ID: 949925873

View in Genome Browser
Species Human (GRCh38)
Location 3:9041222-9041244
Sequence TGAAGTTAGGCAACCTGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949925873_949925881 25 Left 949925873 3:9041222-9041244 CCAATCCAGGTTGCCTAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 949925881 3:9041270-9041292 GTTCCACCTCCACAAACACAAGG 0: 1
1: 0
2: 1
3: 20
4: 167
949925873_949925876 -5 Left 949925873 3:9041222-9041244 CCAATCCAGGTTGCCTAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 949925876 3:9041240-9041262 CTTCAAGTCTAAGTTTACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
949925873_949925883 30 Left 949925873 3:9041222-9041244 CCAATCCAGGTTGCCTAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 949925883 3:9041275-9041297 ACCTCCACAAACACAAGGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 226
949925873_949925878 3 Left 949925873 3:9041222-9041244 CCAATCCAGGTTGCCTAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 130
949925873_949925877 -4 Left 949925873 3:9041222-9041244 CCAATCCAGGTTGCCTAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 949925877 3:9041241-9041263 TTCAAGTCTAAGTTTACCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949925873 Original CRISPR TGAAGTTAGGCAACCTGGAT TGG (reversed) Intronic
901776314 1:11562852-11562874 GGAAGTTATGCAACCTTGCTGGG + Intergenic
902182805 1:14702265-14702287 TGAACTTAGAAAACTTGGATGGG + Intronic
903138874 1:21326778-21326800 TGCAGTTACGGAGCCTGGATGGG + Intronic
906484562 1:46224180-46224202 TGAAATTAGGAAACTTAGATGGG + Intergenic
907725597 1:57017443-57017465 TGGAGTGAGGCACCCTGCATTGG - Intronic
908324719 1:63012542-63012564 TGGGATTAGGCAACCTGGCTTGG + Intergenic
908836948 1:68237928-68237950 TGAACCCAGGCAACCTGGAAGGG + Intergenic
916440566 1:164820642-164820664 TGTATTTAGTCAACCTGGCTGGG - Intronic
920208811 1:204313388-204313410 TGGAGGTAGGCATCCTGGAGTGG - Intronic
921661851 1:217811818-217811840 TGATATTAAGCAACTTGGATGGG + Intronic
921788288 1:219259480-219259502 GGCATTTAGGCAAACTGGATGGG + Intergenic
1063866352 10:10368994-10369016 TCAAGTTAGCCAATCTGGAAGGG - Intergenic
1068853474 10:61771564-61771586 TGTAGTAAGGTATCCTGGATGGG + Intergenic
1071746790 10:88429146-88429168 TGAAGTCAGGAAACCTGGGTTGG + Intronic
1071945669 10:90641739-90641761 TGAAGTTAGGCCACCTGAAGGGG - Intergenic
1072644201 10:97239609-97239631 TGTAGTGTGGCACCCTGGATTGG + Intronic
1073934505 10:108615017-108615039 TGAGGTTAGGTAAGCTGGTTGGG - Intergenic
1075338439 10:121625995-121626017 TGAAGCTAGTGAACCTGAATAGG + Intergenic
1079030237 11:16981385-16981407 TGAAGTCAGGCCAACTGGGTTGG - Intronic
1079122376 11:17695389-17695411 TGAAGTTTGGCTGCCTGGAGGGG + Intergenic
1080922705 11:36724799-36724821 TGAACTTACGCAACATGGTTGGG + Intergenic
1082856330 11:57810556-57810578 TGAGCTTAGGCAACCTGCCTCGG + Intronic
1083815321 11:65129612-65129634 TGTAGATAGGCAGCCTGAATTGG + Intronic
1085689801 11:78655710-78655732 TGATGTCAGGCAGCCAGGATGGG + Exonic
1086855929 11:91865812-91865834 TGAAGTCAAGCAACCAGGCTTGG + Intergenic
1090078158 11:123592370-123592392 AGAAGTTAAGCAACTTGGAGTGG - Intronic
1090578664 11:128136414-128136436 TGGAGTTAGGAGACCTGGAGAGG - Intergenic
1091164996 11:133467762-133467784 AGAAGTTGGGCACCCTGAATTGG - Intronic
1095388847 12:41681237-41681259 TGATGTTAGATAACATGGATTGG - Intergenic
1096270805 12:50165088-50165110 TGTAGTTAGTCATCCTGGAGTGG - Intronic
1097730202 12:63120669-63120691 TGAAGTTAAGCAACTTGCAAGGG - Intergenic
1097939087 12:65284155-65284177 TGCTGTTAGGGAACTTGGATTGG + Intronic
1099345197 12:81491250-81491272 TGAAAGTAAGAAACCTGGATTGG - Intronic
1100372985 12:93986137-93986159 TGAAGTTAGGAATTATGGATTGG - Intergenic
1105614685 13:22001070-22001092 TGAAGTGAGGCAGCCTGGTGTGG - Intergenic
1107125724 13:36843760-36843782 TGAAGGATGGCAACTTGGATCGG + Intergenic
1107570860 13:41656922-41656944 TGAAGTTAGGAAATAAGGATGGG - Intronic
1111026310 13:82530865-82530887 TGAAGTTAGGCAACCATCAAAGG + Intergenic
1118813481 14:69292260-69292282 AGGAATGAGGCAACCTGGATGGG - Intronic
1128195395 15:65749249-65749271 TGGAGTTCTGCAACCTGAATTGG + Intronic
1129312665 15:74723420-74723442 TGGAATTAGGCAACTTGGCTTGG - Intronic
1133622558 16:7540362-7540384 TGAAGTCAGGCAATCTGTACAGG - Intronic
1133662397 16:7931196-7931218 TGAAGTTTGAGAGCCTGGATGGG + Intergenic
1133816600 16:9202429-9202451 TGAAGTTCGGCCACTGGGATTGG - Intergenic
1134755595 16:16664646-16664668 TGCAGTGTGGCACCCTGGATTGG - Intergenic
1134990471 16:18694515-18694537 TGCAGTGTGGCACCCTGGATTGG + Intergenic
1135867701 16:26119529-26119551 TGAGGTTAGGGAGCCTGGAGTGG + Intronic
1136467874 16:30457573-30457595 GGAAGCTAGGGAACCTGGAATGG + Intergenic
1142735493 17:1896201-1896223 TGAAGTCAGGCTGCCTGGGTTGG - Intronic
1143249757 17:5514551-5514573 TGCTGTTAGGCCACCTGGACTGG + Intronic
1146110009 17:30080778-30080800 TGAACTTGGGGAACATGGATTGG - Exonic
1147621672 17:41872169-41872191 AGTACTTAGGCAACCTGGAGTGG + Exonic
1148697629 17:49570628-49570650 TGGAGTCCGGCAGCCTGGATTGG - Intergenic
1148771406 17:50069245-50069267 CAAAGTTATGAAACCTGGATTGG + Intronic
1150379601 17:64710030-64710052 CAAAGTCAGGCAACCAGGATAGG + Intergenic
1150821310 17:68436415-68436437 TGAAGTCAGGCTTCCAGGATAGG + Exonic
1152496771 17:80678670-80678692 TGAAGTTAGAAAACGTGAATGGG - Intronic
1156830966 18:41490624-41490646 TAAAGCTAGGGAACATGGATTGG + Intergenic
1156842847 18:41629778-41629800 AGAAGTCAGGAAACCTGGCTTGG - Intergenic
1156917063 18:42474092-42474114 TGAAGTATGGCAGCCGGGATTGG + Intergenic
1158908821 18:62039710-62039732 TGATGTGCGGCACCCTGGATGGG - Intergenic
1158908892 18:62039939-62039961 TGATGTGCGGCACCCTGGATGGG - Intergenic
1158908976 18:62040202-62040224 TGATGTGCGGCACCCTGGATGGG - Intergenic
1163631709 19:18420934-18420956 TGAAGTTGAGCCACCTGGAGTGG + Intronic
925914308 2:8593899-8593921 TGCAGTTAAACAACCTTGATAGG + Intergenic
927865036 2:26582806-26582828 TGAAGTAAGGCATTCTGGAGGGG - Exonic
928633379 2:33216783-33216805 TGAAGTTAGACCACCTCAATGGG - Intronic
931233358 2:60392674-60392696 AGAACTTTGGCAACCTGGGTTGG + Intergenic
934757565 2:96834809-96834831 TGCAGTATGGCATCCTGGATTGG - Intronic
944545164 2:200791712-200791734 TGAAGTTTGAAAGCCTGGATTGG - Intergenic
944565717 2:200988981-200989003 TGGAATTAAGCAGCCTGGATAGG + Intronic
948085027 2:235240332-235240354 TGAAGCTAGGTCACCTGCATTGG + Intergenic
1170471326 20:16670939-16670961 AGAAGTAAGGAAACCTGGCTGGG + Intergenic
1175374212 20:58513856-58513878 TGGAGTTAGACCACCTGGCTGGG - Intronic
1177490496 21:21819646-21819668 TGAAGTATGGCAACCTGGACGGG - Intergenic
1177643668 21:23875823-23875845 TGAAGTACGGCCACCGGGATTGG + Intergenic
1178721265 21:35011665-35011687 TGAAGTGATGAAACATGGATGGG - Intronic
1178908972 21:36659051-36659073 GGAAGTGAGGCAAGCAGGATGGG - Intergenic
1179397564 21:41055777-41055799 TGAGGTCAGGCAGCCTGGATGGG - Intergenic
949468580 3:4369682-4369704 TGGATTTAAGCAACCTGTATTGG - Intronic
949925873 3:9041222-9041244 TGAAGTTAGGCAACCTGGATTGG - Intronic
950906495 3:16543787-16543809 TGGAGTAAGGCAAACTGGATGGG - Intergenic
952024002 3:29057092-29057114 TGAAGTATGGCCACTTGGATTGG + Intergenic
953880863 3:46690712-46690734 TGGAGTTAGCCAACCTGTGTGGG + Intronic
955530861 3:59871743-59871765 GGAAATTAGGCTACCTGGATTGG - Intronic
957096461 3:75781221-75781243 TGAAGTTTGGCCACTGGGATTGG - Intronic
958443644 3:94187772-94187794 TGAAAGAAGCCAACCTGGATAGG - Intergenic
962408069 3:135117189-135117211 TGAAGTTAGGTAAAGTGGACAGG + Intronic
962608900 3:137056393-137056415 TGATGTTAGGAACCCTGGTTTGG - Intergenic
965714182 3:171585201-171585223 TGAAGGTAGGCAACTTGTATGGG - Intergenic
966895293 3:184440313-184440335 AGAAATTAGGCAAACTGGAGAGG - Intronic
969658282 4:8510425-8510447 TGGAGGGAGGCCACCTGGATTGG - Intergenic
970244424 4:14044542-14044564 TGGAGTTAGGCTACTTGGGTTGG + Intergenic
970681479 4:18513573-18513595 TGAAGTTATGCAAGATGGAAAGG - Intergenic
977466689 4:97390980-97391002 AGAAGTTAAGCAACCTGCACTGG - Intronic
977982692 4:103343962-103343984 TGGAATTTGGCAACATGGATTGG - Intergenic
978042840 4:104091513-104091535 TGCAGTTTGGCACCCTGGACTGG + Intergenic
979939348 4:126740335-126740357 TGAATTTAGGCAAACTGGCCAGG - Intergenic
987493626 5:18614929-18614951 TGAAGTTTGGCAATCTGTTTGGG - Intergenic
990356863 5:54976190-54976212 TGAAGGTAGGAAAGATGGATGGG - Intergenic
993003849 5:82410300-82410322 AGAAGCTAGGAAACCTGGGTTGG - Intergenic
994131220 5:96230281-96230303 AGTAGGTAGGGAACCTGGATTGG - Intergenic
996818500 5:127599563-127599585 TGGAGTAAGGCAAGCAGGATGGG + Intergenic
998025093 5:138810092-138810114 TGAAGCGAGGCAACATGGTTCGG + Exonic
999736393 5:154516495-154516517 TAAATTTAGGCAACCTGGCCGGG - Intergenic
1000989956 5:167901494-167901516 TGAAGTCAGTCTGCCTGGATTGG + Intronic
1005506554 6:26474221-26474243 TGAAGTTCGGCTACTGGGATTGG - Intronic
1006359516 6:33579586-33579608 GGAATTTAGGCCACTTGGATGGG - Intronic
1006834709 6:36990716-36990738 TGAAGTGAGGCAGCCTGCACAGG + Intergenic
1007283356 6:40729097-40729119 TGCAGCTGGGCAACCTGGGTGGG + Intergenic
1007777758 6:44233274-44233296 TGGGGTTAGGCAGCCAGGATGGG + Intronic
1008715808 6:54288472-54288494 TGAAGTTAGGAAAGTGGGATTGG + Intergenic
1010831943 6:80541752-80541774 TGAGGTTAGGAGACCTGGGTTGG - Intergenic
1010985268 6:82416123-82416145 TAAAGTTACAAAACCTGGATGGG + Intergenic
1011794803 6:90940874-90940896 TGAGTTTGGGCAACCAGGATTGG + Intergenic
1012908866 6:105097278-105097300 GGAGGTTAGGAAACCAGGATTGG + Exonic
1014822193 6:126002776-126002798 TGAAGTTAGTCACCTAGGATAGG - Intronic
1015739405 6:136437312-136437334 TGGAGGTAGGAAACCTGCATTGG - Intronic
1018235575 6:161720376-161720398 TGAACTTATGCATCCTGAATTGG + Intronic
1019819355 7:3230282-3230304 AGAAGTTAGGAAAGCTGGAAGGG - Intergenic
1025046421 7:55695901-55695923 TGAAATTAGGGCACTTGGATGGG - Intergenic
1025971143 7:66326711-66326733 TGAAGTTGGACAAGATGGATTGG - Intronic
1028091730 7:86710954-86710976 TGGAGCCAGACAACCTGGATAGG - Intronic
1032142624 7:129347019-129347041 TGAAGTAAGCCAACCTGAAAAGG + Intronic
1032404049 7:131643048-131643070 TTCAGTTAGGCAGCCTGGATGGG - Intergenic
1034087877 7:148337004-148337026 TGAAATTAGGCAACATATATAGG + Intronic
1034518902 7:151603684-151603706 TGATTTTAGGCACCCTGGATAGG - Intronic
1035774987 8:2181390-2181412 TGAATTGAGGCAGCCTGGAGTGG + Intergenic
1042656027 8:71097484-71097506 TGAAATTAGGAAACATGGAAGGG - Intergenic
1044360166 8:91273687-91273709 GGAAGGTAGGCAACTTGGAAAGG + Intronic
1045282626 8:100762200-100762222 TGAAGATAGGCAACCTTAAATGG - Intergenic
1046206421 8:111004019-111004041 TGAAGTTAGAATATCTGGATTGG + Intergenic
1047400921 8:124546640-124546662 TAAAGTTAACCAACTTGGATTGG + Intronic
1047762564 8:127964953-127964975 TGAAGTTAAGAATCTTGGATAGG - Intergenic
1047884967 8:129239583-129239605 TTAAGTTAGGCAACCTAAGTAGG - Intergenic
1052391196 9:27880573-27880595 TGAATTGAAGCAATCTGGATTGG - Intergenic
1058470774 9:105276538-105276560 TTAAGTTAGGAAACGGGGATGGG + Intronic
1058958362 9:109969860-109969882 TGAAGCTAGGCATCCTGGTGGGG - Intronic
1186837706 X:13453939-13453961 TAACATTAGGCAACCGGGATGGG - Intergenic
1187156341 X:16723563-16723585 GGAAGTGGGGCTACCTGGATAGG + Intronic
1199030456 X:142992725-142992747 TGAAGTTAGATTTCCTGGATTGG - Intergenic