GAGAGGAAGGCCAGAGTAGATGG + Intronic
1173755605 20:45512944-45512966 CAGAGCACAGCCATTGTGGATGG - Intronic
1173951079 20:46993753-46993775 ATGAGGAATGCAAGAGTGGAGGG + Intronic
1175119593 20:56707847-56707869 CTGAGGAATGCCAGGATGGATGG - Intergenic
1176280204 20:64299926-64299948 CAGAGGATTGCCAAAGAGAATGG + Intergenic
1178221109 21:30661194-30661216 CAGAGGAGTGGCCTAGTGGGAGG - Intergenic
1182060143 22:27391478-27391500 CAGAGGCATGACAGAGTTGAAGG + Intergenic
1182811194 22:33118237-33118259 GAGTGGAAGGCCAGAGTGGAAGG + Intergenic
1183387447 22:37523182-37523204 CAGAGGATTGACAGAGAGGATGG + Intergenic
949920107 3:8993627-8993649 CAGAGGAATGCCATAGTGGAGGG - Intronic
950421714 3:12903457-12903479 CAGAGGAATCCCAAGCTGGAAGG - Intronic
951220636 3:20065478-20065500 GAGATGAAGGCCAAAGTGGAGGG + Intronic
952407347 3:33016216-33016238 CAGAGGAAAAGCATGGTGGAGGG + Intronic
955103035 3:55870515-55870537 CAGAAGAATCCCACAGGGGAGGG + Intronic
955406450 3:58628691-58628713 CAGAGGAATGGCAGAGGAGACGG - Intergenic
957029178 3:75220648-75220670 CAGAGAAATGTCATGGTTGAGGG + Intergenic
957559525 3:81803995-81804017 GAAAGGAATGCTATAGTGGAAGG - Intergenic
960121395 3:113951287-113951309 CAGAGGACTGCCACAGGGGTGGG - Intronic
962290690 3:134134190-134134212 CAGAGGGATACCATAGGGGATGG - Intronic
963213028 3:142715352-142715374 CAGAGGACTCCCATAGGGGCTGG - Intergenic
965469323 3:169071264-169071286 CAGAGGAATGCAAGGGTTGAGGG - Intergenic
965530626 3:169767042-169767064 CAGAGGTATGCCATCATGGAAGG - Exonic
965938785 3:174149337-174149359 CAAAGGAATGCCATGGAGGGAGG - Intronic
966144339 3:176792700-176792722 CAGAGGAAGACCATAGATGATGG - Intergenic
968372377 3:198233231-198233253 CAGAGGATTGCCAAAGAGAATGG + Intergenic
969478795 4:7436014-7436036 ATGAGGAATGCAATAGTGCAGGG + Intronic
969853019 4:9977040-9977062 CAGAGTAATGGCAGTGTGGATGG - Intronic
970871428 4:20821018-20821040 CAGAGAACTGCCACAGTGGTGGG + Intronic
971520677 4:27546689-27546711 CAGAGAACTGCCACAGTGGTGGG - Intergenic
972226751 4:37022079-37022101 GAGAGCAAAGCCATAGTGAAAGG + Intergenic
973631571 4:52825235-52825257 GAGTGGAATGCCACAGGGGAAGG + Intergenic
975728484 4:77315535-77315557 CAGGTGACTGCCATAGTGGATGG - Intronic
978413893 4:108455386-108455408 CAGAAGAATGTCATGGAGGAGGG - Intergenic
978624817 4:110672981-110673003 CATAGTAATGCCATAGCAGAAGG + Intergenic
979134643 4:117094750-117094772 AAGAGGACTGCCATTGTGTATGG - Intergenic
979261064 4:118645690-118645712 CAGAGGATTGCCAAAGAGAATGG + Intergenic
980995780 4:139778458-139778480 CAGAGGGCAGCCACAGTGGAAGG + Intronic
981793606 4:148568945-148568967 CAGAGGGAAGCCATTATGGAAGG + Intergenic
982065130 4:151648049-151648071 CAGATAAATGCCCTAATGGATGG + Intronic
983515164 4:168648018-168648040 CAGAGAACTACCTTAGTGGACGG - Intronic
983651511 4:170040848-170040870 CAGAGGAGAGCCACAGTGGGTGG - Intergenic
983889498 4:173016163-173016185 CAGAGGTGTGCTATAGTGGTGGG + Intronic
983954921 4:173686330-173686352 CAGAGGAATGTCCTGGTGGATGG - Intergenic
985389167 4:189477128-189477150 CACAGGAATGCCAGAGTCCATGG + Intergenic
988967314 5:36432331-36432353 CAGAGGATTGGGATAGTGGGAGG + Intergenic
991034318 5:62112851-62112873 CTGAGGAATGCCAGTGTGGGTGG - Intergenic
992304175 5:75418829-75418851 GAGAGGAATGACAAAGGGGATGG + Intronic
992564003 5:77980201-77980223 CAGAGGGATGCCAAAGAGGGAGG + Intergenic
993820916 5:92615546-92615568 AAGAAGAAAGACATAGTGGAGGG + Intergenic
994385206 5:99122815-99122837 CAAATGAATGCCATACTGTATGG + Intergenic
996116579 5:119626920-119626942 CAGAGGAAAGCCAGAGGGGGAGG + Intronic
996384656 5:122898508-122898530 CAGAGTGCTGCCATAGTGGCTGG - Intronic
996742487 5:126813751-126813773 GAGAGGAAAGCCCTAGTGAATGG - Intronic
997710702 5:136001635-136001657 CAGAGAAAAGCCACAGAGGAAGG - Intergenic
997866923 5:137472058-137472080 CAGATGAATTTCTTAGTGGAGGG - Intronic
998592355 5:143490767-143490789 CAGAGGAATGGGGTAGAGGATGG - Intergenic
999039041 5:148386212-148386234 CAGAGCAATGCCCTAGTGCTTGG - Intronic
1001665425 5:173429788-173429810 CAGAGGAAAGGCATTTTGGATGG + Intergenic
1002731617 5:181338775-181338797 CAGAGGATTGCCAAAGAGAATGG + Intergenic
1002752916 6:135319-135341 CAGAGGATTGCCAAAGAGAATGG - Intergenic
1004133506 6:12944417-12944439 CAGAGGTATGTAATTGTGGATGG - Intronic
1005440110 6:25858222-25858244 CAGAGAAATGTCAAAGTGCATGG - Intronic
1007151673 6:39699246-39699268 GTGAGGAATGCCATGGTGGTTGG + Intronic
1007449498 6:41932234-41932256 CTGGGGAATACCATAGTGTAAGG + Intronic
1007738153 6:43994620-43994642 TACAGGAATGCCATAGTGTGGGG - Intergenic
1010072426 6:71759738-71759760 CAGAGGAATAGCATAGTACATGG - Intergenic
1010163037 6:72881130-72881152 CTTAGGAAAGCCATAGAGGAAGG + Intronic
1010347129 6:74824899-74824921 CAGGGGCATTCCAAAGTGGATGG + Intergenic
1018653471 6:166010333-166010355 CAGAGGAATGCCAGGATGGCTGG - Intergenic
1019662919 7:2235215-2235237 CAGAGGAATTCCAGAATGTAAGG - Exonic
1022635772 7:32133402-32133424 CTGAGGGATGTCATAGTGGTAGG + Intronic
1023179896 7:37471056-37471078 CAGTGGAAAGCCATAGGTGAAGG + Intergenic
1023354102 7:39349977-39349999 CAGATGAATGCAGCAGTGGAGGG + Intronic
1023362478 7:39430863-39430885 CTGGGGAAGGCCAGAGTGGATGG + Intronic
1024760736 7:52593838-52593860 CAGAGAAATGCCATAAGGGAAGG + Intergenic
1025299678 7:57808615-57808637 CAGAGGAATGTCGTAGTAAAGGG + Intergenic
1028060804 7:86312518-86312540 CAGAGGAGTGCCATGATGTAAGG - Intergenic
1030626783 7:111853624-111853646 CAGAGGAAAGCAACAGTGGAGGG + Intronic
1032474980 7:132205432-132205454 CAGATGACTGCCCCAGTGGAGGG + Intronic
1032545603 7:132739105-132739127 CAGAGGGATGGCAGTGTGGAGGG + Intergenic
1032653525 7:133904105-133904127 CAGAGAAATGGCATAGTGGCTGG + Intronic
1035082835 7:156232166-156232188 CAGAGAAATGCCACAGGGGCAGG + Intergenic
1035511898 8:195504-195526 CAGAGGATTGCCAAAGAGAATGG - Intronic
1036697434 8:10986599-10986621 CAGTAGAATGTCATAGTTGAGGG + Intronic
1039333805 8:36567923-36567945 CAGAGGAAGGCCAGAGGAGATGG + Intergenic
1040364983 8:46706003-46706025 CTGGGGAATTCCATTGTGGAAGG + Intergenic
1041271116 8:56110605-56110627 CACAGAAATGCCATATTGGAAGG - Intergenic
1042064523 8:64859172-64859194 CAGAGGAAAGTCAGACTGGAAGG - Intergenic
1043323475 8:79020100-79020122 CAGAGGAATTCAATAGAGAAAGG + Intergenic
1045820104 8:106326778-106326800 CAGAGGAAAGCAATAGGGAATGG + Intronic
1047166298 8:122442705-122442727 CAAAGGAATGACATATTGGATGG + Intergenic
1049731936 8:144182778-144182800 CAAAGGCATGCCCTAGTGGCCGG + Intronic
1052177600 9:25482865-25482887 CAGAGGAAGGCCACAGTGATTGG + Intergenic
1052627131 9:30990390-30990412 AACAGGAAAGCCATAGTTGAAGG + Intergenic
1053566832 9:39261448-39261470 CAGATGCATGCCATTGTTGATGG - Intronic
1053754145 9:41286091-41286113 CAGTGGCATGCGATTGTGGATGG - Intergenic
1054130311 9:61357559-61357581 CAGATGCATGCCATTGTTGATGG + Intergenic
1057572695 9:96216432-96216454 CAGAGGAATGGGACAGGGGATGG + Intergenic
1058635903 9:107038474-107038496 CAGGGGAATTACATAGTAGATGG - Intergenic
1060607950 9:124934448-124934470 CAGAGGAATGCAGGAGTGAAAGG + Intronic
1062172334 9:135141965-135141987 GAGAAGAATGCCACAGGGGATGG - Intergenic
1062756023 9:138291285-138291307 CAGAGGATTGCCAAAGAGAATGG + Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1187528767 X:20077678-20077700 CAGAGGCCCTCCATAGTGGAAGG - Intronic
1187921096 X:24202650-24202672 CTGGGGAATGCCACAGTTGAAGG - Intronic
1188885827 X:35547554-35547576 CAGAGGCATTGCATAGTGGAGGG - Intergenic
1189365375 X:40383976-40383998 CAGAGAAGTGCCACATTGGAGGG + Intergenic
1190080124 X:47350161-47350183 CAGAGGAAGGACCTAGTGGGAGG + Intergenic
1190105662 X:47559457-47559479 CAGAGGAAGGTCATAGGTGAGGG - Intergenic
1196058650 X:111384198-111384220 CAGAGGAAGGCAATAGTCCAAGG - Intronic
1196139724 X:112247713-112247735 AAGTGGCATGGCATAGTGGAAGG - Intergenic
1197883465 X:131193284-131193306 CAGAGGACTGCCCTAAGGGATGG - Intergenic
1198756252 X:139985697-139985719 CAGACAAAAGCCATAGAGGAAGG + Intergenic
1199116654 X:144000294-144000316 CAGAGGATTGCCATAGGCAAGGG - Intergenic
1201434282 Y:13939906-13939928 CACAGGAATACCAGAGTGGGAGG - Intergenic