ID: 949925871

View in Genome Browser
Species Human (GRCh38)
Location 3:9041198-9041220
Sequence ATCCAGACTCTACACTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949925871_949925876 19 Left 949925871 3:9041198-9041220 CCTGCTAAGTGTAGAGTCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 949925876 3:9041240-9041262 CTTCAAGTCTAAGTTTACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
949925871_949925877 20 Left 949925871 3:9041198-9041220 CCTGCTAAGTGTAGAGTCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 949925877 3:9041241-9041263 TTCAAGTCTAAGTTTACCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 141
949925871_949925878 27 Left 949925871 3:9041198-9041220 CCTGCTAAGTGTAGAGTCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949925871 Original CRISPR ATCCAGACTCTACACTTAGC AGG (reversed) Intronic
901225754 1:7612099-7612121 ATCCTGACTCTCCACTGAGCTGG - Intronic
904065807 1:27749826-27749848 ATCCAGAATCTGCACTGGGCTGG - Intronic
905068615 1:35205852-35205874 ACCCTGACTCTCCACTGAGCTGG - Intergenic
907549268 1:55290456-55290478 ATCCAGGCTTTAGACTTACCAGG - Intergenic
910442047 1:87262830-87262852 ATCCAGGCGCTACACAAAGCTGG - Intergenic
916462231 1:165037462-165037484 ATCCAGACTCAAGTCTCAGCAGG + Intergenic
923254647 1:232211163-232211185 ATCCAAGCCATACACTTAGCAGG + Intergenic
923975450 1:239257161-239257183 ACCCTGACTCTCCACTGAGCTGG - Intergenic
1062805256 10:414682-414704 ATACACACTCTAAAATTAGCTGG - Intronic
1066272560 10:33837698-33837720 ACCCTGACTCTCCACTGAGCTGG + Intergenic
1070758454 10:79008151-79008173 GTCCAGATTGTACACTTAGTAGG - Intergenic
1072478602 10:95787582-95787604 ATCCAGAGCCTGCACTTAACTGG - Intronic
1075848702 10:125568227-125568249 ACCCTGACTCTCCACTGAGCTGG + Intergenic
1078963721 11:16311682-16311704 CTCCAGAGTCTACACTCAGTAGG + Intronic
1081935577 11:46901625-46901647 ATCCAGACTATTGGCTTAGCAGG + Intronic
1082901606 11:58259839-58259861 ATCCTCACTCTACCCTTACCAGG + Intergenic
1087934221 11:104013347-104013369 ATCCTGACTCTCCACTGAGCTGG + Intronic
1088101611 11:106162019-106162041 ATCCAGACTCAAGACTCAACTGG - Intergenic
1089376339 11:117997626-117997648 CTCCAGAGTCTAAACTGAGCTGG - Intronic
1089490584 11:118881080-118881102 TTCAAGACTCTATACTTGGCAGG - Intergenic
1098758311 12:74391513-74391535 ACCCTGACTCTCCACTGAGCTGG - Intergenic
1099508829 12:83508975-83508997 ATTCTGACTCTCCACTGAGCTGG - Intergenic
1099759096 12:86894599-86894621 ATCCATAGTCTAGACTGAGCAGG + Intergenic
1100163526 12:91890363-91890385 ATCTAGACTTTAGACTTGGCTGG + Intergenic
1100692845 12:97057253-97057275 TACTAGACTCTATACTTAGCTGG + Intergenic
1101550233 12:105754640-105754662 ACCCCGACTCTCCACTGAGCTGG - Intergenic
1105526802 13:21185373-21185395 ATCCAAATTCAATACTTAGCTGG - Intergenic
1108159087 13:47619055-47619077 ATCCTGACTCTCCACTGATCTGG + Intergenic
1109941794 13:69377091-69377113 ATCCTGACTCGCCACTGAGCTGG - Intergenic
1112171463 13:96977023-96977045 ACCCTGACTCTCCACTGAGCTGG - Intergenic
1112882609 13:104125809-104125831 ATCCAGATACTTCACTTAACAGG - Intergenic
1113319082 13:109214531-109214553 ATCCATCTTCTACACTTTGCTGG + Intergenic
1114268665 14:21088213-21088235 ATCCAGACTGTAGCCTCAGCTGG - Intronic
1114827501 14:26099087-26099109 ATCCAGATTCTTCACATGGCTGG + Intergenic
1116121097 14:40723056-40723078 ACCCTGACTCTCCACTGAGCTGG - Intergenic
1116479753 14:45383767-45383789 AACCTGACTCTCCACTGAGCTGG + Intergenic
1118687855 14:68309749-68309771 ATCCAGCCTCTACCATTAGTTGG - Intronic
1121022201 14:90587121-90587143 ATCCATTCTCCACATTTAGCTGG + Intronic
1123134927 14:106018750-106018772 ATGTAGACTTTACACTTAGATGG + Intergenic
1123585476 15:21756625-21756647 ATGTAGACTTTACACTTAGATGG + Intergenic
1123622117 15:22199213-22199235 ATGTAGACTTTACACTTAGATGG + Intergenic
1124027087 15:25976767-25976789 ATCCTGACCCTCCACTGAGCTGG - Intergenic
1125744630 15:41989984-41990006 ATCCAGACTGTGCACACAGCTGG - Intronic
1128293904 15:66500618-66500640 ACCCCAACTCTACAATTAGCCGG + Intronic
1132822337 16:1880993-1881015 ATCCACACTGCACACTTTGCAGG - Intronic
1134907350 16:17991713-17991735 ATCCAGACTCTAAAATTTACTGG - Intergenic
1141811971 16:86382012-86382034 ATCCAGATTCTAGACTTTTCTGG - Intergenic
1145261475 17:21357343-21357365 ATCCAAACTTCAGACTTAGCTGG + Intergenic
1145748428 17:27337777-27337799 ATGCAGACTCTGGACTTGGCCGG - Intergenic
1146606790 17:34266674-34266696 ATCCATACCCTACATTTACCAGG - Intergenic
1148255257 17:46125504-46125526 ATCTAGACTCTAGATTTAGGGGG - Intronic
1155695735 18:28683924-28683946 ATCCAGACTCTACCCGTGCCTGG + Intergenic
1160149487 18:76388272-76388294 ACCCTGACTCTCCACTGAGCTGG + Intronic
1162617923 19:11816602-11816624 AGCCAGTCACTTCACTTAGCTGG + Intronic
1162621893 19:11850038-11850060 AGCCAGTCACTTCACTTAGCTGG + Intronic
1166690452 19:44819152-44819174 ATCCAGACCCCAAACTCAGCTGG + Exonic
1166989814 19:46685311-46685333 ATCCAGACTCAAATCTTGGCTGG + Intronic
927322371 2:21762420-21762442 ATCCTGACTCTCCACTGAGCTGG - Intergenic
928664467 2:33536965-33536987 ACCCTGACTCTCCACTGAGCTGG - Intronic
932821972 2:74909241-74909263 ACCCTGACTCTCCACTGAGCTGG + Intergenic
933846175 2:86328921-86328943 ACCCTGACTCTCCACTGAGCTGG - Intronic
934555191 2:95283298-95283320 ATCCAGACTCTCCTGTGAGCTGG - Intronic
934791733 2:97067927-97067949 ATCTTGACTCTCCACTGAGCTGG - Intergenic
936483206 2:112905046-112905068 ATACTGACTGTACACTTATCTGG + Intergenic
936647572 2:114389212-114389234 ATCCTGACTCTTCACTGAGTTGG + Intergenic
937275489 2:120681465-120681487 GACCAGACCCTACACTGAGCTGG - Intergenic
938512074 2:131960531-131960553 ATCAAGACCCTACACTCGGCTGG + Intergenic
939245116 2:139613319-139613341 ACCCTGACTCTCCACTGAGCTGG + Intergenic
941135530 2:161713196-161713218 TTCAAGATTCTACACTTATCTGG - Intronic
943746014 2:191463477-191463499 ACCCTGACTCTCCACTGAGCTGG - Intergenic
944945411 2:204678360-204678382 ACCCTGACTCTCCACTGAGCTGG - Intronic
945339887 2:208639967-208639989 ACCCTGACTCTTCACTGAGCTGG + Intronic
945911712 2:215657366-215657388 ATCCAGGCCCTACCCTTAGGGGG - Intergenic
946609430 2:221441594-221441616 ACCCCGACTCTCCACTGAGCTGG + Intronic
947296009 2:228631269-228631291 ATGCAGACTGTCCACTTATCTGG + Intergenic
1171089693 20:22271998-22272020 ATCAAGACTCTGCCCTTTGCGGG + Intergenic
1175135155 20:56817881-56817903 GTGGAGACTCTACACTTATCAGG + Intergenic
1177605025 21:23367093-23367115 ACCCGGACTCTCCACTGAGCAGG - Intergenic
1177979400 21:27891386-27891408 ATCAAGACCCTACACTCAGCTGG - Intergenic
1178317345 21:31577840-31577862 ATCAAGACTCTTCTCTTGGCTGG + Intergenic
1181329834 22:22081300-22081322 ATCCAGAATCTGCACATAGTAGG - Intergenic
1182397348 22:30046030-30046052 ACCCTCACCCTACACTTAGCGGG + Intergenic
949925871 3:9041198-9041220 ATCCAGACTCTACACTTAGCAGG - Intronic
951501354 3:23390590-23390612 TTCCTGACTCTCCACTGAGCTGG + Intronic
951991208 3:28677864-28677886 ATCCTGACCCTACACTGAGCTGG - Intergenic
952039186 3:29241178-29241200 ACCCTGACTCTCCACTGAGCTGG - Intergenic
957292495 3:78295262-78295284 ACCCTGACTCTCCACTAAGCTGG + Intergenic
959572282 3:107897573-107897595 ATCTAGCCACTACACTTGGCAGG - Intergenic
974859997 4:67508661-67508683 ATCCAGCCTCTACCATTAGCTGG - Intronic
979727575 4:123982689-123982711 ACCCTGACTCTCCACTGAGCTGG - Intergenic
980212892 4:129812873-129812895 ATCCAGAATCTACTTTGAGCAGG - Intergenic
980871494 4:138615911-138615933 ACCCTGACTCTCCACTGAGCTGG + Intergenic
981541254 4:145848727-145848749 ATCCAGACACCTCACTGAGCTGG + Intronic
982851500 4:160322280-160322302 ATCCAGGCTTTACGCATAGCTGG - Intergenic
986174018 5:5336798-5336820 ATCCTGGCCCTGCACTTAGCCGG - Intergenic
987926566 5:24350055-24350077 ACCCTGACTCTCCACTGAGCTGG - Intergenic
987926689 5:24350948-24350970 ACCCTGACTCTCCACTGAGCTGG - Intergenic
988523328 5:31965274-31965296 CTCCAGCCTCTACACATACCTGG - Intronic
989558624 5:42825749-42825771 ACCCTGACTCTCCACTGAGCTGG + Intronic
992160065 5:73992509-73992531 ACCCTGACTCTCCACTGAGCTGG - Intergenic
997453535 5:134002156-134002178 ATCCAACCTCTACCCTTACCAGG - Intronic
999652144 5:153778007-153778029 ATCCAGCCTCTCCACTCAGAGGG - Intronic
999668461 5:153937167-153937189 ACCCTGACTCTCCACTGAGCTGG - Intergenic
999926551 5:156385090-156385112 ATCCAGAGTCTGCATTTAGATGG + Intronic
1000303516 5:159975722-159975744 AGCCAGAGTCTACATTTTGCTGG + Intergenic
1000490883 5:161912102-161912124 ATCCTGACTCTACCTTTAGCTGG - Intergenic
1001616564 5:173047767-173047789 ACCCTGACTCTCCACTGAGCTGG + Intergenic
1002141098 5:177139779-177139801 ATCCTGTCTCTACACTCAGTTGG + Intronic
1004906102 6:20238641-20238663 ATCCTGACCCTCCACTGAGCTGG - Intergenic
1006579542 6:35068879-35068901 CTCCAGACTTTACACTCGGCCGG - Intronic
1007932069 6:45700473-45700495 ACCCTGACTATACACTGAGCTGG + Intergenic
1010494190 6:76513664-76513686 ACCCTGACTCTCCACTGAGCTGG - Intergenic
1011412805 6:87083452-87083474 CTCCAGACCCAACACTTAGTAGG + Intergenic
1012769012 6:103405127-103405149 ACCCTGACTCTCCACTGAGCTGG - Intergenic
1014812381 6:125901696-125901718 ACCCTGACTCTCCACTAAGCTGG - Intronic
1014825833 6:126047608-126047630 ACCCTGACTCTCCACTGAGCTGG + Intergenic
1015194449 6:130510169-130510191 ACCCTGACTCTTCACTGAGCTGG - Intergenic
1017633582 6:156422690-156422712 ACCCTGACTCTCCACTGAGCTGG - Intergenic
1019822365 7:3254680-3254702 ATCCTGTCTCTAAAGTTAGCCGG - Intergenic
1023465674 7:40451807-40451829 ATCCACACGCTACACATAACTGG - Intronic
1024188257 7:46976911-46976933 ACCCAGGCTCTACACTATGCAGG - Intergenic
1027706172 7:81536066-81536088 ACCCTGACTCTCCACTGAGCTGG + Intergenic
1030235138 7:107250589-107250611 AACCAGACTCTAGAATTATCAGG + Intronic
1030387191 7:108878367-108878389 ACCCTGACTCTACACTGAGCTGG + Intergenic
1030799494 7:113831732-113831754 ATAAATACTCTATACTTAGCAGG + Intergenic
1033403080 7:141045891-141045913 ATTCAGACACAACACTGAGCTGG + Intergenic
1037663434 8:20945776-20945798 ATCCAGGCTCTGCACTTCCCAGG - Intergenic
1037943464 8:22972158-22972180 ATCCAGGCTCTACTCTTAACAGG - Intronic
1041784451 8:61616196-61616218 TTCCAGCCTCTACACTTCCCTGG + Intronic
1042449910 8:68932360-68932382 GCCCTGACTCTACCCTTAGCTGG - Intergenic
1042601415 8:70503034-70503056 ACCCTGACTCTCCACTGAGCTGG - Intergenic
1043414537 8:80033778-80033800 AGCCAGACTCAACACTCATCAGG - Intronic
1043702034 8:83300963-83300985 ACCCTGACTCTCCACTGAGCTGG + Intergenic
1045392061 8:101725550-101725572 ACCCTGACTCTCCACTGAGCTGG + Intronic
1046396853 8:113651297-113651319 ACCCTGACTCTCCACTGAGCTGG + Intergenic
1046582549 8:116111028-116111050 ACCCTGACTCTCCACTGAGCTGG + Intergenic
1051665576 9:19464762-19464784 CTCCAGACACTACACTCATCGGG - Intergenic
1052231968 9:26164864-26164886 ACCCTGACTCTCCACTAAGCTGG + Intergenic
1054777500 9:69135900-69135922 ATTAAGACCCTACACTTGGCTGG - Intronic
1186032100 X:5379114-5379136 ATCCTGACTCTCCACTGAGCTGG + Intergenic
1187056777 X:15748156-15748178 CTCCTTACTGTACACTTAGCTGG + Intronic
1187313726 X:18172219-18172241 ATCCAGATTCAACATTTAGCAGG + Intronic
1188750018 X:33893568-33893590 ACTCAGACTCTTCAGTTAGCAGG + Intergenic
1189536407 X:41939777-41939799 AACAAGACTCTACAATTAGAAGG - Intergenic
1190569404 X:51766333-51766355 ACCCTGACTCTCCACTCAGCTGG + Intergenic
1191579759 X:62747449-62747471 ATCCAGAATCTACAATGACCTGG + Intergenic
1192285073 X:69726940-69726962 ATTCTGACTCTCCACTGAGCTGG - Intronic
1194364940 X:93003504-93003526 ACCCTGACTCTTCACTGAGCTGG + Intergenic
1194493362 X:94578369-94578391 CCCCAGGCTCTACAATTAGCCGG - Intergenic
1196348123 X:114691937-114691959 ATTCAGAATCTTCCCTTAGCAGG - Intronic
1198322785 X:135535751-135535773 AGCCAGAGTCTAAATTTAGCAGG - Intronic
1198633002 X:138663026-138663048 GTCCAGACTCTAGACTTTGAGGG - Intronic
1200673169 Y:6119758-6119780 ACCCTGACTCTTCACTGAGCTGG + Intergenic