ID: 949925876

View in Genome Browser
Species Human (GRCh38)
Location 3:9041240-9041262
Sequence CTTCAAGTCTAAGTTTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949925867_949925876 27 Left 949925867 3:9041190-9041212 CCCAAGTCCCTGCTAAGTGTAGA 0: 1
1: 0
2: 1
3: 4
4: 126
Right 949925876 3:9041240-9041262 CTTCAAGTCTAAGTTTACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
949925871_949925876 19 Left 949925871 3:9041198-9041220 CCTGCTAAGTGTAGAGTCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 949925876 3:9041240-9041262 CTTCAAGTCTAAGTTTACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
949925874_949925876 -10 Left 949925874 3:9041227-9041249 CCAGGTTGCCTAACTTCAAGTCT 0: 1
1: 0
2: 1
3: 23
4: 187
Right 949925876 3:9041240-9041262 CTTCAAGTCTAAGTTTACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
949925868_949925876 26 Left 949925868 3:9041191-9041213 CCAAGTCCCTGCTAAGTGTAGAG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 949925876 3:9041240-9041262 CTTCAAGTCTAAGTTTACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
949925873_949925876 -5 Left 949925873 3:9041222-9041244 CCAATCCAGGTTGCCTAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 949925876 3:9041240-9041262 CTTCAAGTCTAAGTTTACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 111
949925870_949925876 20 Left 949925870 3:9041197-9041219 CCCTGCTAAGTGTAGAGTCTGGA 0: 1
1: 0
2: 0
3: 12
4: 153
Right 949925876 3:9041240-9041262 CTTCAAGTCTAAGTTTACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949925876 Original CRISPR CTTCAAGTCTAAGTTTACCC AGG Intronic
902740293 1:18433215-18433237 CCTCAAGACTCAGTTTCCCCAGG - Intergenic
904840052 1:33366922-33366944 CTTCTGGTCTAACTTTACGCAGG - Intronic
906100001 1:43254160-43254182 CTTCACCTCTAAGTCTACCTCGG - Intronic
912654797 1:111476724-111476746 CTTCCAGCTTAAGTTTCCCCAGG - Intronic
912879255 1:113391445-113391467 CTAGAGGTCTAAGATTACCCGGG - Intronic
916763113 1:167834631-167834653 CTTCAAGTCTGATCTTACCTTGG - Intronic
918117811 1:181511634-181511656 GTTCAAGGCTAAGATTCCCCAGG + Intronic
922478129 1:225920975-225920997 CTACAAGTCAAAGTTAATCCTGG + Intronic
922890272 1:229056780-229056802 CCTCAAGTCTAAGATGAGCCAGG + Intergenic
924165257 1:241274806-241274828 CTGCAAATCTAGGTTTTCCCTGG + Intronic
1071202106 10:83230416-83230438 CTTCACGTATAACTTTTCCCTGG - Intergenic
1071570667 10:86695001-86695023 CTTGAAGGCTGAGTTTCCCCAGG + Intronic
1075772087 10:124947652-124947674 CTTCAAATCTATTTTTTCCCAGG + Intronic
1076298363 10:129404841-129404863 CTTCAATTCTAAGTTGTCCATGG - Intergenic
1076832163 10:133001132-133001154 GTTCCAGTCTAAGTTTATCTGGG - Intergenic
1078307907 11:10209342-10209364 CTGCAACTCAAAGTTCACCCTGG + Intronic
1079168573 11:18069957-18069979 TTTCAAGTCTAAGTAAACTCTGG + Intronic
1082637281 11:55612022-55612044 ATTCAAGTCTAATTTCACCAAGG - Intergenic
1085069710 11:73532377-73532399 CTTAAAGGCTGAGTTTATCCAGG - Intronic
1090357857 11:126151991-126152013 CTTCAAGTCTCAGTTTTCCATGG + Intergenic
1090623535 11:128584718-128584740 CTTCACATCTAATTTTTCCCAGG + Intronic
1093858867 12:24138712-24138734 CTTCAGTTCTGAGTGTACCCAGG + Intergenic
1094765290 12:33587748-33587770 CTTAATGTCTAATTTTTCCCAGG - Intergenic
1099084167 12:78224449-78224471 CTTCAAATCTAAATTTATCCAGG + Intergenic
1099107628 12:78516581-78516603 CTTCAAGTGTAAGTGGAACCTGG + Intergenic
1100150133 12:91726580-91726602 ATGCTAGTCTAAGTTTACGCAGG - Intergenic
1102125074 12:110473545-110473567 CTTAAAGACTAAGTTCACCAAGG - Intronic
1106985578 13:35344092-35344114 CTTCAAATATAAATTTACACTGG - Intronic
1108069980 13:46618450-46618472 CTTTAATTTTAAGTTAACCCTGG + Intronic
1110345261 13:74439698-74439720 CTTCAAGACCAAGTTTAGCCAGG - Intergenic
1112604538 13:100890972-100890994 CTTCGAGTCTAAATTTTCACTGG + Intergenic
1113331976 13:109336435-109336457 CTTCAAGGCTAACTTTGCACAGG - Intergenic
1115410562 14:33069269-33069291 CTTCATCTCTAAGTTTACGAGGG - Intronic
1116694774 14:48159233-48159255 CTTGAATTTTCAGTTTACCCTGG - Intergenic
1119910548 14:78345830-78345852 TTTCAAGTCTCAGTTTCCCTCGG - Intronic
1120717088 14:87851738-87851760 CTTCAAGCCTAAGTCTTGCCAGG + Intronic
1125590704 15:40853142-40853164 CTTCAAGTCTATGCCTGCCCAGG - Exonic
1126172539 15:45706349-45706371 CTTCAATCCTAAGTGTAACCAGG - Intergenic
1127070058 15:55280307-55280329 CTTCCAGCCTGAGTTTACTCAGG + Intronic
1127758619 15:62116572-62116594 CTTTAATTCTAAGTTCATCCTGG + Intergenic
1129299933 15:74619697-74619719 CTGCAACTCTAAGTTTGACCTGG - Intronic
1135328402 16:21542488-21542510 CTTAGAGTCTCAGTTTCCCCAGG + Intergenic
1136338749 16:29628461-29628483 CTTAGAGTCTCAGTTTCCCCAGG + Intergenic
1138625336 16:58247298-58247320 CTTCATGTCTAATTTTATCTTGG - Intronic
1139696480 16:68678845-68678867 CCACAAGCCCAAGTTTACCCAGG + Exonic
1140711748 16:77685369-77685391 CTTCAATTCTGAGTTTTGCCTGG - Intergenic
1140895719 16:79322708-79322730 CTTCAAGTCCACCTTGACCCCGG - Intergenic
1142041432 16:87897026-87897048 CTTAGAGTCTCAGTTTCCCCAGG + Intronic
1145848353 17:28065069-28065091 ATTCAAGTATAAGTTTCTCCCGG - Intronic
1148050964 17:44769756-44769778 CTTCAACTCAAACTTCACCCTGG + Exonic
1150077704 17:62207237-62207259 CTTCAAGGATAAGTTTAGGCTGG + Intergenic
1153622802 18:6995392-6995414 CTTCAAGCTTAATTTTTCCCAGG + Exonic
1153998959 18:10467163-10467185 CTGCAGGTCTCAGTTTATCCAGG + Intronic
1156662810 18:39367176-39367198 CTTCTTTTCTAAGTTTAACCGGG + Intergenic
1157730253 18:49997797-49997819 CTTCAACTCTAGGTCTCCCCAGG + Intronic
1161526689 19:4760257-4760279 CCCCAAATCTAGGTTTACCCAGG - Intergenic
1168633137 19:57972828-57972850 CTTCAACTCTAAGTCTCTCCAGG - Intronic
926314630 2:11700280-11700302 GTTTAAGTCTAAGAGTACCCTGG - Intronic
927290259 2:21398051-21398073 TTTCTATTATAAGTTTACCCAGG + Intergenic
927975562 2:27335838-27335860 CTTCAACTCTAAGAATTCCCAGG + Intronic
935416696 2:102826746-102826768 CTGCATGTCTAAGATTGCCCAGG + Intronic
939626775 2:144486724-144486746 AAACAAGTGTAAGTTTACCCAGG - Intronic
942781822 2:179652902-179652924 CTTAAAGTCTTAGTTTAGGCAGG + Intronic
1170652496 20:18255756-18255778 CTCAAAGACTAATTTTACCCAGG + Intergenic
1170968582 20:21098814-21098836 CTCCAAGCCTGTGTTTACCCTGG - Intergenic
1178065987 21:28904939-28904961 CTGCAAGTCTAAGTGTTCTCAGG + Intergenic
1181760246 22:25053403-25053425 CCTCGAGTCACAGTTTACCCTGG + Intronic
1184988196 22:48150124-48150146 CTTCAAGTCTGTGTTTCCCGGGG + Intergenic
1185345374 22:50308345-50308367 CTCCAGGTCCCAGTTTACCCTGG - Intergenic
949269071 3:2193151-2193173 CTTGAAGTCTAAGTTTTCTCAGG - Intronic
949925876 3:9041240-9041262 CTTCAAGTCTAAGTTTACCCAGG + Intronic
952153240 3:30615258-30615280 CTTCAAGGCTACCTATACCCTGG + Intronic
953618809 3:44514744-44514766 ATTCATGTATAAGTTGACCCAGG - Intergenic
959362920 3:105417192-105417214 CTTGAAGAGTAAGTTTACCCAGG - Intronic
959805724 3:110551057-110551079 CTTCAAGTCTATCTATACCAGGG - Intergenic
960376561 3:116909472-116909494 CTACAAGTCTAATTTTTCCTGGG + Intronic
963999838 3:151757028-151757050 ATGCAAGTCTTACTTTACCCTGG + Exonic
964384652 3:156134650-156134672 CTTCAAGTTTATGTTTATCTTGG + Intronic
964642324 3:158922279-158922301 CTTCTGGTCTAAGTGTACACTGG - Intergenic
967671744 3:192244869-192244891 CTTCGAGTCTGAGTTTCCTCTGG + Intronic
969265648 4:6062553-6062575 TTTGATGTCTAAGTTGACCCTGG - Intronic
970596120 4:17601965-17601987 CTTCAAGTTTCAGTTTTCCTTGG + Intronic
973214137 4:47649659-47649681 ATTCAAGTCTAAGTCTACGCAGG + Intronic
975296782 4:72743816-72743838 CTTCAATTCTGAGTTTAAACTGG + Intergenic
977573415 4:98653347-98653369 CTTTAAGTGCAAGTTTATCCAGG - Intronic
979422849 4:120527813-120527835 CTACAAGTCCAAGGTGACCCTGG - Intergenic
981647155 4:147012226-147012248 CTTCCAATCTAAGTGTACCGAGG + Intergenic
983299698 4:165909294-165909316 CTACAGGTCTAAGTCAACCCTGG - Intronic
985849688 5:2379518-2379540 CTTCAAATCCAGGGTTACCCAGG - Intergenic
988922828 5:35960734-35960756 CTTCAAGTCTATGTGTGACCTGG - Intronic
989205555 5:38805927-38805949 CTTCGAGTCTCAGTTTCCCAGGG - Intergenic
993008170 5:82450865-82450887 CTTGAAGACTACGTTTACTCAGG - Intergenic
993051101 5:82926804-82926826 CCTCAAATTTAACTTTACCCTGG + Intergenic
993132611 5:83918284-83918306 CTTTAAAACTAAATTTACCCTGG + Intergenic
993461979 5:88193574-88193596 CTTAAACTCTAAGTATACTCTGG - Intronic
994339607 5:98610884-98610906 GTTTAAGTCTAAGTTTTCACTGG + Intergenic
999381222 5:151122916-151122938 CTTCAAGTCTCACTTTGGCCGGG - Exonic
1000714864 5:164629431-164629453 CTTAAGGTCTAAGTTTTCCTTGG + Intergenic
1005825714 6:29630611-29630633 CTCCAAGTCTTATTTGACCCTGG - Exonic
1008726047 6:54421045-54421067 CTTCACGTCAAAGTCTATCCTGG - Intergenic
1012936419 6:105372520-105372542 CTTCACTTCTAAATTTTCCCAGG - Intronic
1022952163 7:35349478-35349500 ATCAAAGTATAAGTTTACCCAGG + Intergenic
1026001813 7:66565347-66565369 CCTCAAGTCTAACTTTAACATGG + Intergenic
1028432011 7:90758662-90758684 CTTCAAGATTAAGTTTCCCGAGG - Intronic
1033071670 7:138208938-138208960 CTTCAATTGTAAGTTTCCCGAGG - Intergenic
1035756062 8:2033935-2033957 ATTCCAGTCCATGTTTACCCAGG + Intergenic
1035958467 8:4110035-4110057 CTTCAAGTTTCAGTCTAGCCTGG - Intronic
1036631846 8:10521459-10521481 CTCCAAGTCTAAGTTTTATCTGG - Intergenic
1037808912 8:22074569-22074591 CTTCAAGACTCAGTTTAAGCTGG - Intronic
1044753046 8:95434576-95434598 TTTCAAGCCTAAGTTAACCAGGG - Intergenic
1045250556 8:100480260-100480282 CTTAAAGTGTAAGTTTAGCCTGG - Intergenic
1050614132 9:7383924-7383946 TTTCAAATCTAAGTTTTCTCAGG + Intergenic
1050821108 9:9881440-9881462 GTTTGAGTCTAAGTTTACCAGGG + Intronic
1050916407 9:11140456-11140478 CTTCTACTCTAAGATTACCCAGG - Intergenic
1051701776 9:19831845-19831867 CTTCTATTCTAAGTTTAGCAAGG - Intergenic
1057743619 9:97734058-97734080 CCTTAACTCTAAGTTCACCCAGG + Intergenic
1059655461 9:116353628-116353650 CTTCAAGACTCAGTGTACCCAGG + Exonic
1062148287 9:135003292-135003314 CTTCAGATCTCAGTTTACCTGGG - Intergenic
1186072355 X:5835826-5835848 CCTCATGTCTAAGCTCACCCAGG - Intergenic
1189766419 X:44377124-44377146 CTTTAAGTCCATGTGTACCCAGG - Intergenic
1193427227 X:81354789-81354811 CTTCAACTCTAAGTTTTCAAAGG - Intergenic