ID: 949925875

View in Genome Browser
Species Human (GRCh38)
Location 3:9041235-9041257
Sequence GTAAACTTAGACTTGAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949925875_949925885 18 Left 949925875 3:9041235-9041257 CCTAACTTCAAGTCTAAGTTTAC 0: 1
1: 0
2: 0
3: 9
4: 188
Right 949925885 3:9041276-9041298 CCTCCACAAACACAAGGTGAGGG 0: 1
1: 0
2: 0
3: 31
4: 257
949925875_949925878 -10 Left 949925875 3:9041235-9041257 CCTAACTTCAAGTCTAAGTTTAC 0: 1
1: 0
2: 0
3: 9
4: 188
Right 949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 130
949925875_949925883 17 Left 949925875 3:9041235-9041257 CCTAACTTCAAGTCTAAGTTTAC 0: 1
1: 0
2: 0
3: 9
4: 188
Right 949925883 3:9041275-9041297 ACCTCCACAAACACAAGGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 226
949925875_949925881 12 Left 949925875 3:9041235-9041257 CCTAACTTCAAGTCTAAGTTTAC 0: 1
1: 0
2: 0
3: 9
4: 188
Right 949925881 3:9041270-9041292 GTTCCACCTCCACAAACACAAGG 0: 1
1: 0
2: 1
3: 20
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949925875 Original CRISPR GTAAACTTAGACTTGAAGTT AGG (reversed) Intronic
904028190 1:27518155-27518177 CTAAACTGAGACCTGAAGGTGGG - Intergenic
905712146 1:40114563-40114585 GTAAACTTGGACATAAAGATGGG + Intergenic
909345287 1:74578080-74578102 GTAATATGAGACTTGAATTTAGG - Intronic
909841345 1:80329735-80329757 GTAATTTTAGACTTAAACTTTGG - Intergenic
913313205 1:117524571-117524593 TTAAACTTAGGTTTTAAGTTGGG + Exonic
915028066 1:152851859-152851881 CGAAACCTAGGCTTGAAGTTAGG + Intergenic
915946179 1:160153313-160153335 GGAACGTTGGACTTGAAGTTAGG - Intronic
916870015 1:168903514-168903536 GTAGACATAGCCTTGGAGTTGGG - Intergenic
919028954 1:192214385-192214407 TTAAAATAAGACTTCAAGTTCGG - Intergenic
919520190 1:198578701-198578723 TTAACCTTAGTCTCGAAGTTAGG + Intergenic
921477024 1:215623580-215623602 GTAAACTTAGACATGTAGCAGGG + Exonic
922946257 1:229517736-229517758 GTAAAATTAGACTTAAAAGTAGG + Exonic
923476014 1:234331973-234331995 AAAAACTCAGATTTGAAGTTTGG - Intergenic
1063892842 10:10648024-10648046 GTAAATTTGTACATGAAGTTTGG - Intergenic
1074252557 10:111766247-111766269 GTAAACTAAGAGGTGAACTTGGG + Intergenic
1074897834 10:117792448-117792470 CTAAGCTGAGACTTGAAGCTAGG + Intergenic
1075221664 10:120590204-120590226 ATAAACTTAGACTGGAAGATGGG - Intergenic
1080150298 11:29044871-29044893 GTTAACTTTTACTTTAAGTTTGG - Intergenic
1080499111 11:32851719-32851741 GTAAATATTGACTAGAAGTTAGG + Intronic
1085140313 11:74134633-74134655 ATAAAATTAGACTAGGAGTTGGG - Intronic
1085470506 11:76754341-76754363 GTAAACTTAGACTTACAATGTGG - Intergenic
1087735202 11:101824893-101824915 GTAAATTAAGATTTGAGGTTTGG + Intronic
1087990772 11:104743716-104743738 GTAAAAGTAGGCTTGAAGATAGG + Intergenic
1088412403 11:109549405-109549427 GTACACATAGACATGAAGATGGG + Intergenic
1089655669 11:119945081-119945103 GTAAACTTAGATCTGGATTTTGG + Intergenic
1090143089 11:124286970-124286992 TTAAAGTAAGCCTTGAAGTTAGG + Intergenic
1092871088 12:12806401-12806423 TTAAACTGAGACTTGAAAGTTGG - Intronic
1093439253 12:19174115-19174137 ATAAAATTAGATTTGTAGTTGGG - Intronic
1094070085 12:26403331-26403353 TTAAACTTAATCTTGAAATTAGG + Intronic
1095370104 12:41456936-41456958 GCAAACTTAGGCATGATGTTTGG - Intronic
1098332085 12:69363490-69363512 GTTAACTTAGATATGATGTTAGG - Intronic
1098931519 12:76421050-76421072 GAAAACTTAGCTTTTAAGTTTGG - Intronic
1099491728 12:83296647-83296669 GTAAAGTTAGAGTAGAAGTGGGG - Intergenic
1099760052 12:86909179-86909201 TTAAAGTAAGACTTGAAATTAGG - Intergenic
1106698451 13:32203744-32203766 GTAAGCTTAGGCAAGAAGTTAGG - Intronic
1106868922 13:33997536-33997558 GTCAGCTTAGAATTGAATTTTGG - Intergenic
1108475807 13:50816398-50816420 GTAAACTGAGACTGGAAGAGAGG + Intronic
1109722876 13:66298924-66298946 TTAAGCTAAGACTTGAAGCTAGG + Intergenic
1110593844 13:77295946-77295968 GTAAACTGGGACTTGGATTTGGG - Intronic
1111626698 13:90796981-90797003 GTAAACTTATACTTGCTTTTGGG + Intergenic
1112563132 13:100531406-100531428 ATAAACTTCCACTTGAAGTCCGG + Exonic
1112612842 13:100972957-100972979 GGAGACTTAGACTTGCAATTGGG - Intergenic
1115720297 14:36153597-36153619 GTAAACCTAGAAGTGAATTTTGG - Intergenic
1115841477 14:37475829-37475851 GTATAGTAAGTCTTGAAGTTAGG + Intronic
1116071907 14:40057823-40057845 GAAACTTTAGACTTGAAGCTGGG + Intergenic
1116664205 14:47754166-47754188 TTAAAATTAGACGTGAAATTTGG + Intergenic
1120423923 14:84323047-84323069 GTCACCTTAGATTTGAATTTGGG + Intergenic
1121152378 14:91647377-91647399 GCAAACTTAGACTTTGAATTTGG - Intronic
1122579089 14:102760557-102760579 GGAGCCTTAGACTTGCAGTTTGG - Intergenic
1125177019 15:36835403-36835425 CTATACTAAGTCTTGAAGTTAGG - Intergenic
1127115537 15:55722895-55722917 GTTAACTGAGACCTGAAGCTAGG + Intronic
1130175215 15:81561993-81562015 AAAAACTTGGACTTGAATTTTGG - Intergenic
1137253805 16:46759041-46759063 GTAAAGTCAGACTTGCACTTTGG - Intronic
1137958621 16:52858494-52858516 GAAAACTGAGATTTGAAGTTAGG + Intergenic
1138052755 16:53798210-53798232 TTATACTAAGTCTTGAAGTTAGG + Intronic
1138515108 16:57531615-57531637 GTAACCTTAGAATTGAGGCTAGG - Intronic
1140429437 16:74889118-74889140 GCAAACTTCAACTTGAAGTCAGG + Intronic
1140642675 16:76994678-76994700 CTTAACATAGACTTGAAGTTAGG - Intergenic
1143593918 17:7902823-7902845 GGAAACTTAGGCTTTGAGTTGGG + Intronic
1146143779 17:30391846-30391868 TTAAACTTACTCTTGAAGATAGG + Intronic
1147938805 17:44030496-44030518 GAAAGCTTAGAGTTCAAGTTTGG - Intergenic
1151819096 17:76487707-76487729 GCAAACTCAGACTCGAAGGTAGG - Exonic
1153706024 18:7746897-7746919 GTACACGTACACTTGAAGCTGGG - Intronic
1153743574 18:8153690-8153712 TCAAATTTAGACTTGAAATTTGG - Intronic
1155444657 18:25898576-25898598 GCAAAATTAGACTTGAATTTTGG + Intergenic
1158083719 18:53625691-53625713 GCTCACTTTGACTTGAAGTTGGG - Intergenic
1158355719 18:56616814-56616836 GTAAATGTAGAATGGAAGTTTGG - Intronic
1163069856 19:14830252-14830274 GTAAACTTGGACTTCCATTTTGG + Intronic
927292888 2:21422057-21422079 GTAAACTTTGACTTCTAGGTAGG + Intergenic
928262035 2:29776838-29776860 GTGAACTAAGACTTGGGGTTTGG - Intronic
928514420 2:32032533-32032555 GTATACTGTGACTGGAAGTTAGG - Intronic
930936993 2:56965448-56965470 TTAAACTTAGTCTTTAAGTAAGG + Intergenic
933630981 2:84657236-84657258 GTATAGTAAGTCTTGAAGTTGGG + Intronic
936652425 2:114443584-114443606 GTAAACTTTGATTGGAAGTCTGG - Intronic
937527446 2:122788484-122788506 GAAAACTTAGCATTAAAGTTTGG + Intergenic
939353788 2:141074710-141074732 TAAGACTCAGACTTGAAGTTAGG + Intronic
939554280 2:143655378-143655400 GTAAACTTGGGTTTGAATTTGGG + Intronic
941152326 2:161930129-161930151 GTAAATTTAGACTGGAAATAAGG + Intronic
941681417 2:168403564-168403586 GGAAATTTAGGCATGAAGTTGGG + Intergenic
942407965 2:175675854-175675876 GTAAACCTAGAGTAGGAGTTGGG - Intergenic
944611541 2:201413667-201413689 GGAAACTGAGACTTAAAGATGGG + Intronic
946168097 2:217877651-217877673 GTAAACTTGAACTTGGAGCTGGG + Intronic
1169985942 20:11444575-11444597 GCAAACTTAGGCTTGAAATAAGG - Intergenic
1172261556 20:33570550-33570572 GTGTACTTTGATTTGAAGTTTGG + Intronic
1173081830 20:39875799-39875821 GTAAGCTCAGACATGAAGTCAGG + Intergenic
1175372467 20:58501110-58501132 GTAACTTTAGTCCTGAAGTTTGG + Intronic
1181979709 22:26757263-26757285 GGAAACTGAGACTTGAAGCTGGG + Intergenic
1182418180 22:30234899-30234921 ATGAACTTAGCCTTGAAGCTGGG + Intergenic
949684658 3:6554596-6554618 GTAAACACAAACTTGAAGTTAGG + Intergenic
949805166 3:7946997-7947019 GTAAACTTTGATTTGAAACTTGG - Intergenic
949925875 3:9041235-9041257 GTAAACTTAGACTTGAAGTTAGG - Intronic
950863473 3:16170704-16170726 TTAAATTTCGACATGAAGTTTGG + Intergenic
951372163 3:21862833-21862855 GTTCAGTTTGACTTGAAGTTAGG - Intronic
952635975 3:35531981-35532003 GTATAGTAAGACTTGAAGTTAGG - Intergenic
953527170 3:43701773-43701795 GTTAACTTTGAGTTGAAGTCAGG - Intronic
956429017 3:69165847-69165869 TTAAGCTTAGACTTGAGGATTGG - Intergenic
956429452 3:69170439-69170461 GTATAATTAGAAATGAAGTTTGG - Exonic
958782410 3:98558371-98558393 GTAAGCTTTGACTTCAAGGTAGG - Intronic
960407614 3:117281356-117281378 GTACACTGAGACCTGACGTTAGG + Intergenic
963423624 3:145094735-145094757 GTAATCTTAGAATTACAGTTAGG - Intergenic
964127191 3:153247002-153247024 ATAAACTGAGAAGTGAAGTTTGG - Intergenic
964181266 3:153889381-153889403 CTAAACTTACACTAGAATTTTGG - Intergenic
965044299 3:163554606-163554628 ATAACCTAAGACTTCAAGTTAGG + Intergenic
966380328 3:179338199-179338221 GTAATCTCAGACTTGAATTGTGG - Intergenic
966706289 3:182918816-182918838 GTAAACATCAATTTGAAGTTCGG - Exonic
967430362 3:189377421-189377443 TTATAGTAAGACTTGAAGTTAGG + Intergenic
970159497 4:13174757-13174779 TTAAAATGAGAATTGAAGTTTGG + Intergenic
970309751 4:14769673-14769695 CTAAACTTAGACTTGGAGGATGG + Intergenic
970313382 4:14806106-14806128 GTAAAACTAGACTTGAATGTTGG - Intergenic
970449480 4:16152642-16152664 GTAAAGTGAGAATTGATGTTTGG - Intergenic
971206497 4:24574888-24574910 GAAAACTTAGAATTGATGTTAGG - Intronic
971379267 4:26081782-26081804 GTAGACTTAAACTAGAAATTAGG + Intergenic
971628124 4:28950608-28950630 GAAAACTTAGATATTAAGTTTGG + Intergenic
971754295 4:30687358-30687380 GGAAATTTTTACTTGAAGTTAGG - Intergenic
972688374 4:41372843-41372865 GGAAACTGAGACTTGAGGGTTGG + Intronic
973904434 4:55513555-55513577 GTAAAGTAAGTCTTGAAGTCAGG + Intronic
975481612 4:74886881-74886903 TTGAACTTAGACATGGAGTTAGG - Intergenic
975803722 4:78090556-78090578 TTAAACTTAATCTTGGAGTTTGG + Intronic
976711246 4:88073595-88073617 GTAGCCCTAGACTGGAAGTTGGG + Intronic
977488736 4:97684322-97684344 TTATAGTTAGACTTGAAGTAGGG - Intronic
980311598 4:131137276-131137298 GCAGACTGAGACCTGAAGTTAGG - Intergenic
982309156 4:153965967-153965989 GTAAGCTTAGCCATGAGGTTAGG + Intergenic
982849688 4:160296850-160296872 GGAAACTGAGACTTGAAGGAGGG - Intergenic
983241803 4:165242026-165242048 TTAAACTTTGGCTTTAAGTTTGG + Intronic
983753203 4:171301979-171302001 TTAAACTTTGATTTTAAGTTTGG + Intergenic
984201214 4:176723530-176723552 GTAAACTTTTATTTTAAGTTTGG + Intronic
984686775 4:182678298-182678320 GTAAAATTAGACATGAACATTGG - Intronic
985898963 5:2771755-2771777 GTAAAATTATACTAGAACTTTGG + Intergenic
986657763 5:10031847-10031869 GAATCCTTAAACTTGAAGTTTGG - Intergenic
987791524 5:22574984-22575006 GTAAAATTAAACTTAAATTTTGG + Intronic
987894838 5:23930729-23930751 CTAAAATTAGACATGAAATTTGG + Intergenic
989673676 5:43949259-43949281 TTAAACTTAACCTTGATGTTAGG - Intergenic
990214742 5:53517791-53517813 GATAATTTAGACTTAAAGTTTGG + Intergenic
991396016 5:66206174-66206196 TTAAACTGAGACTTGAAGGATGG + Intergenic
994513587 5:100741071-100741093 CTATAGTAAGACTTGAAGTTTGG + Intergenic
995523470 5:113032031-113032053 GTAAACTTAAACCTAAAATTTGG + Intronic
996334269 5:122365929-122365951 GACAACCTAGACTTGAAGTCAGG + Intronic
999812472 5:155140646-155140668 GGAAACTTAGACCTAAGGTTGGG + Intergenic
1001028088 5:168241158-168241180 GGAATCTTCCACTTGAAGTTAGG + Intronic
1003740691 6:8935367-8935389 GTAAACTTATAATTTAAGTCAGG - Intergenic
1003993249 6:11510054-11510076 GTAAACTTATACTTGAAAGAAGG + Intergenic
1006246067 6:32737500-32737522 ATAAAATTAGACCTAAAGTTAGG + Intergenic
1011762272 6:90580379-90580401 GTGAACTTGGACTAGAAATTTGG - Intronic
1013463147 6:110394755-110394777 GGAAACTGAGATTTGAAGTGAGG - Intronic
1014366577 6:120551062-120551084 GTAAAATTAGCATTGGAGTTTGG + Intergenic
1014411977 6:121135849-121135871 GTAAAATTAGTCTTAAAGTAAGG + Intronic
1014472095 6:121828508-121828530 GTAAACTTAGAATTAATTTTTGG + Intergenic
1015080182 6:129214685-129214707 TTATACTAAGTCTTGAAGTTGGG + Intronic
1016075504 6:139790109-139790131 TTATAGTAAGACTTGAAGTTAGG + Intergenic
1022804774 7:33810684-33810706 TTAGGCCTAGACTTGAAGTTAGG + Intergenic
1023507542 7:40915942-40915964 TTAATCTTAAACTTGAAGTGGGG + Intergenic
1024438567 7:49388242-49388264 GTAAGTTAAGAATTGAAGTTTGG - Intergenic
1024888603 7:54175210-54175232 GTAAACTTTGACATTAACTTTGG - Intergenic
1027966829 7:85022195-85022217 GAAATCTCAGATTTGAAGTTGGG + Intronic
1028128083 7:87137688-87137710 GTAAAATAATAATTGAAGTTAGG - Intergenic
1028134125 7:87208594-87208616 GTAAACTGACATTTGTAGTTAGG - Intronic
1029928897 7:104349704-104349726 TTAAAATTATACTTTAAGTTCGG - Intronic
1030442553 7:109605632-109605654 GTAAAATGAAACTGGAAGTTGGG + Intergenic
1030817100 7:114051583-114051605 GTAAAAGCAGATTTGAAGTTAGG + Intronic
1031898221 7:127379040-127379062 GTAAACATAGATTTGGATTTGGG - Intronic
1033135291 7:138779008-138779030 GTACAGTAAGTCTTGAAGTTGGG - Intronic
1035353577 7:158263988-158264010 GTAGAGTTGGACTTGAATTTAGG - Intronic
1037045453 8:14296085-14296107 GTAGCCTTAGACTTCATGTTTGG - Intronic
1038966657 8:32580644-32580666 GGAGACTAAGACTTGAAATTGGG + Intronic
1039648797 8:39317705-39317727 TTATACTAAGTCTTGAAGTTGGG + Intergenic
1040040510 8:42912044-42912066 GTACCCTGAGCCTTGAAGTTTGG + Intronic
1041812915 8:61931851-61931873 GTAAACTGACACCTGGAGTTTGG - Intergenic
1041892294 8:62882969-62882991 TTATACTAAGTCTTGAAGTTTGG + Intronic
1042974035 8:74444555-74444577 GTAACTTCAGACTTGAATTTTGG + Intronic
1046493269 8:114981376-114981398 GTAGCTTTAGACTTTAAGTTTGG + Intergenic
1048432890 8:134386863-134386885 GTAAACAAAGACTTAAAGATGGG + Intergenic
1050752992 9:8963182-8963204 GAAAACTGAGACTTGTAATTTGG + Intronic
1051268782 9:15334653-15334675 GGAAACATAGACTTGGAGCTGGG - Intergenic
1051361731 9:16286902-16286924 GAAAAATTAGAATTGGAGTTTGG + Intergenic
1051508321 9:17849029-17849051 GTGACCTCAGACTTGAACTTTGG + Intergenic
1052130675 9:24842885-24842907 TTAAAGTAAGTCTTGAAGTTGGG + Intergenic
1052551761 9:29959678-29959700 ATACAGTTAGACTTGAAGTCTGG - Intergenic
1052751122 9:32492101-32492123 CTAAACTTAGACTGAGAGTTCGG + Intronic
1055987864 9:82070740-82070762 GTAAACTAAGACATCAAGTTTGG - Intergenic
1056374121 9:85990350-85990372 TTAAACTTCAACTTGAATTTTGG + Intronic
1062148289 9:135003297-135003319 GTAAACTGAGATCTGAAGATAGG + Intergenic
1062235209 9:135504663-135504685 GCAAAATGAGACTTGGAGTTTGG + Exonic
1186312776 X:8338729-8338751 GTAAACATAGTCTTGTACTTTGG - Intergenic
1187179724 X:16932679-16932701 GTGAAATAAGACATGAAGTTGGG + Intergenic
1187920415 X:24196068-24196090 GTAAACATAGATTGGAAGGTAGG - Intronic
1189875687 X:45433776-45433798 GTAAACTTTGTCTTGCAGGTTGG - Intergenic
1190335968 X:49261770-49261792 GTAAACTGAGGCCTGCAGTTGGG + Intronic
1191610839 X:63111217-63111239 GTAAATTTAGTTTTGATGTTAGG - Intergenic
1192838456 X:74827733-74827755 CTAAACATGAACTTGAAGTTGGG + Intronic
1193484662 X:82071687-82071709 TTAAAATTTGACATGAAGTTTGG + Intergenic
1194049419 X:89050887-89050909 GTAAAAATAGACATGCAGTTAGG + Intergenic
1194283103 X:91977061-91977083 GTCTACTTAGACTTGGAGTGAGG - Intronic
1196124755 X:112085286-112085308 GTAAACCTAGTCTAGAAGCTAGG - Intergenic
1196634897 X:117991176-117991198 CTAACATTAGACTTGAATTTTGG + Intronic
1197591078 X:128410919-128410941 GTAAACTTATACTAGAAAATAGG - Intergenic
1197816855 X:130506598-130506620 GTAAATTGAGACTTGAAGGGAGG - Intergenic
1200419287 Y:2946557-2946579 TTAAACTTCTACTTGAAGATAGG + Intronic
1200600684 Y:5201595-5201617 GTCTACTTAGACTTGGAGTGAGG - Intronic