ID: 949922064

View in Genome Browser
Species Human (GRCh38)
Location 3:9010603-9010625
Sequence TCCAGGGCTAGGAGGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949922064_949922071 -1 Left 949922064 3:9010603-9010625 CCCAGTGCCCTCCTAGCCCTGGA 0: 1
1: 0
2: 1
3: 26
4: 239
Right 949922071 3:9010625-9010647 AATTTGCTGAGCTGTCTTCTTGG 0: 1
1: 0
2: 1
3: 18
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949922064 Original CRISPR TCCAGGGCTAGGAGGGCACT GGG (reversed) Intronic
900473939 1:2867669-2867691 TGCCGGGCTTGGAGGGCACTGGG - Intergenic
900476310 1:2877980-2878002 TCCAGGGCTGGCAGGGAACAGGG + Intergenic
900559200 1:3295337-3295359 GCCAGTGCTGGGAGGGGACTGGG + Intronic
900581819 1:3413249-3413271 TCCAGGGGCAGGAGCGCACCAGG - Intronic
900947382 1:5838723-5838745 TCCAGGACTAGGGGGAGACTGGG + Intergenic
902207388 1:14878927-14878949 GCCAGGGCTGAGAGGCCACTTGG - Intronic
902450148 1:16491519-16491541 CCCTGGGCTTGGAGGGCTCTAGG - Intergenic
902502694 1:16921629-16921651 CCCTGGGCTTGGAGGGCTCTAGG + Intronic
903175280 1:21576657-21576679 CCCAGGGCTGGGAGGGGACAGGG + Intronic
903268367 1:22172416-22172438 CCCAGGGCCAGTAGGGCATTTGG - Intergenic
903385034 1:22920563-22920585 TCCAGAGCTGGGAGGCCACACGG + Intergenic
903403993 1:23081028-23081050 TCCTGGGCTTGGAGGGGCCTGGG + Intronic
904094705 1:27967590-27967612 TCCTGGGCTAGGAGGCCACAGGG + Exonic
905970385 1:42137528-42137550 TCCAGGGCTAGATGAGCTCTTGG + Intergenic
906297252 1:44656453-44656475 TCCAGGGCTAGGAGGTCAGGCGG - Intronic
908697000 1:66854956-66854978 TCCAGGGTTAGCAAGGCCCTAGG - Intronic
911015046 1:93323292-93323314 CCCAGGGCTGGGAGGCCACTCGG - Intergenic
912451576 1:109770656-109770678 TCCAGGGCTGTCAGGGCAGTGGG - Intronic
912562546 1:110560999-110561021 GCCAGGGCTGGGAGAGAACTGGG + Intergenic
913086492 1:115442254-115442276 TTCAGGCCCAGAAGGGCACTTGG - Intergenic
914001669 1:143699727-143699749 GTCAGGGCTAGGAGGGCTCCGGG - Intergenic
914096922 1:144552007-144552029 GTCAGGGCTAGGAGGGCTCGCGG - Intergenic
914176038 1:145280989-145281011 GTCAGGGCTAGGAGGGCTGTGGG + Intergenic
914502919 1:148263378-148263400 GTCAGGGCTAGGAGGGCTCGGGG + Intergenic
914530759 1:148522471-148522493 GTCAGGGCTAGGAGGGCTGTGGG + Intergenic
915106942 1:153540674-153540696 TCCAGGGCTGAGAGGGGGCTGGG + Intronic
915894880 1:159804082-159804104 TCCAGTGGTAGGAGGGAAGTTGG - Intronic
920347147 1:205313775-205313797 TGCAGGGCTAGGTGGGAGCTGGG + Intronic
922193820 1:223342118-223342140 ACCAGGGCTAGGAGGACAGGCGG + Intronic
922553197 1:226512471-226512493 TGCTGTGCTGGGAGGGCACTGGG + Intergenic
923555255 1:234995068-234995090 TTCAGGGCTACCAGGGCACCTGG + Intergenic
924403536 1:243717030-243717052 TCCAGGCCTGGGAGGGGAATGGG - Intronic
924457659 1:244231323-244231345 CCCGGGGATAGGAGGCCACTGGG - Intergenic
924777305 1:247119181-247119203 TCCAGGGCTTGGTGGGTACCGGG - Intergenic
1064008377 10:11715580-11715602 GCCTGGGTTTGGAGGGCACTTGG + Intergenic
1064445910 10:15392610-15392632 TGCAGGACGAGGATGGCACTAGG - Intergenic
1067037722 10:42932313-42932335 CCCAGGGCTTGCAGAGCACTAGG + Intergenic
1067284076 10:44894773-44894795 TCTAGGGCAAGGAATGCACTCGG - Intergenic
1069615328 10:69802952-69802974 TCCAGCGCTGGGAGCGCCCTGGG + Intronic
1069991480 10:72319362-72319384 TCCAGGACTGGGAGTGCCCTCGG - Intergenic
1070819368 10:79346023-79346045 TCCTGGCCTAGGAGGGGCCTAGG - Intergenic
1072431879 10:95379525-95379547 TCCAGGGCAAGGTGAGCTCTAGG + Intronic
1072522011 10:96237325-96237347 TCCAGAGCAAAGAAGGCACTTGG - Intronic
1072523996 10:96255230-96255252 TCCAGGGCCAAGAGGGCACGGGG + Intronic
1076518202 10:131061978-131062000 TCCAGGCCGAGGAGGCCACATGG - Intergenic
1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG + Intergenic
1076923358 10:133467019-133467041 GCCAGGGATGGGAGGGCACTGGG + Intergenic
1077028845 11:454283-454305 CCCAGGGCCAGGAGGGTGCTGGG + Intronic
1077295975 11:1826477-1826499 TCCCTGGATAGGAGGGCAGTGGG - Intergenic
1077368387 11:2170502-2170524 TCCAGGCCTGGGACGGCTCTGGG - Intronic
1077502383 11:2915222-2915244 GCCAGAGCAAGGAGGGGACTTGG - Intronic
1079276352 11:19040807-19040829 TCCAGGGATAGGAGGGACCCAGG + Intergenic
1081654804 11:44850149-44850171 TCCAGGACTTGGCGGGCCCTGGG - Intronic
1081798503 11:45840057-45840079 TCTAGGGCTAGGAGGGCTGGGGG - Intergenic
1083716748 11:64581803-64581825 TCCTGGGCTCTGAGGGCACTAGG + Intergenic
1084323937 11:68388360-68388382 ACCAGGGCTAGGAGGGGCCTTGG - Intronic
1084467657 11:69335610-69335632 CCCAGGGCTAGGAATGCAGTCGG + Intronic
1084647219 11:70465509-70465531 TCCAAGGCCAGGAGGGCAGCTGG + Intergenic
1085039757 11:73319974-73319996 TCCAGGGCAAGGAGGGAAGGTGG + Intronic
1085983395 11:81752925-81752947 TGAAGGACTAGGAAGGCACTAGG - Intergenic
1088226855 11:107629959-107629981 TCGAGGGTGAGGAGGACACTAGG + Intronic
1088311754 11:108467554-108467576 GGCGGGGCTAGGAGGGCAATGGG - Intergenic
1088396131 11:109371690-109371712 TCCAGGGCTAGGAAGACAATGGG + Intergenic
1088588527 11:111380394-111380416 ACCAGTGGTAGGAGGGCAGTTGG - Intronic
1089754878 11:120679370-120679392 TCCTGGGCTCCGGGGGCACTAGG - Intronic
1090275803 11:125418566-125418588 TCCTGGCCAAGGAGGGCACGTGG + Intronic
1091601882 12:1922640-1922662 CCCAGGGCAGGGAGAGCACTCGG + Intergenic
1092398205 12:8146857-8146879 TCCAGGGGTGGGAGGGAACCAGG + Intronic
1096490360 12:52009579-52009601 GCCAAGGCTAGGAGGGCTCAGGG - Intronic
1096791306 12:54046921-54046943 GCCAGGGCGAGGAGGCCTCTGGG + Intronic
1097801439 12:63918799-63918821 TCCAGGCCTAGAAGAGTACTCGG - Intronic
1098157538 12:67615059-67615081 TCCTGGGAGAAGAGGGCACTGGG + Intergenic
1098199107 12:68036046-68036068 TTCACGGCTAAGTGGGCACTTGG - Intergenic
1100561885 12:95755318-95755340 TCCATGGATAGGTGGCCACTTGG + Intronic
1100640067 12:96474056-96474078 TCCAGGGCTAGAAGGACCCTAGG + Intergenic
1101817562 12:108157474-108157496 TCCAGGGGTAGGAGGGAAATAGG - Intronic
1102346290 12:112163311-112163333 CCCAGGGCTGGGGAGGCACTGGG - Intronic
1102644853 12:114397174-114397196 TTCAGGGAAAGGAGGGGACTGGG - Intronic
1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG + Exonic
1104481987 12:129115648-129115670 GTCAGGGCTAGGTGGACACTGGG + Intronic
1104946102 12:132415517-132415539 TGCAGGGCCAGGAGAGCACCAGG - Intergenic
1108212735 13:48154809-48154831 TCCACAGATAGGAGGACACTGGG - Intergenic
1109715204 13:66212594-66212616 TCCAGTGCTAGGAAGCCAGTCGG - Intergenic
1112474087 13:99715186-99715208 GCCAAGGCTAGGAGGCAACTGGG + Intronic
1113517725 13:110915582-110915604 TCCGGGGCTTGGAGGTCACGGGG + Intergenic
1115330406 14:32190676-32190698 GCCAGGGTTGGGGGGGCACTCGG - Intergenic
1121910743 14:97790182-97790204 CACAGGGCAAGCAGGGCACTGGG + Intergenic
1123047521 14:105526275-105526297 TTCAGGGCGCGGGGGGCACTGGG + Intergenic
1123122877 14:105926288-105926310 GCCAGGGCCAGGTGGGCAATGGG - Intronic
1123405520 15:20017708-20017730 GCCAGGGCCAGGTGGGCAATGGG - Intergenic
1123514852 15:21024356-21024378 GCCAGGGCCAGGTGGGCAATGGG - Intergenic
1124200239 15:27673222-27673244 TCCAGGGCTACATGGACACTGGG + Intergenic
1124958229 15:34374136-34374158 TCCAGACATAGGATGGCACTGGG + Intergenic
1126686478 15:51252691-51252713 TCCAGTGCATGGAGGGCACACGG + Intronic
1128703531 15:69821719-69821741 TCGAGGGCTAGGAGGGCTGGAGG + Intergenic
1128767063 15:70257717-70257739 TCCAGGGTGAGGAGGGCATGTGG + Intergenic
1129115111 15:73361296-73361318 CCAAGGGCTAGGAAGCCACTGGG - Intronic
1129269779 15:74413539-74413561 GCCAGGGATGGCAGGGCACTGGG - Intronic
1129390886 15:75220464-75220486 ACCAGAGCTAGAAGGGCATTGGG - Intergenic
1129473422 15:75767408-75767430 ACCAGAGCTAGAAGGGCATTGGG + Intergenic
1131061921 15:89409764-89409786 TCCAGGACTAGGAAGGCTCGGGG - Intergenic
1132502651 16:291452-291474 GGCAGGCCTAGGAGGGGACTCGG - Intronic
1134246890 16:12546882-12546904 TCCAGGGCTAGGAGTGCAGCTGG + Intronic
1135342976 16:21664405-21664427 TCCTGGGATTGGAGGGCACTTGG + Intergenic
1136022483 16:27448971-27448993 CCCTGGGCTAGGAGGGCCCCTGG + Exonic
1137520620 16:49192058-49192080 TCCAAGGCCAGGAAGGCAATAGG - Intergenic
1138261082 16:55623287-55623309 TTCAGAGCTATCAGGGCACTGGG - Intergenic
1138455282 16:57117388-57117410 TCCAGGGCTAGGAGGGGGAAGGG - Intronic
1138995832 16:62451984-62452006 CCAAGGGCTAGGAGGGCACCCGG - Intergenic
1141469998 16:84231583-84231605 CCCAGGGCTGGAAGGGCACTAGG + Intronic
1141600002 16:85119954-85119976 GTCAGGGCTGGGAGGGCGCTAGG - Intergenic
1141620314 16:85233889-85233911 GGCAGGGGTAGGAGGGCCCTGGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1141793592 16:86253121-86253143 TCCAGGGCTAGGACGACAAAGGG - Intergenic
1141993448 16:87622878-87622900 TCCAGGGCTGGCAAGGCATTGGG + Intronic
1143107162 17:4535598-4535620 TCCGAGGCTCGGAGGGCTCTGGG + Intronic
1144652640 17:17017164-17017186 GCCAGGGCCAGCAGGGCCCTTGG + Intergenic
1144875842 17:18396782-18396804 CCCTGGGCTAGGAGAGCTCTTGG - Intergenic
1145156387 17:20547638-20547660 CCCTGGGCTAGGAGAGCTCTTGG + Intergenic
1145799521 17:27673935-27673957 TCTAGGGCAAGGAGGCCACCGGG + Intergenic
1147634868 17:41957649-41957671 CACAGGGGTAGGAAGGCACTGGG + Intronic
1149353643 17:55817198-55817220 GCCAGGGCTTGGAGGGAAATTGG + Intronic
1149996617 17:61409253-61409275 TACAGGGCTGGGGGGGCCCTTGG + Exonic
1150636985 17:66919899-66919921 TCCAGGGCCAGGAGAGGACCAGG + Intergenic
1151848432 17:76674555-76674577 GACAGGGCTTGGTGGGCACTCGG - Exonic
1152237487 17:79146180-79146202 TCCATGGCTTGGTGGGAACTGGG - Intronic
1153573235 18:6494752-6494774 TCAAGTGCAAGGAGGGCAGTGGG - Intergenic
1158500102 18:57993363-57993385 TCCAGGGCTGGGAAGGAAATGGG + Intergenic
1160522455 18:79515661-79515683 TCCAGGGGGAGACGGGCACTTGG - Intronic
1160703433 19:518547-518569 GCCTGGGCTGGGAGGGGACTGGG + Intronic
1160932464 19:1577165-1577187 AGCAGGGCCAGGAGGGCACCAGG + Exonic
1161125599 19:2555721-2555743 CCCAGGGCCAGGAGGTCAATAGG + Intronic
1161431267 19:4233636-4233658 TCCAGGGTTTGGTGGGCAGTAGG - Intronic
1163584859 19:18157952-18157974 GCCAGGGCTGGGAGGGGGCTGGG + Intronic
1164556490 19:29256690-29256712 CCCAGGGCCAGGAGGGCACTGGG - Intergenic
1164769271 19:30795763-30795785 TCCACCACTAGGAGGACACTGGG + Intergenic
1164792873 19:31002916-31002938 TCCAGGGCTGGGAGGGTGCCAGG + Intergenic
1164802844 19:31092010-31092032 TCCAGGGCTTTGGGGGGACTGGG - Intergenic
1165308691 19:35017915-35017937 TGCAGGGCTTGGAGGCCAGTGGG - Intronic
1166945458 19:46393544-46393566 TCCAGGGCTGGCCGGGCACGGGG + Intergenic
1167351530 19:48978056-48978078 TCAGGGCCTAGGAGGGCACAGGG + Intronic
1167918381 19:52761030-52761052 TCCATGGTTAGGAGGGCAGAAGG - Intergenic
1168152967 19:54458826-54458848 CCCAGGGCAAGGAGTGAACTAGG - Intronic
927074580 2:19565058-19565080 TCCAGGCTTAGGAGAGCCCTGGG + Intergenic
927720519 2:25379110-25379132 AACAGGGCAAGGAGGGCACATGG + Intronic
927992078 2:27454975-27454997 GACAGGGCTAGGAGGGCTCCTGG + Intronic
928272773 2:29871978-29872000 TCTAGGGCTTGGAGGACAATGGG - Intronic
930022895 2:47012155-47012177 TCCAGGCCTATGGGGGCTCTTGG + Intronic
930250554 2:49029851-49029873 TCCAGGGCTAGCAGGGACCCTGG - Intronic
931186715 2:59959577-59959599 TCCAGGGATGGGAGGGCAGAGGG - Intergenic
934462126 2:94217988-94218010 TCCAGGGATAGGACAGAACTGGG - Intergenic
934661676 2:96146428-96146450 TCCAGGGCTAGCACTGCACCCGG + Intergenic
936983465 2:118285980-118286002 TGCTTGGCTAGGAGGGCTCTGGG - Intergenic
937239037 2:120448437-120448459 TCCAGTGCTTGGAGGCCTCTCGG + Intergenic
937953578 2:127406959-127406981 ACCTGGGGTGGGAGGGCACTGGG - Intergenic
938256320 2:129862346-129862368 TCCAGGGCTATGATTTCACTGGG + Intergenic
940996728 2:160157861-160157883 TCCAGAGCTAGGGGCGGACTGGG + Intronic
942556611 2:177178283-177178305 TCCTGGTCCAGGAGGGCCCTGGG + Intergenic
945454073 2:210028723-210028745 TCCATGGCTATGAAGGAACTGGG + Intronic
946131481 2:217610222-217610244 CTCAGGGCTGGGAGGGCTCTGGG - Intronic
948940829 2:241195529-241195551 GCCAGGGCTAGGAGGACTCCAGG - Intronic
1169209600 20:3758801-3758823 TTCAGGGCTAGATGGACACTAGG + Intronic
1171227783 20:23455839-23455861 TGCAGGGCCAGGAGGGCAAGTGG - Intergenic
1171880473 20:30614716-30614738 TCCTGGGCCAGGAGAGCCCTTGG + Intergenic
1171987394 20:31670147-31670169 TCTGGGGAAAGGAGGGCACTAGG + Intronic
1172481544 20:35274696-35274718 ACCAGGGCCAGCAGGGCCCTAGG + Exonic
1172513233 20:35514958-35514980 TACAGAGATAGGAAGGCACTGGG + Exonic
1172641299 20:36441965-36441987 TCCTGGACTAGGAGAGAACTGGG - Intronic
1172890475 20:38260587-38260609 TCCAGGGCTAGGCGGGACCGAGG - Exonic
1173939187 20:46895143-46895165 CCCAGGGCCAGGAAGGCACAAGG + Intronic
1174387206 20:50194230-50194252 CCCAGGGCTGGGAGGGGACGTGG - Intergenic
1174431833 20:50475701-50475723 TTCAGGGCCAGGAGGGCTGTGGG + Intergenic
1175404255 20:58716597-58716619 TCCAGGGCTGTGGGGGCACATGG - Intronic
1175417571 20:58811839-58811861 TCCTGAGCTAGGAGGGGACTTGG + Intergenic
1176044277 20:63084286-63084308 CCCCGGGCGAGGAGGGCACTGGG - Intergenic
1180081965 21:45491148-45491170 TCCAGGGCTGGGTGGACTCTGGG + Intronic
1181456646 22:23063765-23063787 CCCAGGGGTAGGAGGGAGCTGGG - Intronic
1181573089 22:23778465-23778487 ACCAGGGCTAGGAGTACAGTGGG - Intronic
1181629230 22:24141878-24141900 TCCAGGGCTGGGACAGCACAGGG - Intronic
1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG + Intronic
1183191220 22:36323177-36323199 TCCAGGGATAAGAAGGCACAAGG - Intronic
1183396900 22:37576844-37576866 TCCAGGGTCAGGGGTGCACTTGG + Intronic
1184017077 22:41794375-41794397 TCCAAGGCTGGGAGGCCACGTGG - Exonic
949922064 3:9010603-9010625 TCCAGGGCTAGGAGGGCACTGGG - Intronic
950540339 3:13608685-13608707 TCCAGGCCCAGGAGAGCTCTTGG + Intronic
953386054 3:42506183-42506205 TCCAGGCCTAGGTAGGCAATGGG + Intronic
954420158 3:50414585-50414607 AACAGGGCTAGGCAGGCACTGGG - Intronic
954579624 3:51696253-51696275 GCCAGGGCTAGGAGGACCCCAGG + Intronic
954660341 3:52223720-52223742 CCCAGGCCAAGGAGGGCACCCGG + Exonic
954998351 3:54902605-54902627 TCCAGGGCTAGGATGAGACTTGG - Intronic
958043016 3:88248630-88248652 TCCAGGGCCAGGAGTGAGCTTGG + Intergenic
960207389 3:114918910-114918932 TCCAAGCCTAGCAGAGCACTAGG + Intronic
961767741 3:129225146-129225168 CCTAGGGCCAGCAGGGCACTGGG + Intergenic
964732552 3:159882871-159882893 GCCAGGAGCAGGAGGGCACTTGG - Intronic
966313951 3:178625018-178625040 AGCAGGGCAAGGAGGGCACAGGG + Intronic
969054076 4:4390774-4390796 TCCAGGGCTGGGAGGCTTCTTGG + Intronic
969615026 4:8247262-8247284 TCCAGGGCCAGGAGGTCTCCAGG + Intergenic
975949074 4:79746297-79746319 TCCAGAGCTAGGAGGCTGCTGGG - Intergenic
976507937 4:85871175-85871197 TCTAGGGGTAGGAGGGCTTTAGG + Intronic
978013736 4:103719462-103719484 CCCAGGGCTGGGAGGGCGCGGGG + Exonic
979291647 4:118985014-118985036 TCCAGGTCTAGGACCACACTAGG - Intronic
982926517 4:161343655-161343677 TCCAGGTCTAGGATGGTACCAGG + Intergenic
984968525 4:185164954-185164976 TCAAGGGCTTGTAGGCCACTGGG + Intronic
985666072 5:1182025-1182047 TCCAGGGTTTGGTGGACACTTGG - Intergenic
985888938 5:2700870-2700892 TGGAGGGCTGGGAAGGCACTCGG - Intergenic
987576368 5:19733682-19733704 TCCAGGACTAGCATGGCTCTGGG - Intronic
991733537 5:69611414-69611436 CCTAGGGCTAGGAGGGTAATGGG + Intergenic
991809971 5:70466560-70466582 CCTAGGGCTAGGAGGGTAATGGG + Intergenic
991861417 5:71016436-71016458 CCTAGGGCTAGGAGGGTAATGGG - Intronic
993181568 5:84560582-84560604 GCCAGTGCTTGGAGGGCATTGGG - Intergenic
994536899 5:101042634-101042656 TCCAGGGGAAGGAGGGCAGCAGG + Intergenic
996088979 5:119331779-119331801 TGCATGGCTAGGTGGTCACTAGG - Intronic
996431982 5:123390899-123390921 TCAAAGGCTAAGAGGGCTCTGGG + Intronic
997434636 5:133865512-133865534 TACAAAGCAAGGAGGGCACTGGG - Intergenic
998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG + Intergenic
998511149 5:142714960-142714982 TCCAGTGCCAGGAGAGCACCGGG - Intergenic
999452025 5:151685857-151685879 TCCAAGGGAAGGGGGGCACTGGG - Intronic
999811601 5:155132627-155132649 CCCAGTGCTAGGAGAGCACCCGG + Intergenic
1002479715 5:179492263-179492285 TCCAAGACTAGGTGGGCTCTGGG + Intergenic
1002818380 6:699067-699089 TCCAGGGCTAGCATTTCACTTGG - Intergenic
1004183925 6:13405939-13405961 TCCAGGGCCAGGAGGAGCCTGGG + Intronic
1005109752 6:22267578-22267600 TCCGGGGCAAGGAGGGCCTTGGG - Intergenic
1006622105 6:35372683-35372705 TACAGGTCTAGGAGGGCATGTGG + Intronic
1006836141 6:36999894-36999916 TGCAGGGCCAGGTGGGGACTCGG - Intergenic
1007519571 6:42441127-42441149 TCCAGGGTTGGGATTGCACTGGG - Intronic
1008109543 6:47477867-47477889 TCCGAGGCTAGGCGGGCGCTCGG + Exonic
1008921073 6:56844152-56844174 CACAGGGCAAGGAGGGCACGGGG + Intronic
1011344694 6:86356058-86356080 TCCAGGGCAGGGTGAGCACTTGG - Intergenic
1018132620 6:160747215-160747237 CCCAGGTCTAGGATGGCATTTGG + Intronic
1019335529 7:480876-480898 TTCAGGGCCTGGAGGGGACTGGG - Intergenic
1019560902 7:1656591-1656613 GCCAGAGGTAGGAAGGCACTGGG + Intergenic
1020040551 7:4997661-4997683 TCCTGGGCTAGAAGGCCACAGGG + Intronic
1020084611 7:5303662-5303684 TCCCGGGCCAGGAAGGCAATGGG - Exonic
1020086613 7:5313797-5313819 TCCAGGGCTAAGGGGGTACTGGG + Exonic
1021067560 7:16195728-16195750 TGCAGGGGTGAGAGGGCACTTGG - Intronic
1023765857 7:43510014-43510036 TTCAGGGCTGGGAGTGCATTTGG - Intronic
1024374258 7:48619690-48619712 TCCTGGGTTTGGAGGCCACTTGG - Intronic
1025207700 7:57003341-57003363 TCCAGGGCTAAGGGGGTACTGGG - Intergenic
1025209692 7:57013538-57013560 TCCCGGGCCAGGAAGGCAATAGG + Intergenic
1025662261 7:63563313-63563335 TCCTGGGCCAGGAAGGCAATAGG - Intergenic
1025664236 7:63573531-63573553 TCCAGGGCTAAGGGGGTACTGGG + Intergenic
1027344605 7:77244792-77244814 TCCAGGGGAAGGAGGTCAGTGGG - Intronic
1030335289 7:108318783-108318805 TCCAGGGCTAGGATGGCTAGGGG - Intronic
1033603846 7:142910673-142910695 TCCTGAGCTAGGAGGGAACTTGG - Intronic
1034824843 7:154252368-154252390 TCCCAGGCAAGGAGGGCATTTGG + Intronic
1039549836 8:38435386-38435408 TCCACGGCTAGGAGTGCTCTTGG + Intronic
1045064671 8:98434955-98434977 TGCTGGGCTAGGAGCACACTAGG - Intronic
1048541587 8:135346970-135346992 TCCAGTGCTAGCAGTGCCCTGGG + Intergenic
1049290434 8:141798725-141798747 TCCAGAGCTAAGAGGGCGCACGG + Intergenic
1049382358 8:142323652-142323674 CCCAGGACCAGCAGGGCACTTGG + Intronic
1049473536 8:142786752-142786774 AGCAGGGCCAGGAGGCCACTGGG - Intergenic
1052418172 9:28204790-28204812 TCAAGGGATGGGTGGGCACTTGG + Intronic
1053351869 9:37418502-37418524 ACCAGGGCCAGGAGGGGACACGG + Intergenic
1059327680 9:113514205-113514227 TCCAGGGCTAGCACAGCGCTGGG - Intronic
1061569235 9:131466204-131466226 TCCCTGGCCAGAAGGGCACTAGG - Intronic
1061844540 9:133379662-133379684 ACCAGGGCTAGCAGGGCATGGGG + Intronic
1062453689 9:136626152-136626174 TGCAGGGCCAGGAGGGGACATGG - Intergenic
1062526798 9:136981197-136981219 TCCTGGGCTAGGAGGAAACCAGG + Intronic
1187225014 X:17367435-17367457 TCCAGGTATGGGAGGACACTTGG + Intergenic
1190277739 X:48910086-48910108 GCCATGGCTAGGAGGGTCCTGGG - Intronic
1193899634 X:87161505-87161527 TCCATAGCTAGGAATGCACTGGG + Intergenic
1195750326 X:108157490-108157512 TAATGGGTTAGGAGGGCACTAGG - Intronic
1198213198 X:134533976-134533998 TCCAGGACTGGGAAGGCACACGG - Intergenic
1200039076 X:153353078-153353100 TCCAGTGCTTGCTGGGCACTTGG + Intronic
1200226204 X:154419294-154419316 TCCAGGGCCTGCATGGCACTTGG - Intronic
1201280819 Y:12340523-12340545 TCAAGGCCTAGGAGAGCACTGGG + Intergenic
1201937979 Y:19427888-19427910 TTCAGAGGAAGGAGGGCACTTGG - Intergenic