ID: 949924570

View in Genome Browser
Species Human (GRCh38)
Location 3:9031163-9031185
Sequence CACAAAAGGCAGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 0, 2: 9, 3: 64, 4: 650}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949924570_949924578 20 Left 949924570 3:9031163-9031185 CCTTCCACTTTCTGCCTTTTGTG 0: 1
1: 0
2: 9
3: 64
4: 650
Right 949924578 3:9031206-9031228 ACTACTGACTCCTTGAGGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 191
949924570_949924575 15 Left 949924570 3:9031163-9031185 CCTTCCACTTTCTGCCTTTTGTG 0: 1
1: 0
2: 9
3: 64
4: 650
Right 949924575 3:9031201-9031223 GCTCCACTACTGACTCCTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 111
949924570_949924576 16 Left 949924570 3:9031163-9031185 CCTTCCACTTTCTGCCTTTTGTG 0: 1
1: 0
2: 9
3: 64
4: 650
Right 949924576 3:9031202-9031224 CTCCACTACTGACTCCTTGAGGG 0: 1
1: 0
2: 2
3: 15
4: 126
949924570_949924579 21 Left 949924570 3:9031163-9031185 CCTTCCACTTTCTGCCTTTTGTG 0: 1
1: 0
2: 9
3: 64
4: 650
Right 949924579 3:9031207-9031229 CTACTGACTCCTTGAGGGAAGGG 0: 1
1: 0
2: 0
3: 19
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949924570 Original CRISPR CACAAAAGGCAGAAAGTGGA AGG (reversed) Intronic
900816462 1:4850771-4850793 CACAACATGCAGGAAGTGGGTGG - Intergenic
900856071 1:5185208-5185230 AAAAAAAGAAAGAAAGTGGATGG + Intergenic
901539354 1:9905370-9905392 AACAGAAGATAGAAAGTGGATGG - Intronic
901643723 1:10705754-10705776 CAAAAACGTCAGAAAGTGGTAGG + Intronic
902118896 1:14144782-14144804 CACGAAAGGAAGCAAGTGGGGGG + Intergenic
902778921 1:18692199-18692221 AAGAAAAGGAAGAAGGTGGAAGG + Intronic
904283202 1:29435813-29435835 TACTCATGGCAGAAAGTGGAAGG - Intergenic
904569294 1:31449312-31449334 CACAAGATGTAGAAAATGGAAGG - Intergenic
904979541 1:34485731-34485753 TATAAAAGAAAGAAAGTGGATGG + Intergenic
905220273 1:36441361-36441383 CACCACAGGCACAAAGAGGAAGG + Intronic
905838495 1:41152006-41152028 TAGAAGAGGCAGAAAGTGGGTGG + Intronic
906017879 1:42598547-42598569 TACAAAAGGCAGAAAAAGCATGG + Intronic
906017939 1:42599465-42599487 CACAAAAGGCATAAAAAGCATGG + Intronic
906236603 1:44214935-44214957 CACAAATGGCTCAAAGTGGGAGG - Intronic
906246197 1:44275994-44276016 CACTCAAGGCAGAAAGTGAAGGG + Intronic
906319435 1:44807233-44807255 GGCCAAAGGCAGAAGGTGGAAGG - Intergenic
907829731 1:58053351-58053373 CGCACATGGCAGAAAGTAGAAGG + Intronic
907840181 1:58149452-58149474 CACTAAGGGCAGACAGTTGATGG - Intronic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
908499472 1:64728903-64728925 CTCACATGGCAGAAGGTGGAAGG - Intergenic
909671439 1:78193582-78193604 CTCACAGGGCAGAAAGTTGAAGG + Intergenic
909943636 1:81638740-81638762 CACAAAAGGCAGAAAAAGAGTGG + Intronic
911316665 1:96364021-96364043 CACAGAAGTCTGAAAGTGAAAGG - Intergenic
911373382 1:97021603-97021625 CACAAAAGGCAGAAAAAGAGTGG + Intergenic
913068412 1:115278809-115278831 GACAAGAGGCAGAAAGAGCAAGG - Intergenic
913144083 1:115972275-115972297 CTCACATGGCAGAAGGTGGAAGG + Intergenic
914244793 1:145877525-145877547 CACAAAAGGCAGTTACTGGCCGG - Intronic
914448895 1:147773455-147773477 CACAAAAGAGAGAGAGGGGAGGG - Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914897530 1:151690228-151690250 CATGAATGGCAGAAAGTCGAAGG - Intronic
915328901 1:155097066-155097088 GACAACAGGCAGAATGGGGAGGG - Intergenic
915427318 1:155837441-155837463 CTGAAAAGGCAGAAAGGGAAAGG - Intronic
915788196 1:158639017-158639039 CAGAAAAGGCAGGAAGTCAAAGG - Intronic
915874100 1:159594152-159594174 CACAGACTGCAGAAGGTGGATGG + Intergenic
916660666 1:166920451-166920473 AAAAACAGGCAGAAAGTTGAAGG - Intronic
916865276 1:168849850-168849872 CCAAAAAGGCAGGAAATGGATGG - Intergenic
917334405 1:173913351-173913373 CACAAAAGGCAGTGGGGGGAAGG + Intronic
917449277 1:175133506-175133528 CACAAAAGCCACAAAGAGAAAGG - Intronic
917457378 1:175196792-175196814 AAAAAAAGGCACAAAGTGCATGG - Intergenic
917587451 1:176442160-176442182 CGCTAAAGGCAGAATGTGGCTGG - Intergenic
918485400 1:185024104-185024126 CACAATAGGCAGAAAAAGGGTGG - Intergenic
918961138 1:191279689-191279711 CTCACATGGCAGAAGGTGGAAGG + Intergenic
919001040 1:191831769-191831791 CTCAAGTGGCAGAAGGTGGAAGG + Intergenic
919017101 1:192052699-192052721 AACAAAAACCAGATAGTGGAAGG + Intergenic
919242613 1:194934920-194934942 CAATCATGGCAGAAAGTGGAAGG - Intergenic
919981281 1:202644052-202644074 AACAAAAGGCAGATGCTGGAGGG + Intronic
920161468 1:204001588-204001610 TCCAAAAGGGAGAAACTGGAGGG - Intergenic
920187207 1:204167141-204167163 CAAAAAAGAAAGAGAGTGGAGGG + Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
921003876 1:211072786-211072808 CAAAAAAGGCAGAAAAAGAATGG + Intronic
921359983 1:214322500-214322522 CACAAAAAGCAGAAAATGGGAGG - Intronic
921798939 1:219379957-219379979 CCCAAAAGGCAGGAACTGGCTGG + Intergenic
921917619 1:220629867-220629889 CACAAAAGCCAGGATGTGGAAGG - Intronic
921924790 1:220702712-220702734 CACAGAAGGAAGAATGTGAAGGG + Intergenic
921986992 1:221322919-221322941 CACATAAGGAAGAAAGGGGTTGG - Intergenic
922089522 1:222382396-222382418 CAGAAAGGGCAGAAAGGGCAAGG + Intergenic
922394292 1:225180470-225180492 CACACATGGCAGAAAGTGAAAGG + Intronic
922600387 1:226847052-226847074 TCCAAAAGGGAGAAAATGGAAGG - Intergenic
922815902 1:228449086-228449108 AAAAAAAGGAAGAAAGTGAAGGG - Intergenic
922998063 1:229982634-229982656 CAAACATGGCAGAAAGTGAAGGG + Intergenic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923676857 1:236087876-236087898 CTCACATGGCAGAAGGTGGAAGG + Intergenic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
924114322 1:240730273-240730295 AAAACAAGGAAGAAAGTGGATGG - Intergenic
924445333 1:244124636-244124658 GACAGAAGGCAGAAACTTGATGG + Intergenic
924507705 1:244701640-244701662 TCCAAAAGGGAGAAAATGGAAGG - Intronic
1063179315 10:3583650-3583672 GACAAAAGGCAGAATGAGCAGGG + Intergenic
1063875389 10:10471590-10471612 CTCAAAAGCCAGAAAGTAAATGG - Intergenic
1064375227 10:14789476-14789498 CAAACATGGCAGAAAGTGAAAGG + Intergenic
1064669242 10:17692365-17692387 CTCAAAAGGGAAAAAGTGAACGG + Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065233899 10:23626806-23626828 CGCAACAGGGAGAGAGTGGATGG + Intergenic
1065490537 10:26277645-26277667 CAGAGAAGGAAGTAAGTGGATGG + Intronic
1065819293 10:29510569-29510591 CACCAAAGGCAGAAAGGAGCCGG - Intronic
1065953555 10:30673845-30673867 CACCAAAGGCAGAAAGGAGCCGG + Intergenic
1066067217 10:31771188-31771210 CACTCACGGCAGAAAGTGAAGGG - Intergenic
1066665052 10:37774601-37774623 CACAGATGGCAGAAAGTCAAAGG - Intergenic
1067229337 10:44395848-44395870 AAAAAAAGGAAGAAACTGGATGG + Intergenic
1067514193 10:46922806-46922828 TCCAAAAGGGAGAAACTGGAAGG - Intronic
1067648061 10:48129025-48129047 TCCAAAAGGGAGAAACTGGAAGG + Intergenic
1068222146 10:54058069-54058091 CTCAAAAGGCAGGAAGATGAGGG - Intronic
1068458829 10:57298948-57298970 AACAAAATGCATAAATTGGAAGG - Intergenic
1068656699 10:59583351-59583373 CTCACATGGCGGAAAGTGGAAGG - Intergenic
1069098475 10:64288796-64288818 CACAGAAGACAGAAATTGGCAGG - Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1070841372 10:79490314-79490336 CACAAGATGGAGAAAGGGGAAGG + Intergenic
1071889808 10:89991533-89991555 CACTCATGACAGAAAGTGGAGGG + Intergenic
1072087429 10:92094149-92094171 CATAAAAGGCGAAAAGTGGCCGG - Intronic
1072177378 10:92941345-92941367 CACAATAGTCAAAAGGTGGAAGG - Intronic
1072295433 10:94004855-94004877 CACAAATGACAGAAAGTGTCAGG - Intronic
1073184412 10:101607146-101607168 CACAAAAAGCAGAACCAGGAGGG - Intronic
1073508882 10:104029823-104029845 GACAAAACTCAGAAAGAGGATGG - Intergenic
1073771130 10:106736957-106736979 GACAAAATGCAGCACGTGGAGGG - Intronic
1074665484 10:115717909-115717931 CACAGAAGCCAGAAAATGTAGGG - Intronic
1075786773 10:125055329-125055351 CACAAGGGGCAGAAATGGGAAGG + Intronic
1076181398 10:128411707-128411729 CAGAAAAGGCAGAAAAGGGAGGG + Intergenic
1076479623 10:130776383-130776405 CAACAAAGGCAGAAAGTGAAGGG - Intergenic
1077559797 11:3252598-3252620 GAAAAATGGCAGAAAGTTGAAGG - Intergenic
1077565690 11:3298401-3298423 GAAAAATGGCAGAAAGTTGAAGG - Intergenic
1077852175 11:6084214-6084236 CACAAAATTCAGAATCTGGATGG - Intergenic
1077941436 11:6847811-6847833 CAAAAAAGACAGAAAGATGAGGG + Intergenic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078522629 11:12075619-12075641 CAAAAAGGACAGAGAGTGGATGG - Intergenic
1079315922 11:19407752-19407774 CACAAAATGCCGAGTGTGGAAGG - Intronic
1079343930 11:19635565-19635587 CACTCATGGCAGAACGTGGAAGG + Intronic
1079573344 11:21972036-21972058 TACCAAAGGCAGGAAGTGGGAGG - Intergenic
1079595112 11:22234723-22234745 AACAAAAGGAAGAAACTGCAAGG - Intronic
1080197632 11:29630871-29630893 CAGAAAAGTAAGAAAGTTGAGGG + Intergenic
1080308887 11:30866937-30866959 CCCACAGGGCAGAAAGTGGAAGG - Intronic
1080408647 11:32002421-32002443 CAGAAATGGCAGGAAATGGATGG - Intronic
1080540906 11:33263784-33263806 AACAAAAGACAGAAAGAGGAAGG - Intronic
1080567063 11:33520114-33520136 CACAAAAGGAAAAAAAAGGAAGG - Intergenic
1080579809 11:33632936-33632958 GACAACAGGCTGAAACTGGAGGG - Intronic
1080580315 11:33637065-33637087 CAGAAAATTCAGCAAGTGGAAGG + Intronic
1080695743 11:34601586-34601608 CTCAGAGGGCAGAAGGTGGAAGG - Intergenic
1081396343 11:42590581-42590603 CACAAAAGATAAATAGTGGAGGG + Intergenic
1082065385 11:47894588-47894610 CACAAAAGGCAGAAAAAGTATGG + Intergenic
1083033333 11:59614740-59614762 GAGATAAGGCAGAAAGGGGACGG + Intronic
1083105503 11:60354431-60354453 CAAACATGGCAGAAAGTGGAAGG - Intronic
1084545122 11:69811514-69811536 CACAAAAAGCAGGAAGGGAAGGG + Intronic
1085794531 11:79525923-79525945 CATAAAAGCCAAAAAGTGGAAGG - Intergenic
1086216692 11:84391060-84391082 CACACAAGGTTGAAAGTTGAGGG + Intronic
1087134621 11:94703775-94703797 CACAAAAGGTAATAAGTGAATGG + Intergenic
1087917764 11:103830736-103830758 AGCAGAAGGCAGAAGGTGGAAGG - Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1089842469 11:121430377-121430399 CCAAAAAGACAGAAAGTAGAGGG - Intergenic
1090376968 11:126296967-126296989 CACAAAAAGCACAAAGTAAAAGG - Intronic
1090689809 11:129168298-129168320 ACCAAAAGGTAGAAAATGGAAGG + Intronic
1090996453 11:131870188-131870210 CACAGTAGAAAGAAAGTGGATGG + Intronic
1091654313 12:2334177-2334199 TACACAAGGCAGAAAGTGGGTGG + Intronic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1092569689 12:9708765-9708787 GACAAAAGGTGGAAAGTGAAGGG + Intergenic
1092886188 12:12926480-12926502 CCAAAAAGGCAGAAAGTGATTGG - Intergenic
1094050505 12:26215431-26215453 CAGAAAAGGCAGAAATGGGGTGG + Intronic
1094131754 12:27082313-27082335 GACGGGAGGCAGAAAGTGGATGG + Exonic
1095143067 12:38690665-38690687 CAGAAAAGGAGAAAAGTGGAGGG + Intronic
1095992267 12:48043694-48043716 CCCAAAAGGCAGGCAGTTGAAGG + Exonic
1096160342 12:49371474-49371496 CACAACAGCCAAAAGGTGGAAGG - Intronic
1096273462 12:50185387-50185409 CACATTAGGAGGAAAGTGGAAGG + Intronic
1096380505 12:51153799-51153821 CACAACAGCCAAAAGGTGGAAGG - Intronic
1096516350 12:52157686-52157708 GACAAAAGGCAGAGACTGGCAGG + Intergenic
1097446293 12:59676695-59676717 AACAAAATGCAAAAAATGGAGGG + Intronic
1097574136 12:61370154-61370176 CTCACATGGCAGAAGGTGGATGG - Intergenic
1097960391 12:65526707-65526729 CACAAAAGGTGGAGAGTGTAGGG + Intergenic
1098728782 12:74005439-74005461 GACAAAATACAGAAAGTGCATGG - Intergenic
1099505983 12:83476554-83476576 CACATAAAGCAGATAGTTGAAGG - Intergenic
1100034773 12:90236899-90236921 GTCAACAGGCAGAAAGTGGGAGG - Intergenic
1100208857 12:92380502-92380524 GAGAAAATGCAGAAAGGGGATGG + Intergenic
1101320213 12:103666664-103666686 CCCAAAAGGGAAAAAGTAGATGG - Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102398600 12:112609488-112609510 AACAATAGGCAGGAGGTGGAAGG - Intronic
1102593043 12:113971785-113971807 CTCCAAAGGCTCAAAGTGGAAGG + Intergenic
1103861584 12:124019020-124019042 CCCAAAAGGCTGACAGTGAAGGG + Intronic
1103965393 12:124635880-124635902 CACAGAAGGCAGAAAGCAGCAGG - Intergenic
1104407467 12:128530089-128530111 TGAAAAAGGCAGAAAGTGGGCGG + Intronic
1105043313 12:132979106-132979128 CACAAATAGTAGAAAGTGAAAGG + Intergenic
1105284332 13:18992448-18992470 CAAAAAAGGCAGAAAGCCAAAGG + Intergenic
1105962423 13:25354300-25354322 AACAGAAGGCAGACTGTGGAAGG + Intergenic
1106636291 13:31531850-31531872 CCCAGAAGGCAGAAAATAGATGG - Intergenic
1107072495 13:36286333-36286355 CAAAAGAGGCAGAAGGTGGTTGG - Intronic
1107525918 13:41231131-41231153 TATTAAAGACAGAAAGTGGATGG + Intronic
1107526544 13:41237985-41238007 CACAAAATGCAAGAAGTTGAGGG + Intronic
1107728702 13:43326647-43326669 TACGAAAGGCACAAATTGGATGG - Intronic
1107782950 13:43924613-43924635 CACTTAAGGCAGAAAGTGAAGGG + Intergenic
1108503967 13:51092882-51092904 CAAAAATGGCAGAAAGGTGATGG - Intergenic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1108918863 13:55652781-55652803 CAAAAAAGAAAGAAAGGGGAGGG + Intergenic
1109008340 13:56907823-56907845 CACAAAGGAAAGAAAGTGAAAGG + Intergenic
1109192187 13:59338611-59338633 AAGACAAGGCAGAAAGTGGTTGG - Intergenic
1109497253 13:63189287-63189309 CACAAAAGATAGGAATTGGAAGG + Intergenic
1109923930 13:69108461-69108483 AACAAAAGTCAAAAAGTGGGGGG + Intergenic
1109996767 13:70137912-70137934 CAAACAAGACAGAAAGTGAAGGG + Intergenic
1110670862 13:78175917-78175939 CCCACGTGGCAGAAAGTGGAAGG + Intergenic
1111298122 13:86309782-86309804 CACAAAAGGAAAAAAAGGGAAGG + Intergenic
1111343248 13:86914934-86914956 CAGAAAAGACAGAAAGTACAGGG - Intergenic
1111365799 13:87243017-87243039 CACTCATGGCAGAAAATGGAAGG - Intergenic
1112009179 13:95279777-95279799 AAGAGAAGGCAGAAAGGGGATGG + Intronic
1112182924 13:97103140-97103162 CACTCATGGCAGAAAGTGAAGGG + Intergenic
1112429958 13:99342651-99342673 CAGAAAAGGCACCAAATGGAAGG - Intronic
1112516777 13:100060042-100060064 CAAAAAAGACAGAAAGAGAAAGG - Intergenic
1112894874 13:104286513-104286535 CACAAAAAGGAGAGTGTGGAGGG - Intergenic
1113350309 13:109523212-109523234 CAAAAAAGTAAGAAAGTTGATGG - Intergenic
1113937248 13:114001001-114001023 CTCAGAACGCAGAAAGTGGGGGG - Intronic
1114479695 14:23025065-23025087 GTCAGAAGGCAGAAAGTGGTTGG - Intronic
1114990700 14:28284805-28284827 AACATATGGCAGAAAGTGGAAGG + Intergenic
1115001438 14:28425281-28425303 TACTCATGGCAGAAAGTGGAAGG + Intergenic
1115069990 14:29309894-29309916 AACTAAGGGCAGAAAGTAGAAGG - Intergenic
1115182661 14:30647544-30647566 CAAAGCAGGCAGAAACTGGAGGG - Intronic
1115324349 14:32121772-32121794 CTGTAAAGGCAGAAAGTTGATGG - Intronic
1115782099 14:36781186-36781208 CACAATAAGCTGAAAGTGAAGGG - Intronic
1117095253 14:52290661-52290683 CTCATATGGCAGAAAATGGAGGG + Intergenic
1117881712 14:60319102-60319124 CAATCATGGCAGAAAGTGGAGGG - Intergenic
1118050891 14:62026429-62026451 CTCACATGGCAGAAGGTGGAAGG + Intronic
1119113351 14:71995942-71995964 CACAGAAGGCAGAAAGCACAGGG - Intronic
1119400320 14:74358388-74358410 CCCAAAAGGCAGAAGGTGACAGG - Exonic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1120287868 14:82527756-82527778 CACAGAATGCAGAATGTGTAAGG - Intergenic
1120737666 14:88071802-88071824 CACAAAAGGCAGAAAAAGTGTGG + Intergenic
1120982273 14:90300840-90300862 AAACAAAGGCAGAAAGGGGATGG + Intronic
1122518890 14:102328669-102328691 CATAGAAGACAGAAAGTCGAAGG - Intronic
1122847005 14:104505639-104505661 GACAAAAAGAAGAAAGAGGAAGG + Intronic
1123453522 15:20392012-20392034 AACAGAAGGCAGAAAAAGGAAGG - Intergenic
1123456187 15:20428042-20428064 GAGAAAATGCTGAAAGTGGATGG - Intergenic
1123635380 15:22302795-22302817 GAGAAAATGCTGAAAGTGGATGG + Intergenic
1123771453 15:23533902-23533924 CAAAAGAGGCAGAGAGTGGTCGG + Intergenic
1123828074 15:24103503-24103525 CACAAAAGCCAGAAAATGAATGG - Intergenic
1123842530 15:24262917-24262939 CACAAAAGGCAGAAAATGAATGG - Intergenic
1123843824 15:24276760-24276782 CACAAAAGGGGCAAAGTGTATGG - Intergenic
1123852100 15:24368934-24368956 CACAAAAGGCAGAAAATGAATGG - Intergenic
1123857566 15:24428976-24428998 CACAAAAGGCAGAAAATGAATGG - Intergenic
1123858900 15:24443042-24443064 CACAAAAGGGGCAAAGTGTATGG - Intergenic
1123862196 15:24479504-24479526 CACGAAAGGCATAAAATGAATGG - Intergenic
1123871870 15:24583727-24583749 CACAAAAGGAAGAAAATGACTGG - Intergenic
1123892733 15:24797657-24797679 CACAAAAGGCAGAAAATGGGTGG - Intergenic
1124195861 15:27628288-27628310 CAAGAAAGGAAGAAAGTGAATGG + Intergenic
1124496983 15:30192787-30192809 AACAAAAGGCAGATGCTGGAGGG + Intergenic
1124746593 15:32345860-32345882 AACAAAAGGCAGATGCTGGAGGG - Intergenic
1126925817 15:53585233-53585255 CAAACATGGCAGAAAGTGAAGGG + Intronic
1127267428 15:57373637-57373659 CACCCAAGGGAGAAAGAGGAGGG - Intergenic
1127505166 15:59590983-59591005 CACAAAAGGCAGGAAGTAGCTGG - Intergenic
1127750840 15:62041113-62041135 GACAAAAGGTAGAAAATGGAAGG - Intronic
1128179783 15:65591997-65592019 CACAAAGGGCAGCAAGTAGCTGG + Intronic
1128419481 15:67478086-67478108 CAGAAAAGGCAGACAGAGGCTGG + Intronic
1128885052 15:71279131-71279153 CAGGAAAGGGAGAAAATGGAGGG + Intronic
1128914460 15:71547121-71547143 AACAGAAAGCAGAAAGGGGAGGG - Intronic
1129167124 15:73784992-73785014 CACAGAAGGAAGCCAGTGGAAGG + Intergenic
1129428965 15:75484331-75484353 CACAAAAGGCAAAATATGAATGG + Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1130041884 15:80411921-80411943 CACAGAAGGCAGTAAATGGGAGG - Intronic
1130271294 15:82450304-82450326 TAGAGAAGGAAGAAAGTGGAGGG + Intergenic
1130489040 15:84417143-84417165 TAGAGAAGGAAGAAAGTGGAGGG - Intergenic
1130571433 15:85048483-85048505 CAGAAAAAGCATAAACTGGAGGG - Intronic
1131111707 15:89768559-89768581 TACAAAAAGAAAAAAGTGGAGGG - Intronic
1131528747 15:93174093-93174115 CACTCAAGGCAGAAGGTGAAGGG + Intergenic
1131866392 15:96715828-96715850 CATTAAAGGCAGTAAGTGGTAGG + Intergenic
1131951948 15:97690798-97690820 CAATCAAGGCAGAAAGTGAAGGG + Intergenic
1131975287 15:97939752-97939774 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1132209406 15:100008817-100008839 CAAAAACGGCACAAACTGGAGGG - Intronic
1133634111 16:7650013-7650035 GACAAAAGGAAGAAAGAGGGAGG + Intronic
1133821474 16:9241004-9241026 CACATATGGCAGAACGTGAAGGG - Intergenic
1133854567 16:9537416-9537438 TACAAGAGGCAGAAGGTAGAGGG - Intergenic
1134285672 16:12860155-12860177 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1134306489 16:13037704-13037726 AACAAAAGGCTGGAAGTGGGAGG - Intronic
1134408063 16:13979995-13980017 CCCAAAGGGCAGAAATTGGCTGG - Intergenic
1134628846 16:15742192-15742214 CAGAAAAGGTACAAAGTGAAAGG + Intronic
1135815331 16:25627416-25627438 CAATCATGGCAGAAAGTGGAGGG + Intergenic
1136590164 16:31213867-31213889 CAGAAAAGACAGAAAATTGAAGG - Intergenic
1137880691 16:52044474-52044496 CACAATAGGCTGCAAGTGAAGGG - Intronic
1138231205 16:55337768-55337790 CACTGAAGGGGGAAAGTGGATGG - Intergenic
1138291726 16:55853780-55853802 CACTAATGGCAGAGAGTGCATGG + Intronic
1138372342 16:56537264-56537286 CACAAAAGGCAAATATTGTATGG + Intergenic
1138436208 16:57001411-57001433 CTCAAGAGGCAGAAACAGGATGG + Intronic
1139206798 16:65036910-65036932 GACAAAAGGCAGAAAGAAGATGG + Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1141079712 16:81039221-81039243 TACTCAGGGCAGAAAGTGGATGG - Intronic
1141237648 16:82233568-82233590 TAGAGAAGACAGAAAGTGGAAGG - Intergenic
1141343303 16:83223299-83223321 CTCATATGGCAGAAAGTGGAAGG + Intronic
1142027863 16:87824129-87824151 CACAGAGGGGAGACAGTGGATGG - Intergenic
1142572798 17:886067-886089 CACAAAAGGCACAAAGAGGCTGG + Intronic
1143212449 17:5198638-5198660 CACAGCAGGAAGTAAGTGGAGGG + Intergenic
1143306049 17:5947507-5947529 AACAAAGGGCAGAAGGTGTAGGG - Intronic
1143505704 17:7363819-7363841 CCCAAGAGACAGAGAGTGGAAGG - Intergenic
1143694333 17:8600280-8600302 TATACAAGGCAGAAAGTGAAGGG + Intronic
1144048598 17:11477337-11477359 CACAAAAGACAGAAAGAAAATGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146004707 17:29154040-29154062 AGCAAATGGCAGAAATTGGAGGG + Intronic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1147341860 17:39757055-39757077 CACAGAAGACGGAAAATGGAGGG + Intergenic
1147379538 17:40045621-40045643 CACAAAATGCAAAAATTGGCCGG + Intronic
1148984629 17:51610991-51611013 CACAAAGGGCACACAGTGCAGGG - Intergenic
1149158575 17:53664061-53664083 CACCAAAGGGAGAAATTGGAAGG - Intergenic
1152029546 17:77833474-77833496 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1153468985 18:5421810-5421832 CTCAGAAGGCAGACAGTGGCGGG + Intronic
1153795430 18:8617694-8617716 AACAAAAGGCAGAGGCTGGAAGG - Intronic
1153883975 18:9446724-9446746 CACTCATGGCAGAAAGTGAAGGG - Intergenic
1154037068 18:10813492-10813514 CACAAAAGACAAATATTGGATGG - Intronic
1155142559 18:23056101-23056123 GAAAAGAGGTAGAAAGTGGAGGG - Intergenic
1155978610 18:32158104-32158126 CACAAAACGCAGAAAGCAAAAGG + Intronic
1157319532 18:46623696-46623718 CAGAAAAGGCAGACACTGGCAGG + Intronic
1157696148 18:49725376-49725398 CACAATAGCCACAAGGTGGAAGG - Intergenic
1158094511 18:53755531-53755553 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1158095319 18:53763636-53763658 CAAAAAAGGTAGAAAGAGGAAGG + Intergenic
1159119902 18:64156228-64156250 CACAGAATACAAAAAGTGGAAGG + Intergenic
1160004779 18:75061719-75061741 GACAAAGGGCAGACAGTGAAGGG + Intronic
1161084132 19:2326294-2326316 CACAAAAAGCAGAAAGGGTTTGG - Intronic
1161989376 19:7675890-7675912 TACAAAAGGCACAAAGTAGCTGG - Intergenic
1162085142 19:8244192-8244214 CAGAAAAGGCAGGAAATGGCTGG + Intronic
1162160866 19:8714725-8714747 CACAATAGGCTGAAAATGAAAGG - Intergenic
1162831854 19:13289793-13289815 TGCAAAAGGGAGAAATTGGAAGG - Intronic
1163188007 19:15653227-15653249 GAGAAAAGGAAGAGAGTGGAGGG - Intronic
1164324308 19:24178638-24178660 GACAGAGGGCAGAAAGTGGTGGG + Intergenic
1164796213 19:31033516-31033538 GACAACAGTAAGAAAGTGGACGG + Intergenic
1164883266 19:31754525-31754547 TACTCAAGGCAGAAGGTGGAGGG + Intergenic
1166259377 19:41627157-41627179 CAAAAAAGGCAGAAATGAGAGGG - Intronic
925265641 2:2564599-2564621 CAGTAAAGGCAGCAAGAGGAAGG - Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925681947 2:6431722-6431744 CACAGCAGGCAGCAAGAGGAGGG + Intergenic
925696405 2:6584678-6584700 CACTCATGGCAGAAAGTGAAGGG + Intergenic
926335976 2:11863211-11863233 CACAGAAGGAAGAAAGACGATGG - Intergenic
926358858 2:12066492-12066514 TAAAAGAGGCAGAAAATGGAAGG + Intergenic
926385926 2:12335790-12335812 CAGAAAAGGAGGAAAGTGAAGGG - Intergenic
926479684 2:13377123-13377145 GAGAAAATGCTGAAAGTGGATGG + Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926536281 2:14116922-14116944 AACAAAACTCAGAAAGTGGGTGG + Intergenic
926638743 2:15212398-15212420 CACCAAAAGAAGAAAGTGGAAGG - Intronic
926715753 2:15922243-15922265 CAAAAGAGGAAGGAAGTGGACGG + Intergenic
927223953 2:20743156-20743178 CACAAAAGGCAGAAAATATGTGG - Intronic
928433699 2:31240138-31240160 GACACAAGCGAGAAAGTGGATGG - Intronic
928623171 2:33111727-33111749 CTCAAAAGACAAAAAGTGGATGG - Intronic
929900542 2:45998753-45998775 CACAAAAGGCAGAAAATGAGTGG - Intronic
930182740 2:48380518-48380540 CACAATAGCCAAAAGGTGGAAGG + Intergenic
932518990 2:72388048-72388070 CACAACTGGCAGGAGGTGGAAGG + Intronic
932865438 2:75336503-75336525 CTCAAAAGTCAGAAAATGAAAGG - Intergenic
932882181 2:75513029-75513051 CAAAAAAGGCAGAAAATGGAAGG - Intronic
934649280 2:96081185-96081207 CACAAAAGGCAGAAAAAGAGTGG - Intergenic
934790541 2:97056034-97056056 CACAGAAGGCAGCGAGTGTAAGG - Intergenic
934815924 2:97326497-97326519 CACAGAAGGCAGCGAGTGTAAGG + Intergenic
934821771 2:97381986-97382008 CACAGAAGGCAGCGAGTGTAAGG - Intergenic
935286552 2:101568906-101568928 CATAAAAGGCAGAATTTGGGGGG - Intergenic
936694643 2:114931345-114931367 CACTCATGGCAGAAAGTGAAGGG + Intronic
936963639 2:118103949-118103971 CAGAGAAGGTAGAAAGGGGAAGG - Intronic
937145698 2:119642498-119642520 CAAACATGGCAGAAAGGGGAAGG + Intronic
937346290 2:121127843-121127865 CACATATGGCAGAAAGAGGCTGG - Intergenic
937509419 2:122577328-122577350 AAAGAAAGGCAGAAACTGGAAGG + Intergenic
939435124 2:142166158-142166180 CAGAATAGGCAGAAAATGCAAGG + Intergenic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
939728702 2:145754874-145754896 AAGAAAAGGCAGAAAATGGATGG - Intergenic
941312336 2:163949829-163949851 CAGAAAAGGCAGGAAATGCAGGG + Intergenic
941914335 2:170799974-170799996 CACTCATGGCAGAAAGTAGAAGG + Intergenic
942141550 2:172982316-172982338 GACAAAATGCACAAAATGGATGG + Intronic
942218922 2:173750326-173750348 GATTAAAGGCAGAAAGAGGAAGG - Intergenic
942492026 2:176498992-176499014 CAGAGAGGGGAGAAAGTGGAGGG - Intergenic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
942674253 2:178411020-178411042 CACAATAGCCAAAAGGTGGAAGG + Intergenic
943473330 2:188322910-188322932 GACAAAAGGCAGAACTTTGAAGG - Intronic
944038265 2:195324161-195324183 AACTCATGGCAGAAAGTGGAAGG - Intergenic
944067625 2:195635821-195635843 AACAAAAGGCAGATAATGAAAGG + Intronic
944641129 2:201727154-201727176 CACAAGAGGCAGAAAGAGCCAGG + Intronic
944786082 2:203071795-203071817 TCCAAAAGGGAGACAGTGGAAGG + Intronic
945460136 2:210097770-210097792 TACAAAAGGTACAAAGTGGAAGG + Intronic
945548085 2:211182976-211182998 TGTAAAAGCCAGAAAGTGGACGG - Intergenic
945758725 2:213883961-213883983 CTTAAAAGGCAGAGAGTGGTGGG - Intronic
945983029 2:216329784-216329806 CACAAAAGGTAGAAAGAAAAGGG + Intronic
946169736 2:217887739-217887761 CACACAAAGCTGGAAGTGGATGG + Intronic
946817831 2:223597465-223597487 AAGAAAAGGCAGAAAAGGGAAGG - Exonic
946823519 2:223653972-223653994 CTCAAAAGGCATAAAGAGTAAGG + Intergenic
947196278 2:227571219-227571241 AATAACAGGCAGAAACTGGAGGG + Intergenic
947887964 2:233590916-233590938 TACCAAAGGCAGAAAGTGTGTGG - Intergenic
948550233 2:238766049-238766071 CACAATAGGCAGAAAGGAGGAGG + Intergenic
948960871 2:241335805-241335827 CAGAGAAGTCAGAAAGGGGAAGG - Intronic
1168988228 20:2070053-2070075 CAAAAACGGGAGCAAGTGGAGGG + Intergenic
1169055915 20:2620900-2620922 ACCAAAAGGGAGAAAATGGAAGG - Intronic
1169293156 20:4370099-4370121 CACACATGACAGAAAGTGGCTGG - Intergenic
1169565776 20:6852128-6852150 CACACAAGGGAGAATTTGGAGGG + Intergenic
1170161356 20:13315096-13315118 CACGAAAGGCAGAAAAAGAATGG + Intergenic
1170481472 20:16769288-16769310 CACTCATGGAAGAAAGTGGAAGG + Intronic
1170491733 20:16883967-16883989 CACAAAAAGAAGAAAGAGAAAGG - Intergenic
1170610361 20:17907747-17907769 CTCACATGGTAGAAAGTGGAAGG + Intergenic
1171524869 20:25800943-25800965 CTCACATGGCAGAAGGTGGAAGG + Intronic
1171551958 20:26054940-26054962 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1171959042 20:31480672-31480694 CACAAAAGCCAGTTAGTGTATGG - Intronic
1172092428 20:32443493-32443515 CACTTAAGGCAAACAGTGGATGG - Exonic
1172192070 20:33068130-33068152 CACAAAGGGCAAAAGGTGAAAGG + Intronic
1172389500 20:34557575-34557597 CCCAAAAGGAAGAAATTAGATGG - Intronic
1172950534 20:38720532-38720554 AACAAAGGGCAGAAAGGGGCAGG - Intergenic
1173456489 20:43206573-43206595 CAATCATGGCAGAAAGTGGAGGG + Intergenic
1174925116 20:54750739-54750761 TACAATAGGCAGAAGGTGAAGGG + Intergenic
1175157864 20:56984704-56984726 CAAAAGAGGCAGAAACTGCAGGG + Intergenic
1175169145 20:57067764-57067786 AACAAAAGGCAGAGAGAAGAGGG - Intergenic
1175330850 20:58162765-58162787 CACCAGAGGCAGAAATGGGAGGG + Intergenic
1175896884 20:62340737-62340759 AACAAAAGGCAGAAACTGCCAGG + Intronic
1177833473 21:26166292-26166314 CACAGAAGACAGAAGGTGGCAGG - Intronic
1179262806 21:39773458-39773480 AAGAAAAGGAAGAAAGGGGAGGG - Intronic
1180214798 21:46317237-46317259 CAAGAACGGCAGAACGTGGAAGG - Exonic
1180254247 21:46612664-46612686 CACAAAAGGCAGAAAAAGTGTGG - Intergenic
1180636100 22:17264307-17264329 CACAAAAGGCAGGGAAAGGAAGG + Intergenic
1180677355 22:17596482-17596504 CACTCATGGCAGAAGGTGGAAGG - Intronic
1180741454 22:18055878-18055900 CACAAAATGCAGATAGAGGCCGG - Intergenic
1181364483 22:22364524-22364546 AACACAAGGCATATAGTGGAGGG + Intergenic
1181506295 22:23360479-23360501 CACAAATGGCAAAGAGTGCATGG + Intergenic
1182068922 22:27449591-27449613 AACAACAGGCATAAACTGGATGG - Intergenic
1182474039 22:30566216-30566238 CTCAAAAGGCAGAAGGTCAATGG - Intronic
1182504786 22:30773928-30773950 CACAAATGGCAGCAGCTGGAGGG - Intronic
1183134564 22:35873998-35874020 ATCAAAAGGGAGAAATTGGAAGG + Intronic
1183232616 22:36592369-36592391 TGCAAAAGACAGAGAGTGGAGGG + Intronic
1183258452 22:36778275-36778297 AACAAAAGGGAGACAGTGGGTGG - Intergenic
1183757222 22:39779761-39779783 TACAAAAGTCAAAATGTGGAGGG + Intronic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
949104611 3:188817-188839 CAAAACAGGCAGATAGTGAAGGG - Intergenic
949141134 3:634652-634674 CACTCATGGCAGAAAGTGAAGGG + Intergenic
949586922 3:5449935-5449957 ATCAAAGGTCAGAAAGTGGAAGG - Intergenic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
950021347 3:9789848-9789870 CCCAAGAAGCAGAAACTGGAAGG - Exonic
950150452 3:10682783-10682805 AACAAAGAGCTGAAAGTGGAAGG + Intronic
950667468 3:14506065-14506087 TCCCAAAGGCAGGAAGTGGAGGG - Intronic
951908302 3:27724321-27724343 CACAAAACGCAGGAAGCGCAGGG - Intergenic
951938904 3:28055433-28055455 CACAGAGGGCAGAAAGTGGAAGG - Intergenic
952126524 3:30306970-30306992 CACTCATGGCAGAAAGTGAAAGG + Intergenic
953025434 3:39142291-39142313 AACAGAGGGCAGGAAGTGGAGGG + Exonic
953193023 3:40706787-40706809 CACAAAAGGCAGAAAAAATATGG - Intergenic
953560373 3:43985444-43985466 CACTCATGACAGAAAGTGGAAGG - Intergenic
954076500 3:48185715-48185737 CACAAAAGGCAGCAGGGTGAAGG + Intronic
955505700 3:59631012-59631034 AACAAATGGCAGAAACTGGGAGG + Intergenic
956235696 3:67068754-67068776 CAAAAATGGCAGAAGGTGAAAGG + Intergenic
956545777 3:70400463-70400485 AACTCATGGCAGAAAGTGGAAGG - Intergenic
956758358 3:72412960-72412982 CTCACATGGCAGAAGGTGGAAGG - Intronic
956857038 3:73285514-73285536 GGCAAAAGGCAGAAAGAAGAGGG - Intergenic
957151351 3:76490141-76490163 CATAAAAAGGAGGAAGTGGAAGG - Intronic
958832496 3:99106550-99106572 CACACATGGCAGAAAGCAGAAGG + Intergenic
958869188 3:99537233-99537255 CAAAGAAGACAGAAAGTGGAGGG - Intergenic
959063126 3:101633708-101633730 CAGAAAAGGCAGGATGCGGAAGG - Intergenic
959337481 3:105084251-105084273 GAGAAAAGGCAGAGAGTGGTTGG + Intergenic
959395138 3:105827603-105827625 AGCCAAAGGCAGAAAGGGGAGGG + Intronic
959633717 3:108537551-108537573 CTCACGTGGCAGAAAGTGGAAGG - Intergenic
959897104 3:111617424-111617446 CTCAGAAGGGAGAAAGTGCATGG - Intronic
959977696 3:112480566-112480588 GGCAGAAAGCAGAAAGTGGAAGG + Intronic
960015988 3:112888704-112888726 TCCAAAAGGCAGATAGTGAAGGG + Intergenic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960651133 3:119951273-119951295 CAAAAAATGCTGAAAGTGGCAGG + Intronic
961484387 3:127206971-127206993 CCCAAGAGGCAGAGAGAGGAGGG - Intergenic
962057628 3:131888751-131888773 TTCAAAATGCAGAGAGTGGAGGG + Intronic
962887785 3:139643434-139643456 CACAGTAGCCAGAAGGTGGAAGG + Intronic
963423085 3:145087225-145087247 CTCACATGACAGAAAGTGGAAGG + Intergenic
965133881 3:164737436-164737458 CACTCATGGCAGAAAGTGAATGG - Intergenic
966192515 3:177284309-177284331 TACAGAAGGCTGAAAGTGGATGG + Intergenic
966275086 3:178155822-178155844 CACTGAAGGGAGAAAGCGGAGGG + Intergenic
966453323 3:180086712-180086734 CTCAAATGGCAGAAAGTAGAAGG - Intergenic
967245380 3:187481398-187481420 GACCCAAGGCAGAAAGGGGATGG - Intergenic
968113933 3:196074583-196074605 TTAAAAAGGCATAAAGTGGACGG + Intronic
968880888 4:3299447-3299469 AAAAGCAGGCAGAAAGTGGAGGG - Intronic
969053607 4:4388305-4388327 CACAAAAGGAACAAAGAGGAAGG - Intronic
970166441 4:13243194-13243216 CACAAAAGAAAGAGAGAGGAAGG + Intergenic
970856173 4:20651372-20651394 CACAAAAGACAGAAAGTCTTGGG + Intergenic
971034254 4:22675880-22675902 CACAAAAGGCAGAATGGGTAGGG + Intergenic
971272749 4:25166045-25166067 CTCACATGGCAGAAGGTGGAAGG - Intronic
971484369 4:27144230-27144252 CACAAAAGGAAGCAGGTGTAAGG - Intergenic
971581979 4:28353136-28353158 GACAAAAGGCAAACTGTGGAAGG - Intergenic
971597664 4:28552352-28552374 CTCAAATGGCAGAAAGCAGAAGG - Intergenic
971709687 4:30094403-30094425 GCAAGAAGGCAGAAAGTGGAGGG + Intergenic
971945671 4:33273530-33273552 CTCACATGGCAGAAGGTGGAAGG - Intergenic
972168140 4:36312164-36312186 CACAAAATCCAGAAAGTGCCAGG + Intronic
972247417 4:37259805-37259827 GAGAAAAGGCAGAGAGTGGGAGG + Intronic
972332040 4:38073042-38073064 CACAATAGCCAAAAGGTGGAAGG - Intronic
972776097 4:42242020-42242042 AACAAAAGGCAGAAGGAGGGAGG + Intergenic
973926243 4:55741111-55741133 CACAAAAGGCAGAAAAAGTTTGG + Intergenic
974988536 4:69058672-69058694 CAAAAATTGCAGAAAATGGAAGG + Intronic
975773969 4:77763291-77763313 CACAAAAGGTTGAAAGTAAATGG + Intronic
975926031 4:79454820-79454842 CAGAAAAGCCAGTAAGTGGCTGG - Intergenic
976916938 4:90387796-90387818 CACATAGGGTAGAAACTGGAAGG - Intronic
976980418 4:91218997-91219019 GACAAAAGACAGAACATGGAGGG + Intronic
976995970 4:91434333-91434355 CTCAATAGGCAGAAAATTGATGG + Intronic
977952210 4:102985385-102985407 CACAAAAGGCAGGAAAAGAATGG - Intronic
979090385 4:116476781-116476803 GATAGACGGCAGAAAGTGGAAGG + Intergenic
979380927 4:120005775-120005797 TACACATGGCAGAAAGTGAAGGG - Intergenic
979785033 4:124705818-124705840 CACTAAAGGCCTAAAGTGGGAGG + Intronic
980035367 4:127877234-127877256 CACAAAGGGATGAAAGTGGCCGG + Intergenic
981698358 4:147581523-147581545 CTCACATGGCAGAAGGTGGAAGG - Intergenic
981857832 4:149315630-149315652 CACTAATGGCGGAAAGTGAAGGG + Intergenic
982145286 4:152381844-152381866 CATGAAAGGCAAAAAGTTGATGG - Intronic
982267179 4:153548697-153548719 AGGTAAAGGCAGAAAGTGGAGGG + Intronic
982452277 4:155567147-155567169 AACATAAGGCAGAAAATGGCAGG + Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982670506 4:158314386-158314408 GACAAAATGCTGAATGTGGATGG - Intergenic
983500635 4:168495390-168495412 CTCACATGGCAGAAGGTGGAAGG - Intronic
984442102 4:179785162-179785184 CACAAAAGGCAGAAAATGTGTGG - Intergenic
984803297 4:183733779-183733801 CAGAAAAGGAAGAAAGGGGAAGG - Intergenic
986035908 5:3938987-3939009 CACAAAAGGCAGAAAAAGTATGG - Intergenic
986426721 5:7638980-7639002 CACAGATGGCAGCAAGTGGAGGG - Intronic
986642615 5:9887497-9887519 CTCAACAGGCAGATAGTGAAGGG - Intergenic
987540884 5:19253593-19253615 AACAAAAGGAAGAAAGATGAAGG + Intergenic
987743023 5:21934772-21934794 GAGAAAAGGAAGAATGTGGAGGG - Intronic
987803087 5:22723208-22723230 TACAAAAGGTAGAAAGGGGTTGG + Intronic
987839221 5:23201163-23201185 CACAAAAGGCAGAAAAAGTTTGG + Intergenic
987874240 5:23658529-23658551 CAAAAAAGTCAAAAAGTGAAGGG + Intergenic
989461979 5:41711106-41711128 CACAAAAGGCAGAAAAAGAGTGG - Intergenic
989788238 5:45358005-45358027 CACTCATGGCAGAAAGTGAAGGG - Intronic
990167447 5:53010427-53010449 TTCAAAAGGCAGCAATTGGAAGG - Intronic
990327050 5:54688305-54688327 CACAAAAGGCAGAAAAAGAGTGG - Intergenic
990378782 5:55201002-55201024 CACAAAAGGCAGAAAAAGAACGG + Intergenic
991188808 5:63844037-63844059 CACAGAAGGCCAAAAGTGCAAGG - Intergenic
991221526 5:64224900-64224922 CTCACATGGCAGAAGGTGGAAGG - Intronic
992308466 5:75467992-75468014 AACAAAATGCAAAAAGTGGTTGG + Intronic
992501062 5:77344550-77344572 CTCACATGGCAGAAAGTGCAAGG + Intronic
993082812 5:83322760-83322782 CACAAAAAGCTGGAAGAGGAAGG + Intronic
994609063 5:102012746-102012768 TACAAAAGGCAGAGACTGGTAGG - Intergenic
994728083 5:103460112-103460134 CAAAACAGGCAGAAAATGAAAGG - Intergenic
995015111 5:107301195-107301217 CAAAAAAGACAGAAGTTGGAGGG + Intergenic
995104267 5:108355785-108355807 CACAAAAGGCAGAAAAAGTATGG + Intronic
995265550 5:110154920-110154942 ACCAAAAGTCAAAAAGTGGAGGG + Intergenic
996182191 5:120432577-120432599 CTCACATGGCAGAAGGTGGAAGG - Intergenic
996199800 5:120657817-120657839 AACAAAAAGCAGAAGGTGGGAGG - Intronic
996205594 5:120731614-120731636 CAGAAAAGACAGAAAATGCAAGG + Intergenic
996394519 5:122999985-123000007 TACCAAAGGCAGAAAGTTGTGGG + Exonic
997489480 5:134261536-134261558 CACAAAAGCAAGAAAGTGAATGG - Intergenic
997622289 5:135306749-135306771 CAGAAAAGGCAGGGAGGGGATGG - Intronic
998480338 5:142457968-142457990 CAATCATGGCAGAAAGTGGAGGG - Intergenic
998714083 5:144862232-144862254 CACAAGAGGTAGAAAATGTATGG - Intergenic
999848075 5:155507210-155507232 CAAAAATGTCAGAAATTGGATGG - Intergenic
999860055 5:155634989-155635011 CAGAAAAGGAAAAAAGTTGATGG + Intergenic
999895446 5:156027941-156027963 CTCATATGGCAGAAGGTGGAAGG + Intronic
1000160980 5:158597549-158597571 CACACATGGCAGAAAGTGGAAGG + Intergenic
1000213375 5:159130787-159130809 CACAGAAGGCTGATAGGGGATGG + Intergenic
1000246801 5:159454885-159454907 AAAAAAAGAAAGAAAGTGGAAGG - Intergenic
1001538331 5:172516239-172516261 CACAAAAGGCAGAAAAATGGTGG + Intergenic
1001636224 5:173212279-173212301 CACAATAGCCAAAAGGTGGAAGG + Intergenic
1001910566 5:175513982-175514004 CACAGACGGCAGAGCGTGGATGG + Intronic
1001926104 5:175638368-175638390 GACAACAGCAAGAAAGTGGAAGG - Intergenic
1001947233 5:175789838-175789860 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1002173679 5:177389372-177389394 CACAAGAAGCAGCAAGGGGAAGG - Intronic
1002394008 5:178939455-178939477 CAAAGAAGGCAGACAGTGGTGGG - Intergenic
1002638232 5:180618534-180618556 CAGACAAGGCAGGCAGTGGAGGG - Intronic
1002933796 6:1654331-1654353 CAAAACAGCCAGAATGTGGAGGG + Intronic
1003670642 6:8154650-8154672 CAGAAGAGGCAGAGAGTGGAAGG + Intergenic
1003962652 6:11223244-11223266 CACAAAAGGCAGAGATTTGATGG - Intronic
1004307045 6:14510416-14510438 CACTGAAGGCAGACAGTGGTTGG - Intergenic
1004703631 6:18102510-18102532 CTCAAAAGGCAGAAGTTGCAGGG - Intergenic
1004989325 6:21119143-21119165 CTCAACAGGAAGAAAGAGGAAGG - Intronic
1005245542 6:23880306-23880328 CACAGAATGCAGTAAGTGCATGG - Intergenic
1005355794 6:24982000-24982022 CTCATAAGGCAAAAAGTTGAGGG - Intronic
1005695114 6:28344625-28344647 TACTAAAGGCTGAAAATGGATGG + Intronic
1006349948 6:33513625-33513647 CTCAGAAGGCAGCAGGTGGAGGG - Intergenic
1006482423 6:34307701-34307723 CACAAAAGGCAGAGAAAGAATGG + Intronic
1006546278 6:34784599-34784621 CAAAAAAGGAATAAAGTGGGAGG + Intergenic
1006698095 6:35948913-35948935 CCCACATGGCAGAAGGTGGAAGG - Intronic
1007958498 6:45938217-45938239 CACACAGAGCAGAAAGGGGATGG + Intronic
1009034235 6:58097287-58097309 GACAAAATGCTGAATGTGGATGG + Intergenic
1009209843 6:60848988-60849010 GACAAAATGCTGAATGTGGATGG + Intergenic
1009331173 6:62422583-62422605 CTCAGGTGGCAGAAAGTGGAAGG - Intergenic
1010029360 6:71257184-71257206 CAGAAAAGGCACAAAAAGGAAGG + Intergenic
1010117163 6:72327438-72327460 CGCAAAAGTCAAAAAGTGGATGG - Intronic
1010125009 6:72421439-72421461 AACTCATGGCAGAAAGTGGAAGG + Intergenic
1010145896 6:72669289-72669311 CACAAAAGGGAAAAATCGGAAGG + Intronic
1010469818 6:76214149-76214171 AATAAAAGGAAGAAAATGGAAGG - Intergenic
1011930088 6:92700930-92700952 CCCATAGGGCAGCAAGTGGAGGG + Intergenic
1012724081 6:102786044-102786066 GACAAAAAGCAGAAGGTGAATGG - Intergenic
1012887559 6:104862396-104862418 AACAAAAGGCAGGAAATGGGTGG + Intergenic
1013070882 6:106728335-106728357 CTCAAAAGGCTGAATGTGGAGGG - Intergenic
1013262680 6:108461802-108461824 CACAAAAGGCTGGCAGTGCACGG + Intronic
1013267028 6:108509773-108509795 CCCAAAAGGGAGAGAGGGGAGGG + Intronic
1013688307 6:112610754-112610776 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1014231322 6:118905595-118905617 CACAAAAGGCTGTTAGTGGCAGG - Intronic
1014262722 6:119238003-119238025 AAGAAAAGGCAGAAAGAGCAGGG - Intronic
1014415463 6:121178020-121178042 CAATCATGGCAGAAAGTGGAAGG + Intronic
1014927700 6:127294411-127294433 AACAAAAGGGAGAAAGTGCCAGG - Intronic
1015308795 6:131741696-131741718 GGAAAAAGGCAGAAAGAGGAAGG + Intronic
1015455875 6:133425534-133425556 CAAAACAGGAAGAAAGTGGAGGG - Intronic
1015806570 6:137115805-137115827 TACAACAGGCAGAGAGAGGAAGG - Intergenic
1015974756 6:138778596-138778618 CAAAGATGGCAGTAAGTGGAAGG + Intronic
1015977028 6:138800969-138800991 CTCACATGGCAGAAGGTGGAAGG + Intronic
1016643104 6:146373393-146373415 CAGAAAAGAGAGAAAGTGAAGGG + Intronic
1017109564 6:150919599-150919621 CAAGAATGGCAGAAAGTGAAGGG + Intronic
1017621117 6:156298600-156298622 CACAAAAGGCAGAAAAAGAGTGG + Intergenic
1017770909 6:157644024-157644046 GACAAGAGACAGAAAGAGGAGGG - Intronic
1018410543 6:163541932-163541954 CATAAAATGCAAAAAGAGGAAGG - Intronic
1018431119 6:163723564-163723586 CGCAAAAGGCAGAATGGGGTTGG + Intergenic
1018547353 6:164952345-164952367 CAGAAGTGGCAGAAGGTGGAAGG - Intergenic
1018694095 6:166377042-166377064 CATAAAAGGCAGAAAAAGAATGG - Intronic
1018726331 6:166615860-166615882 CACAAAGGGCAAAGAGTGGGCGG - Intronic
1019624615 7:2009654-2009676 CACAACAGGCAGTCAGTGCACGG + Intronic
1019691976 7:2420443-2420465 CACAATAGCCAAAAGGTGGAAGG - Intronic
1020452647 7:8337415-8337437 CACTAAAGCCAATAAGTGGAAGG - Intergenic
1020742795 7:12043132-12043154 CAAATAAGGTAGAAAGTGAATGG - Intergenic
1021065546 7:16167993-16168015 CATAAAAAGAAGAAAGGGGAAGG - Intronic
1021377454 7:19925354-19925376 CAGAAGAGGGAAAAAGTGGATGG + Intergenic
1023021331 7:36014382-36014404 CACAAAAGGAAGAAGTTGAATGG - Intergenic
1023155133 7:37242957-37242979 CAAAACAGGCAGAAGGTAGAGGG - Intronic
1023295927 7:38715162-38715184 AACTCATGGCAGAAAGTGGAAGG + Intergenic
1023672127 7:42588136-42588158 CACAAAAGGTGGAAGGTGAAGGG - Intergenic
1023763435 7:43488309-43488331 CAAAAAAGAAAGAAAGAGGAAGG + Intronic
1023896865 7:44441238-44441260 CACAACAGTCAGTATGTGGAGGG + Intronic
1024594868 7:50923642-50923664 CACAAAAAGTAGAAACTGGATGG - Intergenic
1025272036 7:57531119-57531141 CAAAAATGGCATAAACTGGATGG - Intergenic
1025285530 7:57657543-57657565 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1026068123 7:67093468-67093490 CCTAAAACTCAGAAAGTGGAAGG - Intronic
1026120432 7:67532126-67532148 TTCCAAAGGGAGAAAGTGGAAGG + Intergenic
1026219331 7:68378983-68379005 AACTCATGGCAGAAAGTGGAAGG - Intergenic
1026289219 7:68990896-68990918 CACAAAAGGCAAAAATGGAAGGG + Intergenic
1026336592 7:69399025-69399047 CACACATGGCAGAAAGCAGAAGG - Intergenic
1026403909 7:70044418-70044440 CAAAAAAGGCAGAGGGTGGGGGG - Intronic
1026667448 7:72355227-72355249 TACAAAAGGCACAAATTGGCCGG + Intronic
1026708798 7:72718839-72718861 CCTAAAACTCAGAAAGTGGAAGG + Intronic
1026884764 7:73933699-73933721 CTCAAATGGCAGAAAGGGGAGGG + Intergenic
1029366948 7:100122712-100122734 CTGAAATGGCAGAAAGGGGAAGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030192025 7:106819722-106819744 CACAAAAGCCAGAAGCTGCATGG - Intergenic
1030456569 7:109782022-109782044 CACAAAGGGCAAAAAGTGCTTGG + Intergenic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1030940483 7:115640870-115640892 CATAAAAGTAAGAAAGTGCAAGG - Intergenic
1032242760 7:130177626-130177648 CAATACAGGAAGAAAGTGGACGG + Intronic
1032682771 7:134202561-134202583 CACAATAGCCAAAAGGTGGAAGG + Intronic
1033284536 7:140028936-140028958 CACAAAAGGGATAAAAGGGATGG + Intronic
1033481658 7:141747834-141747856 CACAAAATGCAAAAAGTAGCCGG + Intronic
1033768794 7:144524874-144524896 AACAAAAGGCAAAGAGTGAACGG - Intronic
1034362778 7:150515174-150515196 CACAACAGCCAGTGAGTGGAGGG - Intronic
1034783154 7:153900474-153900496 CACTCATGGCAGAAGGTGGAGGG + Intronic
1035136563 7:156709096-156709118 CACAAAAGACATAAAGTCTAGGG + Intronic
1035206734 7:157298538-157298560 GACAACAGGCAGAGAGGGGACGG + Intergenic
1035985839 8:4430852-4430874 CACAGAAGGCAAAGAGTGGAGGG - Intronic
1036020978 8:4846003-4846025 CAAAGAAGTGAGAAAGTGGATGG - Intronic
1036149679 8:6285966-6285988 CACAAAAGGCAGTAAGTCAGGGG - Intergenic
1036449484 8:8853307-8853329 CCCAAAAGGTAGAAAGGGGCAGG - Intronic
1036499298 8:9298522-9298544 CAGAAGAGACAGAAAGTGAAGGG - Intergenic
1036502739 8:9328650-9328672 TACTAATGGCAGAAAGTGAAGGG + Intergenic
1037024019 8:14009815-14009837 CTCACAGGGCAGAAAGTGGAAGG - Intergenic
1037131596 8:15413351-15413373 TCCAAAAGGGAGAAATTGGAAGG + Intergenic
1037315314 8:17594888-17594910 CACAACAGCCAGAAGGTGGAAGG - Intronic
1037365823 8:18121500-18121522 TCCAAAAGACAGAAATTGGAAGG + Intergenic
1037371593 8:18184790-18184812 CACATATGGCAGAAAGTGGAAGG - Intronic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1037726820 8:21489553-21489575 CACAATAGTCAAAAACTGGAAGG + Intergenic
1037844068 8:22266963-22266985 GGCAAAAGGCAGAAATTGGTTGG - Intergenic
1038512255 8:28149861-28149883 CACAAAGGGCAGAAAAAGAATGG - Intronic
1039037151 8:33372300-33372322 CACAAAAGGCAGTAAGTATGTGG + Exonic
1039540270 8:38361457-38361479 AACAAAAGACAGAAAGGGGCCGG + Intronic
1039857997 8:41433029-41433051 ACCAAAAGGCAGAAAAAGGAAGG + Intergenic
1040962996 8:53054270-53054292 CCCAAAAGGCAGAGAGAAGAAGG - Intergenic
1041254619 8:55969162-55969184 CACAGGAGGCTGAAAGTGGGAGG + Intronic
1041411805 8:57564668-57564690 TTAAAAAGGCAGAAAGTGGCTGG + Intergenic
1042096381 8:65220360-65220382 CTCACACGGCAGAAGGTGGAAGG - Intergenic
1042383884 8:68150885-68150907 CACCAAAGGCCAAAAGAGGAAGG - Intronic
1042552200 8:70004092-70004114 GAGAAAAGGGAGAAAGTGGTAGG + Intergenic
1042647247 8:71000878-71000900 CACTAAAGGCAGAAATGAGAGGG + Intergenic
1042650351 8:71033753-71033775 CACTCATGGCAGAAAGTGGAAGG - Intergenic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1043138554 8:76558565-76558587 CTCATGTGGCAGAAAGTGGAAGG - Intergenic
1043228317 8:77763843-77763865 CACAAATGGCAGAGAGGGAAAGG + Intergenic
1043234916 8:77852289-77852311 CACAAAAGGCAGAAAATATGTGG - Intergenic
1043765753 8:84130063-84130085 CAAAAGAGGCAGGAAGAGGAGGG - Intergenic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1046276207 8:111964064-111964086 CACAAAATTCAGAATCTGGATGG - Intergenic
1046334702 8:112770326-112770348 CTCATATGGCAGAAGGTGGAAGG - Intronic
1047599562 8:126412691-126412713 CACTCATGGCAAAAAGTGGAAGG - Intergenic
1047986485 8:130240130-130240152 CACAAAAGGAAGTAGGTAGATGG - Intronic
1048786961 8:138060841-138060863 GACAAAAGGCTGAATGTGGGGGG + Intergenic
1048841966 8:138574539-138574561 CCCACATGGCAGAAAGTAGAAGG + Intergenic
1049176087 8:141193532-141193554 CCGAAAAGGGAGAAATTGGAAGG + Intronic
1049523974 8:143111360-143111382 AAAAAAAGGTAAAAAGTGGATGG - Intergenic
1050763723 9:9106554-9106576 CACAAAAGGCAGCCGATGGAGGG + Intronic
1051153184 9:14108004-14108026 GACAAAAGACAGACAATGGAAGG + Intronic
1051606575 9:18923041-18923063 AAAAAAAGGCAGAAAAAGGAGGG + Intergenic
1051643827 9:19248754-19248776 CAAAACAGAGAGAAAGTGGAAGG - Intronic
1051674947 9:19549473-19549495 GACAGAAGGCAGAAACTGCATGG - Intronic
1051814601 9:21090466-21090488 CACAAAAGGCAGAAAAAGAGTGG - Intergenic
1051842578 9:21414814-21414836 CACAAAATGCAGTAAATGGAAGG + Intronic
1052201282 9:25784261-25784283 AAGAAAATGCAGAAAGTGGAGGG - Intergenic
1052729926 9:32273500-32273522 CACAAATGGCAGGAAGTGTGTGG - Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1053119871 9:35538531-35538553 CACAATGGGCAAAAAGAGGAGGG + Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053523231 9:38803200-38803222 CACTCATGGCAGAAAGTGGATGG + Intergenic
1054195459 9:62027619-62027641 CACTCATGGCAGAAAGTGGATGG + Intergenic
1054642948 9:67561070-67561092 CACTCATGGCAGAAAGTGGATGG - Intergenic
1056008458 9:82300355-82300377 CACAAAAAGGAGAAAGAGAAAGG - Intergenic
1056423335 9:86451786-86451808 CTCAAATGGCAGAAGGTAGAAGG + Intergenic
1056649061 9:88442303-88442325 CAAAAAAGGAAGATAGTAGAGGG - Intronic
1057330761 9:94112809-94112831 CTCACATGACAGAAAGTGGAAGG - Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057474249 9:95385190-95385212 CTCACACGGCAGAAAGTGGACGG + Intergenic
1057642115 9:96834591-96834613 AACTCATGGCAGAAAGTGGAAGG - Intronic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1057688834 9:97264494-97264516 CACAATAGCCAAAATGTGGAAGG + Intergenic
1058217085 9:102248178-102248200 CACAAAATGGAGAATGAGGAAGG - Intergenic
1058293897 9:103280498-103280520 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1058531394 9:105908791-105908813 CAAGAAAGGAAGCAAGTGGAGGG + Intergenic
1058533094 9:105926202-105926224 AACAAAAGGGGGAGAGTGGAGGG + Intergenic
1058602324 9:106683529-106683551 GACATAAAGCAGAATGTGGAAGG - Intergenic
1059170803 9:112122913-112122935 CACAAGAGACAGAAAGTAGAAGG + Intronic
1060011600 9:120048329-120048351 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1060570460 9:124634430-124634452 AACAAGAGACAGAAAATGGAAGG - Intronic
1060946154 9:127570090-127570112 GTCAACAAGCAGAAAGTGGATGG - Intronic
1061136171 9:128735186-128735208 CACAAACGCTGGAAAGTGGAGGG + Intronic
1061421811 9:130476846-130476868 GAAAAAAGACAGAAAGTGGTGGG - Intronic
1186056833 X:5658192-5658214 CACAAATGCTAGAAACTGGATGG - Intergenic
1186554593 X:10544408-10544430 CACTAAATGCACAATGTGGAAGG + Intronic
1186716275 X:12255269-12255291 CACACAAGGTAGAAAAAGGAAGG + Intronic
1186923934 X:14311512-14311534 CACAAAAGCCAAAAATTGTATGG + Intergenic
1187263676 X:17710782-17710804 CAGTAAAGGCAGAATGTGCATGG + Intronic
1187324586 X:18274615-18274637 CACAGAGGGCAGATAGTAGAGGG - Intronic
1187335915 X:18381626-18381648 CACAAAAAGCAGAAAAAGCATGG - Intergenic
1188372863 X:29390048-29390070 TAAAAAAGGAAGAAAATGGAAGG + Intronic
1188627249 X:32299896-32299918 CACAAAAAGCAGAAACTAGGAGG - Intronic
1188821650 X:34782786-34782808 TATAAAAGGCAGAAAGTAAATGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189934078 X:46047061-46047083 CACAAAAGGCAGAAAAATAATGG + Intergenic
1190002724 X:46705151-46705173 CACACAGGGGAGAAAGGGGAAGG + Intronic
1190913423 X:54792110-54792132 CACATGAGGTAGAAAGAGGAGGG + Intronic
1191110623 X:56800865-56800887 GACAGAAGGCAGATAGGGGAGGG - Intergenic
1191711905 X:64158784-64158806 GACCAAAGGCAGAAAGGGGCGGG - Intergenic
1191855808 X:65625716-65625738 ATCAAAAGGCAGAAATTGGCAGG - Intronic
1192139052 X:68631935-68631957 CCAAAAAGTTAGAAAGTGGAAGG + Intergenic
1192313337 X:70034004-70034026 AACAAATGGGAGAAAGAGGAAGG - Intronic
1193843619 X:86440680-86440702 CACACAAAGCAGAAAAAGGATGG - Intronic
1193860393 X:86658917-86658939 CACAAAAGTCAGAAAAAGCAGGG - Intronic
1193964050 X:87961576-87961598 CACAAAAGACAGAAAGTGTTGGG + Intergenic
1194376653 X:93142888-93142910 CAATCATGGCAGAAAGTGGAGGG - Intergenic
1194941989 X:100021841-100021863 CAAAAAAGGTAAAAAGTGGGGGG + Intergenic
1195835070 X:109104809-109104831 CATAAAAAGCTGAAAATGGAAGG - Intergenic
1196069607 X:111506204-111506226 GATATAAGGCAGAAAGGGGAGGG - Intergenic
1196202831 X:112905479-112905501 CACAAAAGGCAGAAAAAAGGTGG + Intergenic
1196538742 X:116880547-116880569 AACAAAAGGCAAAAAGTGGAGGG - Intergenic
1197091094 X:122538657-122538679 AAGAAACGGCAGAAAGAGGATGG + Intergenic
1197257081 X:124274963-124274985 CCCAAGAGGCAGCAAGGGGAGGG + Intronic
1197748951 X:129952140-129952162 CAGAAAAGGCTGACAGTGGAAGG - Intergenic
1198061866 X:133053980-133054002 CAGAAAAGTCAGAAAGTACAAGG + Intronic
1198476937 X:137003918-137003940 CACAAAGTGCAGAAAGAGGCTGG + Intergenic
1198929031 X:141833137-141833159 CACAGATGTCAGAAAGTAGAAGG - Intergenic
1199106257 X:143872863-143872885 TACAAAAGGCAGAGAGGGGTGGG + Intergenic
1199423769 X:147677127-147677149 CAGAAACGGGAGAGAGTGGAAGG - Intergenic
1200164881 X:154029124-154029146 AACAAAAGGCAGAAATGGAAGGG + Intronic
1200227119 X:154424314-154424336 CACAAAAGGCAGAGTGTGCATGG + Intergenic
1200829871 Y:7679496-7679518 CATAAACGGCAGAAAGTTGAAGG + Intergenic
1200957968 Y:8970565-8970587 CACAAATGGCAGAGGGAGGAGGG - Intergenic
1201018061 Y:9624827-9624849 CATAAACAGCAGAAAGTTGAAGG + Intergenic
1201060012 Y:10036835-10036857 CATAAACAGCAGAAAGTTGAAGG + Intergenic
1201613260 Y:15866640-15866662 CTCAAAATGCAGTATGTGGATGG + Intergenic
1201930339 Y:19338105-19338127 CACAGAAAGTAAAAAGTGGATGG - Intergenic
1202109618 Y:21406309-21406331 CATAAACAGCAGAAAGTTGAAGG + Intergenic
1202187621 Y:22203901-22203923 GACAGAAGGGAGAAAGTGAAAGG - Intergenic
1202197058 Y:22307281-22307303 CATAAACAGCAGAAAGTCGAAGG - Intergenic
1202203739 Y:22382495-22382517 GACAGAAGGGAGAAAGTGAAAGG + Intronic
1202282825 Y:23208316-23208338 AAAAAAAGGAAGGAAGTGGAGGG + Intergenic
1202434499 Y:24822701-24822723 AAAAAAAGGAAGGAAGTGGAGGG + Intergenic