ID: 949925874

View in Genome Browser
Species Human (GRCh38)
Location 3:9041227-9041249
Sequence AGACTTGAAGTTAGGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949925874_949925883 25 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925883 3:9041275-9041297 ACCTCCACAAACACAAGGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 226
949925874_949925877 -9 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925877 3:9041241-9041263 TTCAAGTCTAAGTTTACCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 141
949925874_949925881 20 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925881 3:9041270-9041292 GTTCCACCTCCACAAACACAAGG 0: 1
1: 0
2: 1
3: 20
4: 167
949925874_949925885 26 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925885 3:9041276-9041298 CCTCCACAAACACAAGGTGAGGG 0: 1
1: 0
2: 0
3: 31
4: 257
949925874_949925876 -10 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925876 3:9041240-9041262 CTTCAAGTCTAAGTTTACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
949925874_949925878 -2 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949925874 Original CRISPR AGACTTGAAGTTAGGCAACC TGG (reversed) Intronic
901953343 1:12766328-12766350 AGACCTGAAATTATGAAACCAGG - Intergenic
903400872 1:23046839-23046861 AGACTGGTATTTAGGCAACTTGG + Intronic
903723804 1:25425942-25425964 AGCTTTGGAGTTAGGCAACCTGG + Intronic
905180065 1:36160107-36160129 AGGCTGGAAGTTAGGCCACAGGG + Intronic
906670768 1:47652913-47652935 AGACTTGCACTAAGGGAACCAGG + Intergenic
908516304 1:64896271-64896293 ACACTTGAATTTAGCCAAACTGG + Intronic
908537159 1:65089253-65089275 AGACTTGAAATTAGGGGACCTGG - Intergenic
908839585 1:68265117-68265139 AGACTTGGAGTTATACATCCTGG + Intergenic
909467663 1:75991407-75991429 AGAATAGAAGTCAGGCATCCTGG - Intergenic
910506803 1:87958817-87958839 AGACTTGGAGTTAGGAAGTCTGG + Intergenic
915028068 1:152851867-152851889 AGGCTTGAAGTTAGGAAATCTGG + Intergenic
915607218 1:156960152-156960174 GGACTTGGAGTTAGGAGACCTGG - Intronic
915779637 1:158532391-158532413 AGACTTCAATTTATGCAACAAGG - Intergenic
916894426 1:169147412-169147434 AGACTTGAACCCAGGCAATCTGG - Intronic
918034884 1:180858680-180858702 AGATTTAAAGTTAGGAGACCTGG - Intronic
918195377 1:182216391-182216413 AGAGTTGAAGTTAGACTTCCAGG - Intergenic
920119389 1:203644457-203644479 AGACTGGAAGTTGGGAAACCTGG + Intronic
920529035 1:206688311-206688333 AGACTGGGAGTCAGGCAACCTGG - Intronic
922366467 1:224869045-224869067 AGACTGGAAGTTAGAAGACCTGG + Intergenic
924612743 1:245587460-245587482 AGTCTAGAAGATAAGCAACCAGG - Intronic
1062948153 10:1476296-1476318 AGACCTGCAGTTGGGCACCCTGG - Intronic
1065133161 10:22643137-22643159 AGACTTGGAGTTGGGAAAACTGG - Intronic
1068147635 10:53091316-53091338 AGACTTTATGTTAAGCAACCTGG + Intergenic
1069997596 10:72352384-72352406 AGACTTGAGGAAAGGCATCCTGG - Intronic
1071992522 10:91113882-91113904 GGATTTGAACTTAGGCAATCTGG - Intergenic
1073929804 10:108562177-108562199 GGACTTAAAGTTAGACAATCAGG - Intergenic
1075867530 10:125738744-125738766 AGATATGAAGTTAGGCAGTCTGG - Intronic
1078434560 11:11313670-11313692 GGGTCTGAAGTTAGGCAACCTGG + Intronic
1080109418 11:28548637-28548659 AGACTTAAGGCTAGGTAACCTGG - Intergenic
1080403566 11:31958618-31958640 AGATTTGAACCCAGGCAACCAGG - Intronic
1080773044 11:35360439-35360461 AGAAGTGAAGGTAGGCACCCAGG - Intronic
1084079771 11:66814172-66814194 CCACTTGAAGTGAGGCAAACAGG + Intronic
1086428808 11:86715402-86715424 AGACCTGAAGTTATGCTATCTGG + Intergenic
1086855928 11:91865807-91865829 AGATGTGAAGTCAAGCAACCAGG + Intergenic
1088503241 11:110505566-110505588 AGACTCGAAGTCAGGTCACCTGG - Intergenic
1089333211 11:117704514-117704536 AGACTTGCAGTTTCCCAACCCGG + Intronic
1093907223 12:24707296-24707318 AGATTTGAACCTAGGCAAACTGG - Intergenic
1094635475 12:32223220-32223242 AGAATTGAAGAGAGGCATCCGGG + Intronic
1097288384 12:57894775-57894797 AGACTTGCATTGGGGCAACCAGG + Intergenic
1097394862 12:59061091-59061113 AGATTAGAAGTTATGGAACCTGG - Intergenic
1097993011 12:65856434-65856456 GGACTAGAAGTCAGGAAACCTGG - Exonic
1098205685 12:68107025-68107047 GGACTTGAATCTAAGCAACCTGG - Intergenic
1099429552 12:82565917-82565939 TGAATGGAAGTTAGGAAACCTGG - Intergenic
1100081509 12:90857672-90857694 AAACTTGAAATTCTGCAACCTGG + Intergenic
1100595014 12:96064199-96064221 AAAATGGAAGTTAGGAAACCAGG - Intergenic
1100729325 12:97446638-97446660 GGACTTGAACTTAGGCAGTCTGG - Intergenic
1100786984 12:98089128-98089150 AGAATGGAAGTAAGACAACCAGG - Intergenic
1101214399 12:102566211-102566233 AGACTTGGAGTTAGGGAATCTGG + Intergenic
1101366931 12:104081230-104081252 AGTCTTGAATTTAGGCAATCTGG - Intronic
1101710722 12:107262637-107262659 GGATTTGAAGCCAGGCAACCAGG - Intergenic
1101875967 12:108597230-108597252 AGACTTGAAGCTAGGGGACCGGG + Intronic
1102402610 12:112643136-112643158 AGATTTGAATCTAGGCAGCCTGG + Intronic
1104209574 12:126675563-126675585 AGACTTGAAGTTGGATACCCAGG - Intergenic
1104309378 12:127640599-127640621 AGATTTGATGTTTGGCACCCAGG + Intergenic
1105614686 13:22001075-22001097 AGCTTTGAAGTGAGGCAGCCTGG - Intergenic
1108005459 13:45941684-45941706 AGTCTTGAATTTATGCAACCAGG - Intergenic
1108691935 13:52867028-52867050 AGACATGAAGGAAGGAAACCAGG - Intergenic
1109262379 13:60159668-60159690 AGATTTGAATCTAGGCAAGCTGG - Intronic
1110790687 13:79583461-79583483 AGAATTGACCTTAGGCAACAAGG + Intergenic
1111898382 13:94169944-94169966 AGACTGGAAGTTGGGCAGGCGGG + Intronic
1116190865 14:41663779-41663801 AGACTTGGAGTTAGAAAACATGG + Intronic
1116571282 14:46519187-46519209 ATTCTTGAAGTTAAGAAACCTGG + Intergenic
1116597654 14:46871814-46871836 AAACTTGAAGTCAGGAGACCTGG - Intronic
1117254776 14:53966768-53966790 AAACTTGAAGTCAGGTAGCCGGG + Intergenic
1119137871 14:72237598-72237620 GGACTAGGAGTTAGGAAACCAGG - Intronic
1119840824 14:77791549-77791571 GGACTGGAAGTTAGGCAAGCTGG - Intergenic
1121052330 14:90827697-90827719 ACTCTTGAAGTTAGGAAACCTGG + Intergenic
1121898207 14:97668577-97668599 TGACTTGAAGTCAGGCATCTGGG - Intergenic
1123926592 15:25118697-25118719 AGACTGGAAGTTTGACAAACTGG + Intergenic
1124637937 15:31376826-31376848 AGACTTGCAGTGCGGCCACCTGG + Exonic
1125824951 15:42668246-42668268 TGAGTTGAAGTTTGGAAACCAGG - Intronic
1126579947 15:50233475-50233497 AGAATTGAATTCAGGCAGCCTGG - Intronic
1127006663 15:54578457-54578479 ACACTTGAAGTCAGGAAACAGGG - Intronic
1133342112 16:5043443-5043465 GGACTTGAATTCAGGCAGCCTGG + Intronic
1136616879 16:31403803-31403825 AGACTGGCAGCGAGGCAACCAGG - Intronic
1137492513 16:48944759-48944781 AAACTTGAACTTAAGCAAGCAGG - Intergenic
1137574504 16:49590099-49590121 GTACTTGGAGTAAGGCAACCTGG + Intronic
1140487584 16:75305944-75305966 AGACTTGAATTTGGGCATCTGGG - Intronic
1141890726 16:86924877-86924899 AGACTTGGGGTGAGGGAACCAGG + Intergenic
1143917151 17:10302497-10302519 ATCCTTGAAGTAAAGCAACCAGG + Intronic
1143924973 17:10361649-10361671 AGACTTGATATTAGGCATCATGG + Intronic
1144239339 17:13294862-13294884 AGACTTGAAGTCGTGCTACCTGG + Intergenic
1146207258 17:30915498-30915520 AGACTTGAATTTAGGCATGGAGG + Intronic
1148884374 17:50760947-50760969 AAACATGAAGTTAGCCAAACTGG + Intergenic
1149207078 17:54260753-54260775 AGATTTGAATTTAGGCATTCTGG - Intergenic
1149972748 17:61235320-61235342 AGACTTGCAGACAGGCAGCCTGG + Intronic
1153579898 18:6562470-6562492 AAACTTGAAGGTAGGGAACTCGG - Intronic
1155035033 18:22018888-22018910 AGAGTTGAAGTCAGGGAAACAGG + Intergenic
1157422742 18:47559953-47559975 AGGCTTGAACTCAGGCCACCTGG - Intergenic
1158494466 18:57942114-57942136 AGGCTTAAAGTAAGGCATCCTGG + Intergenic
1162120197 19:8460708-8460730 GGACTTGAATTTCGGCAACATGG + Intronic
1162768109 19:12932512-12932534 AGATTTGAAATTAGGCACTCAGG - Intronic
1163500152 19:17671429-17671451 AGACTTGAGGTTAGGAGGCCAGG + Intronic
1164766868 19:30779038-30779060 AGACTTGAAGTGACACAGCCAGG - Intergenic
926263658 2:11293161-11293183 AGTCTAGAAGTTAAGAAACCTGG + Intronic
926427803 2:12755119-12755141 ATACTTGAAGTTAAAAAACCTGG - Intergenic
927854173 2:26517565-26517587 GGGCTTGGAGTTAGGCAGCCTGG - Intronic
932216836 2:69971846-69971868 GGAGTTGAATTTAGGCAGCCTGG - Intergenic
933139211 2:78773343-78773365 AGACCTGAAGTGAGACAAACAGG + Intergenic
933877493 2:86633391-86633413 AGACTTGAGGCTGGGCATCCAGG - Intronic
936776440 2:115979654-115979676 AGACTTCAAGTTACGCTACAAGG - Intergenic
937208815 2:120253868-120253890 AGAAATGAGGTTAGGAAACCAGG - Intronic
937950191 2:127379789-127379811 GGACTTGAACTCAGGCAGCCTGG - Intronic
939353790 2:141074718-141074740 AGACTTGAAGTTAGGTTAAAGGG + Intronic
941826060 2:169898550-169898572 GGCTTTGAAGTTAGACAACCCGG - Intronic
942235043 2:173895728-173895750 TGACTTGCATGTAGGCAACCAGG - Intergenic
944802530 2:203250454-203250476 GGACTTGAAGTCAGGCAATCTGG + Intronic
946142560 2:217704102-217704124 CGACTTGCAGTTAGGCAAGAAGG + Intronic
947614392 2:231545846-231545868 AGACTTGAAATTAGGGAACCAGG + Intergenic
947828035 2:233119764-233119786 GGACTTGGAGTTAGCCACCCAGG + Intronic
1173405155 20:42758061-42758083 TGACTTGAAGTTGGAAAACCTGG - Intronic
1173598121 20:44273113-44273135 AGATTTGAACTTAGGCCATCTGG - Intronic
1173599474 20:44283060-44283082 AGACTGGAAGATTGGTAACCAGG - Intergenic
1173818524 20:46005780-46005802 AGATTTGAACTTAGGCAGCCTGG + Intergenic
1174062878 20:47844946-47844968 AGATTTGAACCTAGGCAGCCTGG - Intergenic
1174151232 20:48487942-48487964 AGATTTGAACCTAGGCAGCCTGG - Intergenic
1174362170 20:50035684-50035706 AGCCTTGAAGTCAGGATACCTGG + Intergenic
1177343733 21:19840486-19840508 AGATTTGAAGGATGGCAACCAGG + Intergenic
1177646409 21:23904510-23904532 AAACTTGAAGTTAGGTGACCAGG + Intergenic
1177924832 21:27200925-27200947 AGAGTTGAAGGAGGGCAACCAGG + Intergenic
1178544394 21:33480518-33480540 AAAGTTGAAGTTAGTAAACCAGG + Intergenic
1181984350 22:26789289-26789311 TGACTTCCAGTTAGGCAACTGGG - Intergenic
1182598956 22:31444721-31444743 AGACTTGAAGTTAAGCAGATTGG - Intronic
949381212 3:3447695-3447717 AGGCATGAAGTAAGGCAACCAGG - Intergenic
949925874 3:9041227-9041249 AGACTTGAAGTTAGGCAACCTGG - Intronic
950458477 3:13106560-13106582 AGACTTAAACTTAGGCCATCTGG + Intergenic
951849154 3:27119259-27119281 AGATTTGAATCTAGGCACCCAGG + Intronic
952125140 3:30291070-30291092 AGACTTGCAGTGTGGCCACCTGG - Intergenic
953104365 3:39861254-39861276 AGAAATGAAGCTAGTCAACCAGG + Intronic
953156729 3:40382072-40382094 ATACTGGTAGTTAGGAAACCTGG - Intergenic
956010292 3:64823436-64823458 GGACTAGAAGTTAGGAAACCAGG + Intergenic
956054617 3:65285563-65285585 AAACTGGAAGCTAGACAACCTGG - Intergenic
956539050 3:70313711-70313733 AGAAATGAAGTTAGGAAACGAGG - Intergenic
964237327 3:154546830-154546852 AGACTTGAACTCAAGCAGCCTGG - Intergenic
966965739 3:184990667-184990689 AAACTTGAAGTTAGCAGACCTGG - Intronic
967082713 3:186064968-186064990 GGACCTGAAGTTAGGAAGCCAGG + Intronic
967735559 3:192948130-192948152 TGACCTGAAGTTAGGCAGACAGG + Intergenic
969312202 4:6360234-6360256 TGACTGGAAGTTAGGGAGCCAGG - Intronic
969592614 4:8130571-8130593 GGACTTGAAGGGAGGCAGCCTGG + Intronic
969873504 4:10119055-10119077 AGAGTTAAAGTTAGGGAACGCGG - Intergenic
970547674 4:17146280-17146302 AGACTAGAAGTGAGGCATTCTGG + Intergenic
971135594 4:23864717-23864739 AAACAAGAAGTTAGGCAACCTGG + Intronic
971601650 4:28599060-28599082 AAACTTCAATTTAGTCAACCTGG - Intergenic
972823758 4:42732847-42732869 AGACTTGAAGCTATGCAGCCAGG + Intergenic
973086634 4:46070723-46070745 AGACTGGTAGTTAGGGAGCCAGG + Intronic
973211949 4:47625364-47625386 ACACTTGTAGTTAGTAAACCAGG + Intronic
974163035 4:58165136-58165158 ATACTTGAAGTTGCCCAACCAGG - Intergenic
977530897 4:98199596-98199618 AGACTTGAAGTTAAGCTCCTAGG - Intergenic
979939349 4:126740340-126740362 TGAATTGAATTTAGGCAAACTGG - Intergenic
980075281 4:128287751-128287773 GGACGTGAAGCTAGGCACCCTGG - Exonic
981000911 4:139828249-139828271 AGCCTTGATGTTAGGACACCAGG + Intronic
982137196 4:152282800-152282822 AGACTTGAATGTAGTCATCCTGG + Intergenic
982447907 4:155515587-155515609 AGGCTTGAGTTTAGGCAATCTGG + Intergenic
982720703 4:158856668-158856690 AGACTAGAAGATAGGAATCCTGG + Intronic
983994856 4:174169418-174169440 AAACCTGCAGTCAGGCAACCAGG - Intergenic
985116650 4:186598733-186598755 AGGCTAGAAGTGAGGCAGCCTGG - Intronic
990065373 5:51706943-51706965 AGACTTGCATTTAGGTAACTTGG - Intergenic
990189250 5:53240299-53240321 AGTCTTAAAATTAGGAAACCTGG + Intergenic
990843970 5:60116133-60116155 AGACTTGAATTATGACAACCAGG - Intronic
997930418 5:138068112-138068134 AGACGTGAAGCTAGGCAGTCTGG + Intergenic
998587293 5:143440298-143440320 AGACTGGAAGTTAAGAGACCTGG + Intergenic
999340152 5:150763232-150763254 TGGCTTGAAGTTAGGCAACAGGG + Intergenic
999538558 5:152546794-152546816 AGACTGGCAGTAAGGAAACCTGG + Intergenic
1001594992 5:172892545-172892567 AGGCTTGATGGTAGGAAACCTGG - Intronic
1004231693 6:13839569-13839591 AGACTTGAAGTCAGGAAACTTGG - Intergenic
1004670558 6:17792489-17792511 AGACTGGGAGTCAGGAAACCTGG - Intronic
1006016647 6:31086503-31086525 AAACTTGAAGCAAGGTAACCAGG + Intergenic
1006718725 6:36136483-36136505 GGACCTGAAGCCAGGCAACCTGG + Exonic
1007733141 6:43964100-43964122 AGATTTGAACTCAGGCAGCCTGG - Intergenic
1008685520 6:53922054-53922076 AGACTGGAAGTTAAGTAACAGGG - Intronic
1010058941 6:71599573-71599595 GGACTTGAATCCAGGCAACCTGG - Intergenic
1010157756 6:72814303-72814325 CGACTTGAAGCCAGGCAGCCTGG - Intronic
1010811597 6:80306862-80306884 AGACTTGATATGAGGCTACCTGG + Intronic
1011853079 6:91654763-91654785 AGACTTGAAGTTTGGTTGCCAGG + Intergenic
1012621952 6:101356074-101356096 AGACTTGCAGTTAGAAAACAAGG - Intergenic
1017064154 6:150513192-150513214 AGACTAGAAATTAGGAAATCAGG + Intergenic
1017347012 6:153395818-153395840 AGACTTGAAATCAGGGAATCTGG - Intergenic
1019974136 7:4566956-4566978 AGACTTGAAGTTGGGAAGCAAGG - Intergenic
1020246460 7:6433010-6433032 AGACTGGATTTTAGGGAACCCGG - Intronic
1023838142 7:44080328-44080350 GGATTTGAAGGCAGGCAACCTGG + Intronic
1024218260 7:47266249-47266271 AGATTTGAAGCCAGGCAACGTGG + Intergenic
1024449622 7:49524308-49524330 AGTCTTGAAGTTAGGGAAGGTGG - Intergenic
1025231516 7:57205966-57205988 AGATTTGAACCTAGGCAGCCTGG + Intergenic
1027626207 7:80547504-80547526 AGACTTGAAGTAGGAAAACCTGG - Intronic
1029668905 7:102015156-102015178 AAACGTGAAGTCAGGCATCCAGG + Intronic
1030067063 7:105667811-105667833 AGACTTGAAGTTAGGAGACTTGG - Intronic
1030229199 7:107187980-107188002 GGACTTGGAGTCAGGAAACCTGG + Intronic
1032804920 7:135343774-135343796 ACACTCGATGTTAGGAAACCTGG - Intergenic
1038698127 8:29824539-29824561 ATACTTGAGGTGAGCCAACCAGG - Intergenic
1039088887 8:33806966-33806988 GAACTTGGAGTTAGACAACCTGG - Intergenic
1041973578 8:63771583-63771605 AAAATTGGAGTCAGGCAACCTGG + Intergenic
1043140169 8:76578212-76578234 AGATTTGTAGTCAGGCATCCTGG - Intergenic
1043278347 8:78430604-78430626 ATACTTGAGGTTAGGCAAGAGGG - Intergenic
1048035597 8:130674358-130674380 TGCTTTGAAGTCAGGCAACCTGG + Intergenic
1048106377 8:131414902-131414924 AGACTCGGAGTTATGCAAGCAGG - Intergenic
1048828563 8:138453740-138453762 AGATTTGAACCTAGGCAGCCTGG - Intronic
1051275381 9:15393386-15393408 AGGCTTGAAGATAGGCACCTGGG - Intergenic
1058059389 9:100478731-100478753 AAACTTGAATTTAGGAGACCAGG + Intronic
1058634204 9:107020471-107020493 AGACTTGAACTAAGGCAACTTGG - Intergenic
1058958365 9:109969865-109969887 AGAGATGAAGCTAGGCATCCTGG - Intronic
1058965058 9:110029760-110029782 CGACTGGAAGGTAGCCAACCTGG + Intronic
1059821084 9:117972965-117972987 AGGCTAGAAGTTAGAAAACCTGG + Intergenic
1061198576 9:129122634-129122656 AGCTTTGAAGTTAGGCTACTGGG + Intronic
1188685972 X:33071050-33071072 ATACTTGAAGTTAGAATACCTGG + Intronic
1192953713 X:76045856-76045878 GGACTTGAATTCAGGCAATCTGG - Intergenic
1195723782 X:107892293-107892315 AGACTAGAAATCAGGAAACCTGG + Intronic
1196099575 X:111833410-111833432 AGATTTGAAGTTAATAAACCAGG - Intronic
1196989828 X:121316003-121316025 AGACATGAAGCTAGGGATCCTGG + Intergenic
1198455733 X:136815911-136815933 AGACTTAGAGCTAGGCCACCAGG + Intergenic
1200385490 X:155886199-155886221 GCACTTGAAGTTAGAAAACCTGG - Intronic
1200424585 Y:3007182-3007204 AGACTGGAAGTGAAGTAACCAGG - Intergenic
1202112264 Y:21434609-21434631 AAACTTAAAGTTAAGCATCCAGG + Intergenic