ID: 949921097

View in Genome Browser
Species Human (GRCh38)
Location 3:9001277-9001299
Sequence TGATGAATATACTGCTTACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949921096_949921097 4 Left 949921096 3:9001250-9001272 CCACAAAGAAACAATATATTTAC 0: 1
1: 0
2: 2
3: 61
4: 585
Right 949921097 3:9001277-9001299 TGATGAATATACTGCTTACCCGG 0: 1
1: 1
2: 0
3: 20
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949921097 Original CRISPR TGATGAATATACTGCTTACC CGG Intronic
905323750 1:37135622-37135644 TAATGAATATGCTAATTACCCGG - Intergenic
908899329 1:68938073-68938095 TGATCAATGTTCTGCTTGCCTGG + Intergenic
909329693 1:74396528-74396550 TCATGAATATTCTGTTTACTGGG + Intronic
911150239 1:94591341-94591363 TGACGGATAGACTGGTTACCAGG + Intergenic
918025838 1:180745099-180745121 CTATGAATATACTGCTGTCCAGG - Intronic
919543056 1:198875355-198875377 TAATAAATAAAATGCTTACCTGG + Intergenic
920009396 1:202856915-202856937 TGTTGAACATACAGATTACCAGG + Intergenic
920875342 1:209829180-209829202 TGATGAATATGCTAATTACCCGG - Intronic
1063804452 10:9622725-9622747 TGATGAATATAAAGCTTATGGGG - Intergenic
1065934713 10:30511057-30511079 TGATGAATTCCCTGCTTATCTGG - Intergenic
1066177105 10:32919630-32919652 TGTTGAATATACTTCTTTCATGG + Intronic
1068410890 10:56652961-56652983 TGAAGAATATACTGATTTCTGGG - Intergenic
1070060139 10:72974031-72974053 TGATGGATATGCTAATTACCTGG - Intergenic
1073920858 10:108457142-108457164 CTATGTATTTACTGCTTACCAGG + Intergenic
1087165281 11:94997465-94997487 TGATAAATATATTGCTTACATGG + Exonic
1090554965 11:127864390-127864412 TGATGAAAACTCTGCTTCCCAGG + Intergenic
1091925813 12:4347589-4347611 GGATGGATACCCTGCTTACCAGG + Intronic
1096608953 12:52788603-52788625 GGATGGAAATACTGCTTCCCTGG + Intergenic
1097595781 12:61627808-61627830 TGATGAACATACTAAATACCTGG + Intergenic
1100089076 12:90948015-90948037 TGAAGAATATACTGCTTGAAAGG - Intronic
1105812165 13:24005396-24005418 TCAGGAATATAGTGCTCACCTGG + Intronic
1108353952 13:49613461-49613483 TGATGGATATATTTATTACCTGG - Intergenic
1114421676 14:22589044-22589066 TGCTGTATATACTGCTGACCGGG - Exonic
1115073029 14:29349282-29349304 TTTTGAATACACTGCTTAGCAGG - Intergenic
1117725675 14:58670904-58670926 TGATGAGTATTATGCTAACCTGG + Intergenic
1117878003 14:60276056-60276078 TAAGCAATATACTGCATACCTGG - Intronic
1120675915 14:87421069-87421091 TGATGAATATGCCAATTACCAGG + Intergenic
1120756925 14:88253409-88253431 TGATGAATATGCTAATTTCCCGG + Intronic
1121464771 14:94108606-94108628 TTCTGAATATACTGCCTCCCCGG + Intronic
1124145954 15:27125518-27125540 TGATGGTTATGCTACTTACCAGG + Intronic
1124832505 15:33162671-33162693 TGCTGAACATACTGCTTCCCTGG - Intronic
1125571837 15:40726172-40726194 TGTTAAATATACAGATTACCAGG + Intronic
1126482285 15:49138877-49138899 TGAGGACTATACTGCTTACAAGG + Intronic
1127821745 15:62664257-62664279 TGAAGTATATACTGCTATCCTGG - Intronic
1128255548 15:66193815-66193837 TTATAAATATATTGCTTTCCTGG + Intronic
1129526725 15:76222408-76222430 TGGTGAATATATTCCTTACTGGG - Intronic
1131383354 15:91982453-91982475 AGTTGAAAATACTGCTTAACTGG - Intronic
1133619807 16:7515523-7515545 TGATGGATATGCTAATTACCTGG + Intronic
1135098334 16:19583477-19583499 TGATGAATATGCTAATTACTTGG - Intronic
1138145370 16:54604382-54604404 ATGTGAAGATACTGCTTACCTGG - Intergenic
1141332846 16:83127790-83127812 TGATAAATATAATGATTACCAGG - Intronic
1141351053 16:83297269-83297291 TGATGGATATGCTAATTACCTGG + Intronic
1145108550 17:20141099-20141121 TGATGGATATGCTGTTCACCTGG + Intronic
1146859605 17:36285725-36285747 TGATGAATATGCTCATTACCTGG - Intronic
1147089929 17:38089812-38089834 TGATGAATATGCTCATTACCTGG - Intergenic
1147107282 17:38230709-38230731 TGATGAATATGCTCATTACCTGG + Intergenic
1147757137 17:42776179-42776201 TGATGAATTTACTGTCTCCCAGG + Intronic
1148422245 17:47557827-47557849 TGATGAATATGTTCATTACCTGG - Intronic
1149007964 17:51825359-51825381 TGTAGAATATACTCTTTACCAGG + Intronic
1149224465 17:54453387-54453409 TGAAGAATTTACTGCCTCCCAGG - Intergenic
1150627801 17:66853805-66853827 TGTTGAAAATACAGCTTATCAGG - Intronic
1155663582 18:28280890-28280912 AGATTAACATAATGCTTACCAGG - Intergenic
1156147551 18:34203764-34203786 TGATAAATATGCTGCTTTCTAGG - Intronic
1156696562 18:39774707-39774729 TGGTGATTCTACTGCATACCTGG - Intergenic
1159834008 18:73314001-73314023 TGATGAATATGTTTATTACCTGG + Intergenic
1166011918 19:39949053-39949075 TGAAGTTTATACTCCTTACCAGG - Intergenic
926701183 2:15804788-15804810 TGAAGAATAGACTGCTTCCTTGG + Intergenic
927599680 2:24430104-24430126 TGTTTAATATACTGGTTACAGGG - Intergenic
927653833 2:24928856-24928878 TGATTAACATACTGCTGACCCGG + Intergenic
934130237 2:88941070-88941092 TGCTAAATATAATGCTTTCCAGG - Intergenic
934132395 2:88961238-88961260 TGCTAAATATAATGCTTTCCAGG - Intergenic
934134974 2:88986859-88986881 TGCTAAATATAATGCTTTCCAGG - Intergenic
934146056 2:89094965-89094987 TGCTAAATATAATGCTTTCCAGG - Intergenic
934223205 2:90105611-90105633 TGCTAAATATAATGCTTTCCAGG + Intergenic
934235332 2:90226891-90226913 TGCTAAATATAATGCTTTCCAGG + Intergenic
937733290 2:125260195-125260217 TTATGAATATTCTGTTTACTGGG - Intergenic
938031237 2:127995849-127995871 GGAAGAACACACTGCTTACCTGG + Intronic
942841115 2:180361743-180361765 TGATGGATATGCTAATTACCTGG + Intergenic
1169733225 20:8809554-8809576 TGATTAATATACGGCTCTCCTGG - Intronic
1172190113 20:33056833-33056855 TGATGACTCTACTGCATGCCTGG + Intronic
1174206612 20:48844841-48844863 TGATGGATATACTGCTTGTATGG + Intergenic
1177150562 21:17451358-17451380 TTAAAAAAATACTGCTTACCCGG - Intergenic
1177631320 21:23732481-23732503 TTATGAATATACTACTTACTTGG - Intergenic
1179103179 21:38374947-38374969 TGATGAATAGAATGCATTCCAGG - Intergenic
1179524585 21:41967407-41967429 TGCTGAAGACACTGCTGACCCGG + Intergenic
1181945039 22:26509963-26509985 TGATAAGTATACTTCTCACCTGG - Intronic
1183103695 22:35599722-35599744 TGATGATAATAATGCCTACCTGG + Intergenic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
949921097 3:9001277-9001299 TGATGAATATACTGCTTACCCGG + Intronic
950094889 3:10323252-10323274 TGCTGGATCTCCTGCTTACCAGG + Intergenic
952228441 3:31403525-31403547 TCATGAATATATTGCCTACATGG - Intergenic
955381424 3:58441364-58441386 TAATGAATATACTTCTTGTCAGG - Intergenic
955618029 3:60829701-60829723 TGAAGAATATAAAGCTTTCCTGG + Intronic
956787821 3:72656858-72656880 AGATGTACCTACTGCTTACCTGG - Intergenic
958912848 3:100013778-100013800 TGATGAATATGTTGATTAGCTGG - Intronic
962743305 3:138378980-138379002 TGATGGATATGCTAATTACCTGG - Intronic
963858709 3:150284088-150284110 TGATGGATATCCTATTTACCCGG + Intergenic
966265338 3:178034696-178034718 TGATGTATATGCTGAGTACCTGG - Intergenic
966686130 3:182697920-182697942 TGATGAAAATACTGCTTACCTGG - Intergenic
971747674 4:30605209-30605231 TGATAAATATATTAATTACCTGG - Intergenic
973005850 4:45006185-45006207 TGATGAGTATACTGTTGAACAGG + Intergenic
975113066 4:70648844-70648866 TGATGAATATAATTTTTATCTGG + Intronic
978026477 4:103881186-103881208 TGATTCATATCCTGCTTACCGGG - Intergenic
979359391 4:119744013-119744035 TGAGGAAGAGACTGCTTCCCAGG + Intergenic
980427185 4:132641109-132641131 TGATGAATATCCCAATTACCTGG + Intergenic
980522789 4:133953820-133953842 TCATGAATATTCTGTTTACTGGG - Intergenic
981591731 4:146371664-146371686 GGGTGAATAAACTGCCTACCTGG + Intronic
984338644 4:178425077-178425099 TGATTAAGATAATGCCTACCAGG - Intergenic
986410457 5:7474281-7474303 TCATGAAGATACTGCATACAAGG + Intronic
987432970 5:17859361-17859383 TGATATATCTACTGCTTATCTGG + Intergenic
987575110 5:19716452-19716474 TCATGAAGAAACTGCTTACTTGG - Intronic
988849774 5:35168958-35168980 TCATGAAGATCCTGCTTTCCAGG - Intronic
989467703 5:41776018-41776040 TGGTGAAGGTAGTGCTTACCAGG - Intronic
993287683 5:86020869-86020891 TGATAAATATCCTGCTTCCAGGG + Intergenic
994953133 5:106490972-106490994 TGATGAATATACTAATTACATGG + Intergenic
996704773 5:126486150-126486172 TGATGGATATGCTAATTACCCGG - Intronic
999087594 5:148906716-148906738 TGCTGCCTATACCGCTTACCTGG - Intergenic
1000578963 5:163011878-163011900 TGATGAATACAGGGCTTACCTGG + Intergenic
1005802561 6:29441701-29441723 GGATCAATAAACTGCTTATCAGG - Intronic
1005869542 6:29964423-29964445 TCATGAATATTCTGTTTACTGGG + Intergenic
1009656979 6:66559955-66559977 TTATGAATATAGTCCTTACTTGG + Intergenic
1010980944 6:82368525-82368547 TAATGAATCTACTGCTTCCCTGG - Exonic
1011049580 6:83129871-83129893 TGATCAATATACTGTTTTTCGGG + Intronic
1011175301 6:84553008-84553030 TGATGAATAGACTGCTTTTCAGG + Intergenic
1012029923 6:94045932-94045954 TGCTGAAGATCCTGCTTATCTGG - Intergenic
1012431648 6:99170469-99170491 TAATGACTATACTGCTTCCCAGG - Intergenic
1012636012 6:101543128-101543150 TGATGGATGTCCTGCTTACCTGG + Intronic
1012866460 6:104624257-104624279 CGATGAATATACAGCTTATTTGG + Intergenic
1012876657 6:104736716-104736738 TCATAAAAATACTGCTTACTTGG + Intronic
1013786151 6:113783543-113783565 TTATATATATACTGCTTGCCTGG - Intergenic
1014601518 6:123418859-123418881 TGATGAGTGTTTTGCTTACCTGG + Intronic
1015347013 6:132171943-132171965 TGATGTTCATGCTGCTTACCAGG - Intergenic
1016270788 6:142288274-142288296 GAATGATTATAATGCTTACCTGG - Intergenic
1016951177 6:149581664-149581686 TGACATTTATACTGCTTACCAGG + Intronic
1018557551 6:165064567-165064589 TAATGAATATCCTGTTTACCGGG - Intergenic
1021324515 7:19249345-19249367 TGATGAATGTACTGATTAAAAGG - Intergenic
1024480455 7:49856661-49856683 TGATGGATATATTAATTACCTGG - Intronic
1025711646 7:63916291-63916313 TGTTGTATATTCTGCTTACTTGG - Intergenic
1027915089 7:84307699-84307721 TCATGAAATTACTGCTTAGCTGG - Intronic
1033894875 7:146057181-146057203 TCATGAATATCCTGTTTACTGGG - Intergenic
1035974347 8:4290633-4290655 TTATGAATATACTTCTCACAAGG - Intronic
1037216513 8:16459573-16459595 TTATCAATTTACTGCTTGCCAGG - Intronic
1039640094 8:39210096-39210118 TGATGAATTTTCTTCTTAGCTGG + Intronic
1040926964 8:52694687-52694709 TGATGGAAGTGCTGCTTACCAGG - Intronic
1041325352 8:56657692-56657714 TGAAAAATATATTGCCTACCTGG + Intergenic
1044803655 8:95982712-95982734 TGATGAGTATATTTCATACCAGG - Intergenic
1047028433 8:120850014-120850036 TGAGGAATATACTGTGTATCAGG - Intergenic
1048586014 8:135774904-135774926 TGATGAATATGCTAATTACCTGG + Intergenic
1050415889 9:5417197-5417219 AGATAAAGAAACTGCTTACCAGG - Intronic
1057480694 9:95442867-95442889 TGATGAAATCATTGCTTACCAGG + Intergenic
1186738897 X:12496417-12496439 TGTTAAATATACAGATTACCAGG - Intronic
1188215431 X:27470828-27470850 TGATAAATATAATGCTTAAGAGG - Intergenic
1189137763 X:38566810-38566832 TAATAAATATTTTGCTTACCAGG + Intronic
1196373915 X:115010296-115010318 TTATGAAGATACTTCTTCCCAGG - Intronic
1198539683 X:137624032-137624054 TGATGAGTATACTGCCTAGTGGG - Intergenic
1201620771 Y:15954751-15954773 TGTTGAATATACAGGTGACCTGG + Intergenic